{"search_session":{},"preferences":{"l":"en","queryLanguage":"en"},"patentId":"US_6552181_B1","frontPageModel":{"patentViewModel":{"ref":{"entityRefType":"PATENT","entityRefId":"136-867-360-110-638"},"entityMetadata":{"linkedIds":{"empty":true},"tags":[],"collections":[{"id":6802,"type":"PATENT","title":"Univ Queensland Patent Portfolio","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":8841,"tags":[],"user":{"id":91044780,"username":"Cambialens","firstName":"","lastName":"","created":"2015-05-04T00:55:26.000Z","displayName":"Cambialens","preferences":"{\"usage\":\"public\",\"beta\":false}","accountType":"PERSONAL","isOauthOnly":false},"notes":[{"id":8194,"type":"COLLECTION","user":{"id":91044780,"username":"Cambialens","firstName":"","lastName":"","created":"2015-05-04T00:55:26.000Z","displayName":"Cambialens","preferences":"{\"usage\":\"public\",\"beta\":false}","accountType":"PERSONAL","isOauthOnly":false},"text":"
Copied from Raj's collection ' Univ Queensland'
.......................
Annie's search
Search applicants = 'Univ* AND Queensl* AND NOT Technology', 'Univ* AND Queensl* AND NOT STATE', ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'.
notes: When search ' Univ* AND Queens* AND NOT Technology' only, the results came out with many patents that belong to Queensland State Government and Other universities. Hence, re set the search terms as' ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'.
Search Owners(US) = ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'
Add to collection
Select more for logical variants
Select all the patents in the collection and expand by simple families
Add to collection
Total patents = 8993
Search Applicants = 'QIMR Berghofer Medical Research Institute ' ' QIMR' ' Que* Inst Med Res' ' Qu* Inst* Med* Re' ' \"Queensland \" NEAR \" Medical research\" ' \"Queensland Institute' AND \"Medical Research\" ' The Council of Queensland Institute of Medical Research' 'The Cou* Queen* Inst* Med* Res*'
Search Owners(US) = 'QIMR Berghofer Medical Research Institute ' ' QIMR'\n ' Que* Inst Med Res' ' Qu* Inst* Med* Re' ' \"Queensland \" NEAR \" \nMedical research\" ' \"Queensland Institute' AND \"Medical Research\" 'The Council of Queensland Institute of Medical Research' 'The Cou* Queen* Inst* Med* Res* '
Select More for logical variants
Add to collection
Select all the patents in the collection and expand by simple families
Add to collection
total patents= 698
...... Annie Second search....
Search Applicants and Owners(US) respectively = 'Qu* Med* Res* Inst*', 'Inst* Qu* Med* Res*', 'Cou* Qu* Ins* Med* Res*'
Add to collection
Select all the patents in the collection and expand by simple families
Add to collection
Total patents= 767
Search applicants and owners = \"Yale univ\", \"Univ Yale\", \"Yale University\", \"University Yale\", \"Univ Yal*\", \"Yal* Univ*\", \"Yale Entrepreneurial Institute\".
Select more for logical variants
Add to collection
Select all the results in the collection and expand by simple family
Add to collection
Total patents: 7360
Copied from Raj's collection ' Univ Queensland'
.......................
Annie's search
Search applicants = 'Univ* AND Queensl* AND NOT Technology', 'Univ* AND Queensl* AND NOT STATE', ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'.
notes: When search ' Univ* AND Queens* AND NOT Technology' only, the results came out with many patents that belong to Queensland State Government and Other universities. Hence, re set the search terms as' ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'.
Search Owners(US) = ' Univ* AND Queensl* AND NOT STATE AND NOT TECHNOLOGY'
Add to collection
Select more for logical variants
Select all the patents in the collection and expand by simple families
Add to collection
Total patents = 8993
Search Applicants = 'QIMR Berghofer Medical Research Institute ' ' QIMR' ' Que* Inst Med Res' ' Qu* Inst* Med* Re' ' \"Queensland \" NEAR \" Medical research\" ' \"Queensland Institute' AND \"Medical Research\" ' The Council of Queensland Institute of Medical Research' 'The Cou* Queen* Inst* Med* Res*'
Search Owners(US) = 'QIMR Berghofer Medical Research Institute ' ' QIMR'\n ' Que* Inst Med Res' ' Qu* Inst* Med* Re' ' \"Queensland \" NEAR \" \nMedical research\" ' \"Queensland Institute' AND \"Medical Research\" 'The Council of Queensland Institute of Medical Research' 'The Cou* Queen* Inst* Med* Res* '
Select More for logical variants
Add to collection
Select all the patents in the collection and expand by simple families
Add to collection
total patents= 698
...... Annie Second search....
Search Applicants and Owners(US) respectively = 'Qu* Med* Res* Inst*', 'Inst* Qu* Med* Res*', 'Cou* Qu* Ins* Med* Res*'
Add to collection
Select all the patents in the collection and expand by simple families
Add to collection
Total patents= 767
Search applicants and owners = \"Yale univ\", \"Univ Yale\", \"Yale University\", \"University Yale\", \"Univ Yal*\", \"Yal* Univ*\", \"Yale Entrepreneurial Institute\".
Select more for logical variants
Add to collection
Select all the results in the collection and expand by simple family
Add to collection
Total patents: 7360
(a) a portion of SEQ ID NO:1 amplified from a human genomic library by primers SEQ ID NO:10 and 11,
(b) a portion of SEQ ID NO:1 amplified from a human genomic library by primers SEQ ID NO:12 and 13, and
(c) the sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGACGGCCGGCTATG (exon 2a, SEQ ID NO: 84), and
(d) a nucleic acid that differs from a portion of SEQ ID NO: 1 amplified by the primers of (a) or (b) or encoded by the sequence of (c) by encoding a protein with a conservative substitution of an amino acid relative to the sequence encoded by SEQ ID NO: 1."],"number":13,"annotation":false,"title":false,"claim":true},{"lines":["The nucleic acid of claim 13 , wherein said portion of said protein is encoded by a nucleic acid selected from the group consisting of a nucleic acid sequence amplified by primers SEQ ID NO:10 and 11, a nucleic acid sequence amplified by primers SEQ ID NO:12 and 13, and a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGACGGCCGGCTATG (exon 2a, SEQ ID NO: 84)."],"number":14,"annotation":false,"title":false,"claim":true},{"lines":["A recombinant vector comprising a nucleic acid of claim 13 ."],"number":15,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid encoding a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of
(a) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:10 and 11,
(b) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:12 and 13, and
(c) a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCACGGGTTGACGGCCGGCTATG (exon 2a, SEQ ID NO: 84), wherein:
said polypeptide, when presented as an antigen, elicits the production of an antibody which specifically binds to a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide encoded by SEQ ID NO:1."],"number":16,"annotation":false,"title":false,"claim":true},{"lines":["A recombinant vector comprising a nucleic acid of claim 16 ."],"number":17,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid, which nucleic acid encodes a human nevoid basal cell carcinoma (NBCCS) (PTC) polypeptide comprising at least 10 contiguous amino acids from a polypeptide sequence encoded by a nucleic acid selected from the group consisting of
(a) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:10 and 11,
(b) a nucleic acid sequence amplified from a human genomic library by primers SEQ ID NO:12 and 13, and
(c) a nucleic acid sequence GGAGGACGAGGAAAGGGGGGCCAGGGAAAAAAATTGATGTGAAATCCAAGCCCGCGCTCCGAGCAGGGGTTGACGGCCGGCTATG (exon 2a, SEQ ID NO: 84)."],"number":18,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid encoding a human nevoid basal cell carcinoma syndrome (NBCCS) (PTC) protein, wherein said nucleic acid has the sequence of SEQ ID NO:1."],"number":19,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid having a coding region encoding a polypeptide, which coding region has at least 98% sequence identity to a nucleic acid sequence of nucleotides 442 to 4329 of SEQ ID NO:1."],"number":20,"annotation":false,"title":false,"claim":true},{"lines":["A recombinant vector comprising the nucleic acid of claim 20 ."],"number":21,"annotation":false,"title":false,"claim":true}]}},"filters":{"npl":[],"notNpl":[],"applicant":[],"notApplicant":[],"inventor":[],"notInventor":[],"owner":[],"notOwner":[],"tags":[],"dates":[],"types":[],"notTypes":[],"j":[],"notJ":[],"fj":[],"notFj":[],"classIpcr":[],"notClassIpcr":[],"classNat":[],"notClassNat":[],"classCpc":[],"notClassCpc":[],"so":[],"notSo":[],"sat":[]},"sequenceFilters":{"s":"SEQIDNO","d":"ASCENDING","p":0,"n":10,"sp":[],"si":[],"len":[],"t":[],"loc":[]}}