Cadherin-specific Antibodies And Hybridoma Cell Lines

  • Published: Jan 28, 1997
  • Earliest Priority: Apr 17 1992
  • Family: 1
  • Cited Works: 54
  • Cited by: 59
  • Cites: 2
  • Sequences: 62
  • Additional Info: Cited Works Full text
*US5597725A*  
(12)United States Utility Patent(10)Patent No: US 5,597,725 A
  Suzuki (45)Date of Patent:Jan. 28, 1997

(54) Cadherin-specific antibodies and hybridoma cell lines  
(75)Inventor: Shintaro Suzuki, Torrance, California (US)
(73) Assignee: Doheny Eye Institute, Los Angeles, California  
Type:U.S.
( * )Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. 
(21)Appl. No.: 08/188,228 
(22)Filed: Jan. 26, 1994 
     
(51)Int. Cl.6C12N 5/12; A61K 51/10; C07K 16/00; C07K 16/28 
(52)U.S. Cl.435/328; 5 7/021; 351/722; 435/331; 435/336; 435/332; 303/873; 303/881; 038/822; 303/891; 303/892 
(58)Field of Search 530/388.1; 530/388.22; 530/389.1; 530/389.2; 530/387.3; 435/702.1; 435/172.2; 435/240.27 

        
(56)References Cited
 
 U.S. PATENT DOCUMENTS
 
 
 FOREIGN PATENT DOCUMENTS
  WO91/04745  4/1991 ( WO )
  WO92/08731  5/1992 ( WO )
 OTHER PUBLICATIONS
Staskus et al. [Virology 181:228-240 (1991)].
Suzuki et al. [Cell Regulation 2:261-270 (1991)].
Lerner [Nature 299:592-596 (1982)].
Geiger et al. [J. Cell Science 97:607-614 (1990)].
Ausubel et al., Eds., Current Protocols in Molecular Biology, Sections 6.1.1 to 6.1.4 and 6.2.1 to 6.2.3, John Wiley & Sons, New York (1987).
Behrens et al., "Dissecting Tumor Cell Invasion: Epithelial Cells Acquire Invasive Properties after the Loss of Uvomorulin-Mediated Cell-Cell Adhesion", J. Cell Biol., 108:2435-2447 (Jun. 1989).
Blaschuk et al., "Identification of a Cadherin Cell Adhesion Recognition Sequence", Devel. Biol., 139:227-229 (1990).
Civitelli et al., "Connexin43 Mediates Direct Intercellular Communication in Human Osteoblastic Cell Networks", J. Clin Invest., 91:1888-1896 (1993).
Collins et al., "Cloning and Sequence Analysis of Desmosomal Glycoproteins 2 and 3 (Desmocollins): Cadherin-like Desmosonal Adhesion Molecules with Heterogenous Cytoplasmic Domains", J. Cell Biol., 113(2):381-391 (Apr. 1991).
Detrick et al., "The Effects of N-Cadherin Misexpression on Morphogenesis in Xenopus Embryos", Neuron, 4:493-506 (Apr. 1990).
Donalies et al., "Expression of M-cadherin, A Member of the Cadherin Multigene Family, Correlates with Differentiation of Skeletal Muscle Cells", Proc. Natl. Acad. Sci. USA, 88:8024-8028 (1991).
Franke et al., "Immunolocalization of Plakoglobin in Endothelial Junctions: Identification as a Special Type of Zonulae adhaerentes", Biol. of the Cell, 59:205-218 (1987).
Franke et al., "Molecular Cloning and Amino Acid Sequence of Human Plakoglobin, the Common Junctional Plaque Protein", Proc. Natl. Acad. Sci. USA, 86:4027-4031 (1989).
Frixen et al., "E-Cadherin-Mediated Cell--Cell Adhesion Prevents Invasiveness of Human Carcinoma Cells", J. Cell Biol., 113(1):173-185 (Apr. 1991).
Fugimori et al., "Disruption of Epithelial Cell--Cell Adhesion by Exogenous Expression of a Mutated Nonfunctional N-Cadherin", Molecular Biology of the Cell, 4:37-47 (1993).
Furie et al., "Migration of Neutrophils Across Endothelial Monolayers is Stimulated by Treatment of the Monolayers with Interleukin-1 or Tumor Necrosis Factor-α", J. Immunol., 143:3309-3317 (1989).
Furie et al., "E-Selectin (Endothelial-Leukocyte Adhesion Molecule-1) is Not Required for the Migration of Neutrophils Across IL-1 Stimulated Endothelium In Vitro", J. Immunol., 148:2395-2484 (1992).
Furie et al., "Monoclonal Antibodies to Leukocyte Integrins CD11a/CD18 and CD11b/CD18 or Intercellular Adhesion Molecule-1 Inhibit Chemoattractant-Stimulated Neutrophil Transendothelial Migration In Vitro", Blood, 78:2089-2097 (1991).
Gallin et al., "Sequence Analysis of a cDNA Encoding the Liver Cell Adhesion Molecule, L-CAM", Proc. Natl. Acad. Sci. USA, 84:2808-2812 (1987).
Geiger et al., "Broad Spectrum Pan-Cadherin Antibodies, Reactive with the C-Terminal 24 Amino Acid Residues of N-Cadherin", J. Cell Science, 97:607-614 (1990).
Hatta et al., "Cloning and Expression of cDNA Encoding a Neural Calcium-Dependent Cell Adhesion Molecule: Its Identity in the Cadherin Gene Family", J. Cell. Biol., 106:873-881 (1988).
Heimark et al., "Identification of a Ca.sup.2+ -Dependent Cell--Cell Adhesion Molecule in Endothelial Cells", J. Cell Biol., 110:1745-1756 (1990).
Herrenkenecht et al., "The Uvomorulin-Anchorage Protein α Catenin is a Vinculin Homologue", Proc. Natl. Acad. Sci. USA, 88:9156-9160 (1991).
Inuzuka et al., "R-Cadherin: A Novel Ca.sup.2+ -Dependent Cell--Cell Adhesion Molecule Expressed in the Retina", Neuron, 7:69-79 (1991).
Johnson et al., "P-and E-Cadherin Are in Separate Complexes in Cells Expressing Both Cadherins", Exp. Cell. Reg. 207:252-260 (1993).
Kintner et al., "Regulation of Embryonic Cell Adhesion by the Cadherin Cytoplasmic Domain", Cell, 69:229-236 (1992).
Klambt et al., "The Drosophila Melanogaster 1(2)gl Gene Encodes a Protein Homologous to the Cadherin Cell-Adhesion Molecule Family", Devel. Biol., 133:425-436 (1989).
Koch et al., "Identification of Desmoglein, a Constitutive Desmosonal Glycoprotein, as a Member of the Cadherin Family of Cell Adhesion Molecules", Eur. J. Cell. Biol., 53:1-12 (1990).
Liaw et al., "Identification and Cloning of Two Species of Cadherins in Bovine Endothelial Cells", EMBO J., 9:2701-2708 (1990).
Mahoney et al., "The Fat Tumor Suppressor Gene in Drosophila Encodes a Novel Member of the Cadherin Gene Superfamily", Cell, 67:853-868 (1991).
Maniatis et al., Eds., Molecular Cloning: A Laboratory Manual, "Guanidinium/Cesium Chloride Method", p. 196, Cold Spring Laboratory, Cold Spring Harbor, New York (1982).
Matsunaga et al., "Guidance of Optic Nerve Fibres by N-Cadherin Adhesion Molecules", Nature, 334:62-64 (1988).
McCrea et al., "A Homolog of the armadillo Protein in Drosophila (Plakoglobin) Associated with E-Cadherin", Science, 254:1359-1361 (1991).
Nagafuchi et al., "Transformation of Cell Adhesion Properties by Exogenously Introduced E-Cadherin cDNA", Nature, 329:341-343 (1987).
Nagafuchi et al., "The 102 kd Cadherin-Associated Protein: Similarity to Vinculin and Posttranscriptional Regulation of Expression", Cell, 65:849-857 (1991).
Napolitano et al., "Molecular Cloning and Characterization of B-Cadherin, a Novel Chick Cadherin", J. Cell Biol., 113:893-905 (1991).
Nelson et al., "Identification of a Membrane-Cytoskeletal Complex Containing the Cell Adhesion Molecule Uvomorulin (E-Cadherin) Ankyrin, and Fodrin in Madin-Darby Canine Kidney Epithelial Cells", J. Cell Biol., 110:349-357 (1990).
Nose et al., "Isolation of Placental Cadherin cDNA:Identification of a Novel Gene Family of Cell--Cell Adhesion Molecules", EMBO J. 6:3655-3661 (1987).
Ozawa et al., "The Cytoplasmic Domain of the Cell Adhesion Molecule Uvomorulin Associates with Three Independent Proteins Structurally Related in Different Species", EMBO J., 8:1711-1717 (1989).
Peifer et al., "The Vertebrate Adhesive Junction Proteins β-catenin and Plakoglobin and the Drosophila Segment Polarity Gene armadillo Form a Multigene Family with Similar Properties", J. Cell Biol., 118:681-691 (1992).
Ranscht et al., "T-Cadherin, a Novel Cadherin Cell Adhesion Molecule in the Nervous System Lacks the Conserved Cytoplasmic Region", Neuron, 7:391-402 (1991).
Ringwald et al., "The Structure of Cell Adhesion Molecule Uvomorulin. Insights into the Molecular Mechanism of Ca.sup.2+ -Dependent Cell Adhesion", EMBO J., 6:3647-3653 (1987).
Sacristan et al., "Evidence for the Coexistance of Two T-cadherin Forms in the Developing Chicken Nervous System", J. Cell Biol., 111, Abstract 158a (1990).
Saiki et al., "Primer-Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase", Science, 239:487-491 (1988).
Seldin et al., "Genetic Analysis of Autoimmune gld Mice", J. Exp. Med., 167:688-693 (1988).
Shimoyama et al., "Cadherin Dysfunction in a Human Cancer Cell Line:Possible Involvement of Loss of α-Catenin Expression in Reduced Cell--Cell Adhesiveness.sup.1 ", Cancer Res., 52:5770-5774 (1992).
Suzuki et al., "Evidence for Cadherin Superfamily", J. Cell Biol., 115:Abstract 72a (1991).
Suzuki et al., "Evidence for Cadherin Superfamily", Cell. Struc. Funct., 16:605 (1991).
Takeichi, "Cadherins:A Molecular Family Important in Selective Cell--Cell Adhesion", Annu. Rev. Biochem., 59:237-252 (1990).
Takeichi, "Cadherin Cell Adhesion Receptors as a Morphogenetic Regulator", Science, 251:1451-1455 (1991).
Tanihara et al., "Molecular Cloning of Novel Cadherins from Neural Retina", Invest. Opthalmol. Vis. Sci., 32:1013 (1991).
Thomas, "Hybridization of Denatured RNA and Small DNA Fragments Transferred to Nitrocellulose", Proc. Natl. Acad. Sci. USA, 77:5201-5202 (1980).
Vleminckx et al., "Genetic Manipulation of E-Cadherin Expression by Epithelial Tumor Cells Reveals an Invasion Suppressor Role", Cell, 66:107-119 (Jul. 1991).
Yoshida-Noro et al., "Molecular Nature of the Calcium-Dependent Cell--Cell Adhesion System in Mouse Teratocarcinoma and Embryonic Cells Studied with a Monoclonal Antibody", Devel. Biol., 101:19-27 (1984).
 
(74)Primary Examiner — Donald E. Adams
 Assistant Examiner
 Attorney, Agent, or Firm — Marshall, O'Toole, Gerstein, Murray & Borun
 Exemplary claim number — 1
 Art Unit — 186

(57)

Abstract

[00001]  DNA sequences encoding novel cadherins, desginated cadherins-4 through -12, are disclosed along with methods and materials for the recombinant production of the same. Antibody substances specific for the novel cadherins and cadherin peptides are disclosed as useful for modulating the natural binding and/or regulatory activities of the cadherins.
6 Claims, 1 Drawing Sheet, and 1 Figure
   [00002]  This application is a continuation-in-part of U.S. patent application Ser. No. 08/049,460 filed on Apr. 19, 1993, now abandoned which is in turn a continuation-in-part of U.S. patent application Ser. No. 07/872,643 filed on Apr. 17, 1992 now abandoned.

FEDERAL FUNDING

   [00003]  This invention was made with government support under grant No. EY08106 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE INVENTION

   [00004]  The present invention relates, in general, to materials and methods relevant to cell-cell adhesion. More particularly, the invention relates to novel Ca.sup.2+ -dependent cell adhesion proteins, referred to as cadherins, and to polynucleotide sequences encoding the cadherins. The invention also relates to methods for inhibiting binding of the cadherins to their natural ligands/antiligands.

BACKGROUND

   [00005]  In vivo, cell-cell adhesion plays an important role in a wide range of events including morphogenesis and organ formation, leukocyte extravasion, tumor metastasis and invasion, and the formation of cell junctions. Additionally, cell-cell adhesion is crucial for the maintenance of tissue integrity, e.g., of the intestinal epithelial barrier, of the blood brain barrier and of cardiac muscle.
   [00006]  Intercellular adhesion is mediated by specific cell adhesion molecules. Cell adhesion molecules have been classified into at least three superfamilies including the immunoglobulin (Ig) superfamily, the integrin superfamily and the cadherin superfamily. All cell types that form solid tissues express some members of the cadherin superfamily suggesting that cadherins are involved in selective adhesion of most cell types.
   [00007]  Cadherins have been generally described as glycosylated integral membrane proteins that have an N-terminal extracellular domain that determines binding specificity (the N-terminal 113 amino acids appear to be directly involved in binding), a hydrophobic membrane-spanning domain and a C-terminal cytoplasmic domain (highly conserved among the members of the superfamily) that interacts with the cytoskeleton through catenins and other cytoskeleton-associated proteins. Some cadherins lack a cytoplasmic domain, however, and appear to function in cell-cell adhesion by a different mechanism than cadherins that do have a cytoplasmic domain. The cytoplasmic domain is required for the binding function of the extracellular domain in cadherins that do have a cytoplasmic domain. Binding between members of the cadherin family expressed on different cells is mainly homophilic (i.e., a member of the cadherin family binds to cadherins of its own or a closely related subclass) and Ca.sup.2+ -dependent. For recent reviews on cadherins, see Takeichi, Annu. Rev. Biochem., 59:237-252 (1990) and Takeichi, Science, 251, 1451-1455 (1991).
   [00008]  The first cadherins to be described (E-cadherin in mouse epithelial cells, L-CAM in avian liver, uvomorulin in the mouse blastocyst, and CAM 120/80 in human epithelial cells) were identified by their involvment in Ca.sup.2+ -dependent cell adhesion and by their unique immunological characteristics and tissue localization. With the later immunological identification of N-cadherin, which was found to have a different tissue distribution from E-cadherin, it became apparent that a new family of Ca.sup.2+ -dependent cell-cell adhesion molecules had been discovered.
   [00009]  The molecular cloning of the genes encoding mouse E- [see Nagafuchi et al., Nature, 329: 341-343 (1987)], chicken N- [Hatta et al., J. Cell Biol., 106: 873-881 (1988)], and mouse P-[Nose et al., EMBO J. 6: 3655-3661 (1987)] cadherins provided structural evidence that the cadherins comprised a family of cell adhesion molecules. Cloning of chicken L-CAM [Gallin et al., Proc. Natl. Acad. Sci. USA, 84: 2808-2812 (1987)] and mouse uvomorulin [Ringwald et al., EMBO J., 6: 3647-3653 (1987)] revealed that they were identical to E-cadherin. Comparisons of the amino acid sequences of E-, N-, and P-cadherins showed a level of amino acid similarity of about 45%-58% among the three subclasses. Liaw et al., EMBO J., 9: 2701-2708 (1990) describes the use of PCR with degenerate oligonucleotides based on one conserved region of E-, N- and P-cadherins to isolate N- and P-cadherin from a bovine microvascular endothelial cell cDNA. The Liaw et al., supra, results implied that there were only E-, N-, and P-cadherins because no new cadherins were identified. Also in 1990, it was reported in Heimark et al., J. Cell Biol., 110: 1745-1756 (1990) that an antibody generated to bovine aortic endothelial cells recognized an intercellular junctional molecule designated V-cadherin which had a similar molecular weight to known cadherins and was able to inhibit Ca.sup.2+ -dependent cell endothelial cell adhesion. The article did not disclose any sequence information for the protein recognized by the antibody.
   [00010]  No further cadherin genes were described until the identification of eight of the novel cadherins claimed herein was reported in Suzuki et al., Cell Regulation, 2: 261-270 (1991). Subsequently, several other cadherins were described including chicken R-cadherin [Inuzuka et al., Neuron, 7: 69-79 (1991)], mouse M-cadherin [Donalies et al., Proc. Natl. Acad. Sci. USA, 88: 8024-8028 (1991)], chicken B-cadherin [Napolitano et al., J. Cell. Biol., 113: 893-905 (1991)], and T-cadherin [chicken in Ranscht et al., Neuron, 7: 391-402 (1991) and chicken and human in Patent Cooperation Treaty (PCT) International Publication No. WO 92/08731 published on May 29, 1992].
   [00011]  The determination of the tissue expression of the various cadherins reveals that each subclass of cadherins has a unique tissue distribution pattern. For example, E-cadherin is found in epithelial tissues while N-cadherin is found in nonepithelial tissues such as neural and muscle tissue. The unique expression pattern of the different cadherins is particularly significant when the role each subclass of cadherins may play in vivo in normal events (e.g., the maintenance of the intestinal epithelial barrier) and in abnormal events (e.g., tumor metastatis or inflammation) is considered. Supression of cadherin function has been implicated in the progression of various cancers. See Shimoyama et al., Cancer Res., 52: 5770-5774 (1992). Different subclasses or combinations of subclasses of cadherins are likely to be responsible for different cell-cell adhesion events in which therapeutic detection and/or intervention may be desirable. Studies have also suggested that cadherins may have some regulatory activity in addition to adhesive activity. Matsunaga et al., Nature, 334, 62-64 (1988) reports that N-cadherin has neurite outgrowth promoting activity and Mahoney et at., Cell, 67, 853-868 (1991) reports that the Drosophila fat tumor supressor gene, another member of the cadherin superfamily, appear to regulate cell growth. Expression of the cytoplasmic domain of N-cadherin without its extracellular domain has been shown in Kintner et al., Cell, 69: 229-236 (1992) to disrupt embryonic cell adhesion and in Fugimori et al., Mol. Biol. Cell, 4: 37-47 (1993) to disrupt epithial cell adhesion. Thus, therapeutic intervention in the regulatory activities of cadherins expressed in specific tissues may also be desirable.
   [00012]  There thus continues to exist a need in the art for the identification and characterization of additional cadherins participating in cell-cell adhesion and/or regulatory events. Moreover, to the extent that cadherins might form the basis for the development of therapeutic and diagnostic agents, it is essential that the genes encoding the proteins be cloned. Information about the DNA sequences and amino acid sequences encoding the cadherins would provide for the large scale production of the proteins and for the identification of the cells/tissues naturally producing the proteins, and would permit the preparation of antibody substances or other novel binding molecules specifically reactive with the cadherins that may be useful in modulating the natural ligand/antiligand binding reactions in which the cadherins are involved.

SUMMARY OF THE INVENTION

   [00013]  The present invention provides materials and methods that are relevant to cell-cell adhesion. In one of its aspects, the present invention provides purified and isolated polynucleotide sequences (e.g., DNA and RNA, both sense and antisense strands) encoding novel cadherins, cadherin-4 through -12. Preferred polynucleotide sequences of the invention include genomic and cDNA sequences as well as wholly or partially synthesized DNA sequences, and biological replicas thereof (i.e., copies of purified and isolated DNA sequences made in vivo or in vitro using biological reagents). Biologically active vectors comprising the polynucleotide sequences are also contemplated.
   [00014]  The scientific value of the information contributed through the disclosures of the DNA and amino acid sequences of the present invention is manifest. For example, knowledge of the sequence of a cDNA encoding a cadherin makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences that encode the protein and that specify cadherin-specific expression regulating sequences such as promoters, enhancers and the like. DNA/DNA hybridization procedures utilizing the DNA sequences of the present invention also allow the isolation of DNAs encoding heterologous species proteins homologous to the rat and human cadherins specifically illustrated herein.
   [00015]  According to another aspect of the invention, host cells, especially eucaryotic and procaryotic cells, are stably transformed or transfected with the polynucleotide sequences of the invention in a manner allowing the expression of cadherin polypeptides in the cells. Host cells expressing cadherin polypeptide products, when grown in a suitable culture medium, are particularly useful for the large scale production of cadherin polypeptides, fragments and variants; thereby enabling the isolation of the desired polypeptide products from the cells or from the medium in which the cells are grown.
   [00016]  The novel cadherin proteins, fragments and variants of the invention may be obtained as isolates from natural tissue sources, but are preferably produced by recombinant procedures involving the host cells of the invention. The products may be obtained in fully or partially glycosylated, partially or wholly de-glycosylated or non-glycosylated forms, depending on the host cell selected or recombinant production and/or post-isolation processing.
   [00017]  Cadherin variants according to the invention may comprise polypeptide analogs wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss, and preferably with enhancement, of one or more of the biological activities or immunological characteristics specific for a cadherin; or (2) with specific disablement of a particular ligand/antiligand binding function of a cadherin.
   [00018]  Also contemplated by the present invention are antibody substances [e.g., monoclonal and polyclonal antibodies, chimeric and humanized antibodies, and antibody domains including Fab, Fab' and F(ab').sub.2, single chain antibodies, and Fv or single variable domains] and other binding proteins or peptides specifically react with cadherins of the invention. Antibody substances can be developed using isolated natural, recombinant or synthetic cadherin polypeptide products or host cells expressing such products on their surfaces. The antibody substances may be utilized for purifying polypeptides of the invention, for determining the tissue expression of the polypeptides and as antagonists of the ligand/antiligand binding activities of the cadherins. Specifically illustrating antibody substances of the invention are the monoclonal antibodies produced by the hybridomas designated 30Q8A, 30Q4H, 45A5G, 30S2F and 45C6A which were all deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852 on Apr. 6, 1993 and were respectively assigned ATCC Deposit Nos. HB11316, HB11317, HB11318, HB11319 and HB11320. Also illustrating antibody substances of the invention are the monoclonal antibody produced by the hybridoma designated 30T 11G which was deposited with the ATCC on Apr. 8, 1993 and was assigned ATCC Deposit No. HB11324 and the monoclonal antibody produced by the hybridoma designated 64G11F which was deposited with the ATCC on Jan. 20, 1994 and was assigned ATCC Deposit No. HB11527.
   [00019]  The DNA and amino acid sequence information provided by the present invention makes possible the systematic analysis of the structure and function of the cadherins described herein and definition of those molecules with which the cadherins will interact on extracellular and intracellular levels. The idiotypes of anti-cadherin monoclonal antibodies of the invention are representative of such molecules and may mimic natural binding proteins (peptides and polypeptides) through which the intercellular and intracellular activities of cadherins are modulated. Alternately, they may represent new classes of modulators of cadherin activities. Anti-idiotypic antibodies, in turn, may represent new classes of biologically active cadherin equivalents.
   [00020]  Methods for modulating cadherin activity may involve contacting a cadherin with an antibody (or antibody fragment), another polypeptide or peptide ligand (including peptides derived from cadherins or other proteins, or a novel peptide), or a small molecule ligand that specifically binds to a portion (extracellular or cytoplasmic) of the cadherin.

BRIEF DESCRIPTION OF THE DRAWING

   [00021]  Numerous aspects and advantages of the present invention will be apparent upon consideration of the following detailed description thereof, reference being made to the drawing wherein:
   [00022]  FIG. 1 is a bar graph illustrating the binding of polymorphonuclear neutrophils and T cells to fusion proteins comprising extracellular subdomains of cadherin-5.

DETAILED DESCRIPTION

   [00023]  The present invention is illustrated by the following examples wherein Example 1 describes the isolation of cDNA sequences encoding rat cadherins-4 through -11 and -13; Example 2 describes the isolation of cDNA sequences encoding the human homologs of rat cadherins-4, -5, -6, -8, -10, -11 and -13 and the isolation of a human cadherin not identified in rat, cadherin-12, as well as chromosome localization results for cadherin genes of the invention. Example 3 characterizes the relationship of cadherins of the invention to previously identified cadherins in terms of amino acid sequence and structure. The generation of polyclonal and monoclonal antibodies specific for cadherins of the invention and mapping of epitopes recognized by antibodies of the invention are described in Example 4. Example 5 describes the construction of expression constructs comprising cadherin-4, -5 and -8 sequences, transfection of mammalian cells with the constructs and results of cell-cell adhesion assays performed with the transfected cells. Example 6 presents the results of assays for cadherin mRNA and protein expression in various mammalian tissues, cells and cell lines. The results of in vitro transendothelial migration assays involving cadherin-5 and assays of neutrophil and T-cell binding to cadherin-5 fusion protein are described in Example 7. Example 8 describes expression of cadherin-5 in the blood-brain barrier and Example 9 describes cadherin-5 peptides that are capable of increasing endothelim permeability. Example 10 describes the association of the cytoplasmic domain of cadherin-5 with plakoglobin. Example 11 describes the preparation of chimeric cadherin-4/-5 molecules and cell-cell adhesion assays performed with L cells expressing the chimeric molecules. The disclosures of Suzuki et al., Cell Regulation, supra; Suzuki et al., J. Cell. Biol., 115, Abstract 72a (1991); Suzuki et al., Cell. Struc. Funct., 16, 605 (1991); and Tanihara et al., Invest. Ophthalmol. Vis. Sci., 32, 1013 (1991) are incorporated by reference herein for purposes of illustrating the background of the invention.

EXAMPLE 1

   [00024]  Partial cDNA clones encoding nine novel cadherins were isolated from rat brain and retina by PCR. Eight of the novel rat cadherin cDNAs were isolated using degenerate PCR primers based on highly conserved regions of the cytoplasmic domain of known cadherins and one was isolated using degenerate PCR primers based on moderately conserved regions of the extracellular domain of known cadherins.
   [00025]  A. Preparation of Rat cDNA
   [00026]  Total RNAs were prepared from rat brain by the guanidium isothiocyanate/cesium chloride method described in Maniatis et al., pp. 196 in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory (1982). Brain poly(A).sup.+ RNAs were then isolated using an Invitrogen (San Diego, Calif.) FastTrack kit. Rat retina poly(A).sup.+ RNA was purchased from Clonetech (Palo Alto, Calif.). cDNA was synthesized from the poly(A).sup.+ RNA of both rat brain and retina using a cDNA synthesis kit (Boehringer Mannheim Corporation, Indianopolis, Ind.).
   [00027]  B. Design, and Synthesis of PCR Primers Corresponding to Cadherin Cytoplasmic Domain
   [00028]  A first pair of degenerate oligonucleotide primers, listed below in IUPAC nomenclature, was designed to correspond to highly conserved sequences in the cytoplasmic domain of mouse N-, E-, and P-cadherins. Underlined sequences at the end of each oligonucleotide indicate an EcoR1 site added to the primers to facilitate cloning of the fragments generated by PCR.
   [00029]  Degenerate Primer 1
   [00030]  TAPPYD (SEQ ID NO: 1)
   [00031]  5' GAATTCACNGCNCCNCCNTAYGA 3' (SEQ ID NO: 2)
   [00032]  Degenerate Primer 2
   [00033]  FKKLAD (SEQ ID NO: 3)
   [00034]  3' AARTTYTTYRANCGNCTCTTAAG 5' (SEQ ID NO: 4)
   [00035]  The degenerate oligonucleotides were synthesized using the Applied Biosystems model 380B DNA synthesizer (Foster City, Calif.).
   [00036]  C. Design and Synthesis of PCR Primers Corresponding to Cadherin Extracellular Domain
   [00037]  A second pair of degenerate oligonucleotide primers, listed below in IUPAC nomenclature, was designed to correspond to moderately conserved sequences in the third subdomain of the extracellular domain of mouse N-, E-, and P-cadherins. The extracellular domains of the mouse N-, E- and P-cadherins have been characterized as having five internal subdomains, some of which may be involved in cadherin interaction with Ca.sup.2+. Underlined sequences at the end of each oligonucleotide indicate an EcoR1 site added to the primers to facilitate cloning of the fragments generated by PCR.
   [00038]  Degenerate Primer 3
   [00039]  K(P/G)(L/I/V)D(F/Y)E (SEQ ID NO: 5)
   [00040]  5' GAATTCAARSSNNTNGAYTWYGA 3' (SEQ ID NO: 6)
   [00041]  Degerenate Primer 4
   [00042]  (N/D)E(A/P)PXF (SEQ ID NO: 7)
   [00043]  3' TRCTYSGNGGNNNNAARCTTAAG 5' (SEQ ID NO: 8)
   [00044]  D. Cloning of cDNA Encoding Eight Novel Rat Cadherins
   [00045]  PCR amplification reactions of rat brain and retina cDNA were carried out either with degenerate primers 1 and 2 or with degenerate primers 3 and 4 under conditions essentially the same as those described in Saiki et al., Science, 239, 487-491 (1988). Briefly, 100 ng of brain or retina first strand cDNA was used as template for amplification by Taq DNA polymerase (International Bioltechnology, New Haven, Conn.) using 10 μg of each primer set per reaction. PCR reactions were initiated by adding 2 units of Taq DNA polymerase to the reaction solution, after which 35 PCR reaction cycles were carried out. Reaction cycles consisted of denaturation performed at 94° C. for 1.5 minutes, oligonucleotide annealing at 45° C. for 2 minutes, and elongation at 72° C. for 3 minutes. The resulting PCR fragments were separated by agarose gel electrophoresis, and DNA bands of the expected size were extracted from the gel and digested with EcoR1. The fragments were then cloned into the M13 vector (Boehringer Mannheim) and E. coli JM101 cells were transformed with the resulting constructs. Individual clones were then isolated and sequenced. Sequencing of the DNAs was carried out using a sequenase kit (United States Biochemicals, Cleveland, Ohio) and the resulting DNA and deduced amino acid sequences of the clones were compared to sequences of known cadherins using the Microgenie program (Beckman, Fullerton, Calif.).
   [00046]  Ten representative cDNA clones encoding cadherins were identified from the PCR reaction based on degenerate primers 1 and 2. Two clones corresponded to rat N-, and E-cadherins, but eight clones encoded previously undescribed cadherins, and were designated cadherins-4 through -11. The DNA and deduced amino acid sequences of the eight rat cytoplasmic domain cDNA clones are respectively set out in SEQ ID NOs: 9 and 10 (cadherin-4), SEQ ID NOs: 11 and 12 (cadherin-5), SEQ ID NOs: 13 and 14 (cadherin-6), SEQ ID NOs: 15 and 16 (cadherin-7), SEQ ID NOs: 17 and 18 (cadherin-8), SEQ ID NOs: 19 and 20 (cadherin-9), SEQ ID NOs: 21 and 22 (cadherin-10) and SEQ ID NOs: 23 and 24 (cadherin-11).
   [00047]  An additional novel cadherin was identified from the PCR reaction based on degenerate primers 3 and 4, and it was designated cadherin-13. The DNA and deduced amino acid sequences of the rat cadherin-13 fragment are respectively set out in SEQ ID NOs: 25 and 26.
   [00048]  The PCR reaction based on degenerate primers 3 and 4 also amplified sequences which were later determined to be fragments of the extracellular domains of rat cadherins-4, -5, -6, -8, -9, -10 and -11. The DNA and amino acid sequences of these extracellular fragments are respectively set out in SEQ ID NOs: 27 and 28 (cadherin-4), SEQ ID NOs: 29 and 30 (cadherin-5), SEQ ID NOs: 31 and 32 (cadherin-6), SEQ ID NOs: 33 and 34 (cadherin-8), SEQ ID NOs: 35 and 36 (cadherin-9), SEQ ID NOs: 37 and 38 (cadherin-10), SEQ ID NOs: 39 and 40 (cadherin-11 ).
   [00049]  Larger cadherin-8 and -10 cDNAs were isolated from a rat brain cDNA library made in Uni-ZAP vector (Stratagene, La Jolla, Calif.) using labelled cadherin-8 extracellular domain PCR fragment (SEQ ID NO: 17) or cadherin-10 extracellular domain fragment (SEQ ID NO: 21) as probes. Two types of cadherin-8 cDNA clones were isolated. The first type encodes a full length cadherin, but the second type encodes a truncated protein the sequence of which diverges from the first type of cadherin-8 clone near the N-terminus of the fifth extracellular subdomain (EC5). The truncated clone contains a short stretch of unique sequence in the N-terminus of EC5 but lacks the remainder of EC5, the transmembrane domain and the cytoplasmic domain. DNA and deduced amino acid sequences of the full length cadherin-8 clone are respectively set out in SEQ ID NOs: 41 and 42 and the DNA and deduced amino acid sequences of the truncated cadherin-8 clone are set out in SEQ ID NOs: 43 and 44. The cadherin-10 cDNA clone that was isolated has an open reading frame which begins at a region corresponding to the middle of the first-extracellular domain (EC1) of previously identified cadherins. The DNA and deduced amino acid sequences of the cadherin-10 clone are set out in SEQ ID NOs: 45 and 46.

EXAMPLE 2

   [00050]  A. Isolation of Full Length cDNAs
   [00051]  Full length cDNAs encoding human homologs of rat cadherins-4, -8, -11 and -13 and partial cDNAs encoding human homologs of rat cadherins-6 and -10 were isolated from a human fetal brain cDNA library (λZapII vector, Stratagene). A full length cDNA encoding a human homolog of rat cadherin-5 was isolated from a human placental cDNA library (λgt11 vector, Dr. Millan, La Jolla Cancer Research Foundation, La Jolla, Calif.).
   [00052]  Probes for screening the human fetal brain and placental cDNA libraries were amplified by PCR from human brain cDNA (Dr. Taketani, Kansain Medical University, Moriguchi, Osaka, Japan) using the primers described in Example 1B-C. Probes consisting of human cadherin-4, -5, -6, -8, -10 and -11 sequences were generated using degenerate primers 1 and 2 and probes consisting of human cadherin-13 sequence were generated using degenerate primers 3 and 4. Amplification of the human fetal brain cDNA with degenerate primers 3 and 4 also generated a PCR fragment encoding a cadherin not isolated from rat, designated cadherin-12.
   [00053]  PCR fragments encoding human cadherins-4, -5, -6, -8, -10, -11, -12 and -13 were labelled with .sup.32 p and used to probe the human fetal brain and placental cDNA libraries according to the plaque hybridization method described in Ausubel et at., Eds., Current Protocols in Molecular Biology, Sections 6.1.1 to 6.1.4 and 6.2.1 to 6.2.3, John Wiley & Sons, New York (1987). Positives were plaque-purified and inserts were cut out using an in vivo excision method yielding Bluescript clones. The inserts were then subcloned into the M13 vector (Boehringer Mannheim) for sequencing.
   [00054]  Inserts consisting of full length cDNAs encoding human homologs of rat cadherins-4, -8, -11, -12 (putative) and -13 and partial cDNAs encoding human homologs of rat cadherins-6 and -10 were identified in clones from the human fetal brain cDNA library and a full length cDNA encoding a human homolog of rat cadherin-5 was identified in a clone from the human placental cDNA library. The DNA and deduced amino acid sequences of the human homologs are respectively set out in SEQ ID NOs: 47 and 48 (cadherin-4), SEQ ID NOs: 49 and 50 (cadherin-5), SEQ ID NOs: 51 and 52 (cadherin-6), SEQ ID NOs: 53 and 54 (cadherin-8), SEQ ID NOs: 55 and 56 (cadherin-10), SEQ ID NOs: 57 and 58 (cadherin-11), SEQ ID NOs: 59 and 60 (cadherin-12), and SEQ ID NOs: 61 and 62 (cadherin-13).
   [00055]  Chromosome Localization
   [00056]  The chromosomal location of the cadherin-8, -10, -11 and -13 genes was determined by conventional methods.
   [00057]  Briefly, C3H/HeJ-gld and Mus spretus (Spain) mice and [(C3H/HeJ-gld x Mus spretus) F.sub.1 ×C3H/HeJ-gld] interspecies backcross mice were bred and maintained as previously described in Seldin, et al., J. Exp. Med., 167: 688-693 (1988). Mus spretus was chosen as the second parent in the cross because of the relative ease of detection of informative restriction fragment length variants (RFLVs) in comparison with crosses using conventional inbred laboratory strains. Gene linkage was determined by segregation analysis.
   [00058]  Genomic DNA isolated from mouse organs by standard techniques was digested with restriction endonucleases and 10 μg samples were electrophoresed in 0.9% agarose gels. DNA was transferred to Nytran membranes (Schleicher & Schull, Inc., Keene, N.H.), hybridized with the appropriate probe at 65° C. and washed under stringent conditions, all as previously described in Maniatis et al., supra). To localize the cadherin-8 gene, a probe corresponding to nucleotides 1999 to 2340 of SEQ ID NO: 41 was used. To localize the cadherin-10 gene, a probe corresponding to nucleotides 1034 to 1368 of SEQ ID NO: 45 was used. To localize the cadherin-11 gene, a probe corresponding to nucleotides 1590 to 1945 of SEQ ID NO: 57 was used. To localize the cadherin-13 gene a probe corresponding to nucleotides 1726 to 2195 of SEQ ID NO: 61 was used. Other clones used as probes in the current study and RFLVs used to detect anonymous DNA loci were all previously described [Chromosome 7, DNA segment, Washington 12 (D7Was12); the parathyroid hormone (Pth); calcitonin (Calc); hemoglobin, β chain (Hbb); metallothionein-I (Mt-1); adenine phosphoribosyltransferase (Aprt); growth hormone receptor (Ghr); prostaglandin E receptor EP2 subtype (Ptgerep2); dihydrofolate reductase-2 (Dhfr2); fibroblast growth factor a (Fgfa); and glucocorticoid receptor-1 (Grl-1)].
   [00059]  Comparison of the haplotype distribution of protocadherin genes with those determined for loci throughout the mouse genome allowed each to be mapped to specific regions of mouse chromosomes. The probability for linkage was >99% and indicated assignment of. The assignment of the cadherin-8, -11 and -13 genes was to mouse chromosome 8 and the assignment of the cadherin-10 gene was to mouse chromosome 15.

EXAMPLE 3

   [00060]  Comparison of the full-length sequences of the novel human cadherins described in Examples 1 and 2 with sequences of previously described cadherins and cadherin-related proteins provides support for the proposal that cadherins can be divided into at least three subgroups based on amino acid sequence identity and/or domain structure. Identity values for one possible alignment of the sequences of the extracellular domains of selected human cadherins are presented in Table 1 below. TABLE 1 ______________________________________ N E P 4 5 8 11 12 13 ______________________________________ N 100 45 45 68 30 34 35 33 46 E 45 100 53 41 29 30 29 31 37 P 45 53 100 29 30 29 31 31 38 4 68 41 41 100 29 33 34 33 44 5 30 29 30 29 100 40 41 39 32 8 34 30 29 33 40 100 66 58 32 11 35 29 31 34 41 66 100 58 31 12 33 31 31 33 39 58 58 100 33 13 46 37 38 44 32 32 31 33 100 ______________________________________
   [00061]  Based on such sequence alignments and on the fact that certain combinations of cadherin sequences seem to have conserved stretches of amino acids when aligned, one subgroup of cadherins may include E-cadherin, N-cadherin, P-cadherin and cadherin-4, while a second subgroup may include cadherin-5, cadherin-8, cadherin-11 and cadherin-12. Cadherins-6, -7, -9 and -10 may also be included with the second subgroup based on their partial amino acid sequences disclosed herein. The amino acid sequence of cadherin-4 exhibits especially high amino acid sequence identity with that of R-cadherin (92%), indicating that cadherin-4 may be the human homolog of chicken R-cadherin. All cadherins in these two subgroups have a similar structure. Following an initiation codon, each has a signal sequence, prosequence, proteolytic cleavage site of precursor protein, an extracellular domain (which comprises five subdomains EC1-5), a transmembrane sequence and a cytoplasmic domain. For cadherin-5, these sequences/domains appear to correspond to about the following amino acid positions of SEQ ID NO: 50: 1-24 (signal sequence), 25-43 (prosequence), 44-147 (EC1), 148-254 (EC2), 255-368 (EC3), 369-475 (EC4), 476-589 (EC5), 590 -616 (transmembrane sequence) and 617-780 (cytoplasmic domain).
   [00062]  Cadherin-13, T-cadherin and V-cadherin may be representative of a third subgroup of cadherins. Cadherin-13 consists of a cadherin-like extracellular domain, but has no domains that would correspond to the typical transmembrane or cytoplasmic domains of other cadherins. Even though about 10% of the clones obtained by PCR using degenerate primers 3 and 4 were cadherin-13 clones, none of the clones included sequences corresponding to a cytoplasmic domain. An attempt to isolate a cDNA that contained this region by PCR using a primer corresponding to the most C-terminal region of cadherin-13 available and a mixed oligonucleotide primer corresponding to a well-conserved amino acid sequence of the cytoplasmic domain of cadherins failed to generate any product with the anticipated molecular weight. A similar protein, T-cadherin, has been identified in chicken which aim lacks the typical cadherin cytoplasmic domain. The amino acid sequence identity between the two molecules is about 80%. Cadherin-13 may be the human homologue of chicken T-cadherin or may be a closely related molecule. Human cadherin-13 and avian T-cadherin may also both be closely related to V-cadherin. A 29-amino acid amino terminal sequence of bovine V-cadherin is similar to the start of the precursor region of cadherin-13 (93% ) and T-cadherin (79%). V-cadherin is a 135 KD protein which appears to be restricted in tissue distribution to endothelium. In constrast, mature T-cadherin (has a molecular weight of 95 KD and shows a wide tissue distribution. Both V-cadherin and T-cadherin are linked to the cell membrane through phosphoinositiol.

EXAMPLE 4

   [00063]  Polyclonal and/or monoclonal antibodies specific for cadherins of the invention were generated.
   [00064]  A. Generation of Polyclonal Antibodies
   [00065]  Bacterial fusion proteins consisting of maltose binding protein fused to portions of cadherin extracellular subdomains (either human cadherin-4, -5 or -11, or rat cadherin-8) were generated and subsequently used for the generation of polyclonal antibodies.
   [00066]  A cDNA fragment corresponding to a 40 KD portion of the extracellular domain of human cadherin-5 (nucleotides 535 to 1527 of SEQ ID NO: 49) was synthesized by PCR from the full-length human cadherin-5 cDNA described in Example 2. The fragment was subcloned into the multicloning site (EcoR1-XbaI) of the pMAL-RI plasmid vector [New England Biolabs Inc. (NEB), Beverly, Mass.]. The resulting construct encodes maltose binding protein fused to the extracellular domain of cadherin-5. Constructs encoding maltose binding protein fused to the three N-terminal subdomains of human cadherin-4, rat cadherin-8 and human cadherin-11 were generated by similar methods.
   [00067]  E. coli NM522 cells (Stratagene) were then transformed with one of the fusion protein constructs and grown in quantity. After disruption of E. coli cells, the individual fusion proteins were purified by affinity column chromatography using amylose resin (NEB) according to the instructions of the manufacturer. When subjected to SDS-PAGE, the purified fusion proteins each showed essentially one band of the expected size.
   [00068]  A total of five hundred μg of a fusion protein in Freund's complete adjuvant was injected into rabbits at four subcutaneous sites. Subsequent injections were carried out at three week intervals using 100 μg of the fusion protein in Freund's incomplete adjuvant also at four subcutaneous sites. The resulting polyclonal sera generated from immunization of rabbits with cadherin-4, -5 or -8 fusion protein were collected and tested for specificity on L cells transfected with the appropriate cadherin sequence (see Example 5). Polyclonal serum generated from immunization of rabbits with cadherin-11 was also collected.
   [00069]  Immunoblotting of various cell types showed that the The anti-cadherin-4 polyclonal serum reacts with protein of about 130 KD in L cells transfected with full length cadherin-4 cDNA and in rat brain. Cadherin-5-specific serum reacts with a protein of about 135 KD in L cells transfected with a full length cadherin-5 DNA and with a protein of about 135 KD in human umbilical vein endothelial cells (HUVEcs). The serum does not react with MDCK cells that expressed high levels of E-cadherin. In bovine aortic endothelial cells, the anti-cadherin-5 serum reacts with a protein of about 120 KD. Additionally, the anti-cadherin-5 serum reacts with a protein which has the same molecular weight in rat brain endothelial cells in culture. The cadherin-8 polyclonal antibody detected a strong band of about 90 KD and a weak band of about 130 KD in rat brain.
   [00070]  B. Generation of Monoclonal Antibodies Specific for Human Cadherin-5
   [00071]  Monoclonal antibodies to cadherin-5 were prepared using bacterial fusion proteins containing subdomains of the extracellular domain of human cadherin-5 as immunogens. The fusion proteins prepared included maltose binding protein and the extracellular subdomains 1-2 (EC1-2) or extracellular subdomains 2-4 (EC2-4) of cadherin-5 in the bacterial expression vector pMAL (NEB). The two fusion proteins were expressed in bacteria and purified on amylose-sepharose as described in foregoing section on generation of polyclonal antibodies. The purified fusion proteins were used separately to immunize mice at two subcutaneous sites (100 μg of fusion protein per mouse in Freund's complete adjuvant). The mice then were subcutaneously immunized with Freund's incomplete adjuvant.
   [00072]  The spleen from each mouse was removed by sterile methods and treated in the same manner. Briefly, a single-cell suspension was formed by grinding the spleen between the frosted ends of two glass microscope slides submerged in serum free RPMI 1640 supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin and 100 mg/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through a sterile 70-mesh cell strainer, and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI. Thymocytes taken from 3 naive Balb/c mice were prepared in a similar manner. NS-1 myeloma cells, kept in log phase in RPMI with 11% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described for the mouse spleen cells.
   [00073]  After washing, the spleen cells and myeloma cells were brought to a final volume of 10 ml in serum free RPMI, and 10 μl of that final volume was diluted 1:100 in serum free RPMI. Twenty μl of each dilution was removed, mixed with 20 μl 0.4% trypan blue stain in 0.85% saline, loaded onto a hemacytometer and counted. Two×10.sup.8 spleen cells were combined with 4×10.sup.7 NS-1 cells, centrifuged and the supernatant was aspirated. The cell pellets were dislodged by tapping the tube and 2 ml of 37° C. PEG 1500 (50% in 75 mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 ml RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI containing 15% FBS, 100 mM sodium hypoxanthine, 0.4 mM aminopterin, 16 mM thymidine (HAT) (Gibco), 25 units/ml IL-6 (Boehringer Mannheim) and 1.5×10.sup.6 thymocytes/ml (plating medium). The suspension was dispensed into ten 96-well flat bottom tissue culture plates at 200 ml/well. Cells in plates were fed on days 2, 4, and 6 days post-fusion by aspirating approximately 100 ml from each well with an 18 G needle, and adding 100 ml/well plating medium described above except containing 10 units/ml IL-6 and lacking thymocytes.
   [00074]  Fusions 30 (from a mouse immunized with EC2-4) and 45 (from a mouse immunized with EC1-2) were screened initially by antibody capture ELISA, testing for presence of mouse IgG. Secondary screening of fusions 30 and 45 consisted of assays using plates coated with a monolayer of fixed endothelial cells for ELISAs. HUVEcs, Lewis rat brain endothelial cells (LeBCE), and bovine aortic endothelial cells (BAE) were allowed to grow in 96-well flat bottom tissue culture microtiter plates until the bottom of well was completely covered with a monolayer of cells. Plates were washed twice with 100 μl/well of Ca.sup.2+ /Mg.sup.2+ free PBS (CMF-PBS) and aspirated completely. Cells were then fixed with 100 μl/well of 3% p-Formaldehyde, 1% Sucrose in CMF-PBS at room temperature for 30 minutes. Cells were then permeablized with approximately 250 μl/well of CSK buffer (0.5% Triton 100, 100 mM NaCl, 10 mM PIPES, 2 mm MgCl) and incubated at room temperature for 30 minutes. Plates were blocked with 250 μl/well of 2% BSA in 1× CMF-PBS (blocking solution) and incubated at 37° C. for 60 minutes. Blocking solution was aspirated and 50 to 100 μl/well of supernatant from fusion plates was added. Plates were incubated at room temperature for 60 minutes and then were washed one time with 250 μl/well of 0.5% BSA in CMF-PBS (wash solution 1) and two times with 250 μl/well of CMF-PBS (wash solution 2). One hundred fifty μl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, Pa.) diluted 1:3500 in PBST was added and plates were incubated at room temperature for 60 minutes. Plates were washed as before and 150 μl substrate consisting of 1 mg/ml o-phenylene diamine (Sigma Chemical Co., St. Louis, Mo.) and 0.1 ml/ml 30% H.sub.2 O.sub.2 in 100 mM Citrate, pH 4.5 was added. The color reaction was stopped after 30 minutes with the addition of 50 μl of 15% H.sub.2 SO.sub.4. A.sub.490 was read on a plate reader (Dynatech). About 20 positive wells were identified for each fusion and were subsequently cloned.
   [00075]  Hybridomas were screened in cloning steps in an ELISA assay by testing for reactivity of monoclonals to the cadherin-5 EC2-4 fusion protein and excluding maltose binding protein reactive monoclonals. Immulon 4 plates (Dynatech) were coated at 4° C. with 50 μl/well fusion protein diluted to 0.1 μg/well (for fusion protein) and to 0.2 μg/well (for maltose binding protein alone) in 50 mM carbonate buffer, pH 9.6. Plates were washed 3 times with PBS, 0.05% Tween 20 (PBST) and 50 μl hybridoma culture supernatant was added. After incubation at 37° C. for 30 minutes, and washing as above, 50 μl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson Immunoresearch) diluted 1:3500 in PBST was added. Plates were incubated at 37° C. for 30 minutes and washed 4 times with PBST. One hundred μl substrate consisting of 1 mg/ml o-phenylene diamine (Sigma) and 0.1 μl 30% H.sub.2 O.sub.2 in 100 mM citrate, pH 4.5 was added. The color reaction was stopped after 5 minutes with the addition of 50 μl of 15% H.sub.2 SO.sub.4. Absorbance at 490 nm was determined using a plate reader.
   [00076]  Fusion 64 (from a mouse immunized with EC1-2) was initially screened by antibody capture ELISA, testing for the presence of mouse IgG. Secondary screens of fusion 64 consisted of ELISAs testing for the presence of mouse IgG preferentially binding to cadherin-5 EC1-2 fusion protein over cadherin-5 EC2-4 fusion protein. Immulon 4 plates (Dynatech) were coated overnight at 4° C. with 100 ng/well EC1-2 or EC2-4 diluted in 50 mM carbonate buffer, pH 9.6. Plates were washed three times with PBS containing 0.05% Tween 20 (PBST) and 50 μl hybridoma culture supernatant was added. After incubation at 37° C. for 30 minutes, and washing as above, 50 μl of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch) diluted 1:3500 in PBST was added. Plates were incubated as above, washed 4× with PBST and 100 μl substrate consisting of 1 mg/ml o-phenylene diamine (Sigma), and 0.1 μl/ml 30% H.sub.2 O.sub.2 in 100 mM Citrate, pH 4.5, was added. The color reaction was stopped in 5 minutes with the addition of 50 μl of 15% H.sub.2 SO.sub.4. A.sub.490 was read on a plate reader (Dynatech).
   [00077]  Wells containing antibody that tested positive on EC1-2 but negative on EC2-4, were also tested for their activity on HUVEC cell lysates by Western blotting. Those monoclonal antibodies that strongly reacted with cadherin-5 by Western blotting were pursued further.
   [00078]  The hybridomas designated 30Q8A (ATCC HB11316), 30Q4H (ATCC HB11317), 45A5G (ATCC HB11318), 30S2F (ATCC HB11319), 45C6A (ATCC HB11320), 30T11G (ATCC HB11324), 30M8G, 3006E, 30R1A and 30Q6F were identified as reactive with endothelial cells and with the cadherin-5 EC2-4 fusion protein. The hybridoma designated 64G11F (ATCC HB11527) was identified as reactive with endothelial cell lysates, reactive with cadherin-5 EC 1-2 fusion protein and not reactive with cadherin-5 EC2-4 fusion protein. All hybridomas were cloned twice by limiting dilution and grown in ascites. The monoclonal antibodies produced by the hybridomas were isotyped in an ELISA assay. The results of the assay are presented in Table 2 in Section C below.
   [00079]  C. Subdomain Specificity Of C5 Specific Monoclonal Antibodies
   [00080]  To determine if the hybridomas produced monoclonal antibodies reactive with unique epitopes of the extracellular domain of C5, the monoclonal antibodies were purified, biotinylated, and tested in a cross competition ELISA. Immulon IV 96-well plates were coated with either EC1-2 or EC2-4 cadherin-5 fusion protein at 0.2 μg/ml in 50 μl 50 mM NaCO.sub.3, pH 9.6 overnight at 4° C. The wells were aspirated and washed three times with PBS/0.05% Tween 20. The plate was then blocked with 50 μl/well PBS, 2% BSA (Sigma) for 30 minutes at 37 ° C. Monoclonal antibodies were purified from hybridoma supernatants over a protein A-Sepharose column and the eluted antibody was dialyzed against 0.1M NaCO.sub.3 pH 8.2. One mg/ml of antibody was reacted with 60 μl of a 1 mg/ml stock solution in DMSO of NHS-biotin (Pierce Chemical Co., Rockford, Ill.) for 1 hour at room temperature and the reaction was stopped by dialysis overnight at 4° C. against CMF/PBS. The biotinylated antibodies in PBS/0.05% Tween 20 were then added as primary antibody (50 μl/well) to a plate coated with fusion protein and incubated for 30 minutes at 37° C. The plate was then aspirated and washed three times with PBS/0.05% Tween 20. Peroxidase-conjugated strepavidin in PBS/Tween was added 50 μl/well and incubated for 30 minutes at 37° C. The plate was aspirated and washed three times in PBS/0.05% Tween 20, and o-phenylenediamine in 100 mM citrate buffer and hydrogen peroxide was added at 100 μl/well. The plate was developed at room temperature for 5-15 minutes. The reaction was stopped with 50 μl/well 15% sulfuric acid and the plate was read on a plate reader. To confirm subdomain specificity, the cadherin-5 fusion proteins EC1-2 and EC2-4 were run on SDS-PAGE (10%) and immunoblotted with the cadherin-5 specific monoclonal antibodies.
   [00081]  Table 2 below set outs the domain specificity and isotype of the cadherin-5 specific monoclonal antibodies. TABLE 2 ______________________________________ Monoclonal Antibody C5 Subdomain Isotype ______________________________________ 64G11F 1 IgG.sub.1 30M8G 2 IgG.sub.2b 30O6E 2 IgG.sub.2b 30R1A 2 IgG.sub.2a 30Q6F 2 IgG.sub.1 30Q4H 2 IgG.sub.2b 45A5G 2 IgG.sub.1 45C6A 2 IgG.sub.1 30S2F 3-4 IgG.sub.1 30Q8A 3-4 IgG.sub.2b 30T11G 3-4 IgG.sub.1 ______________________________________
   [00082]  Competition assays were carried out as described above for assays for binding to cadherin-5 EC2-4 fusion protein except that unlabelled primary cadherin-5 specific monoclonal antibodies (or mouse IgG) were added 30 minutes prior to addition of biotinylated cadherin-5 specific monoclonal antibodies. Monoclonal antibodies produced by the hybridomas 30M8G, 3006E and 30R1A compete for a site that is near or identical to the binding site of the antibody produced by hybridoma 30Q4H.
   [00083]  D. Epitope Mapping Of Cadherin-5 Specific Monoclonal Antibodies
   [00084]  To determine the specific amino acids encoding the unique epitopes which the cadherin-5 extracellular domain-specific monoclonal antibodies recognized, the Novatope Library Construction System (Novagen Inc., Madison, Wis.) was utilized according to the instructions of the manufacturer. This system allows localization of monoclonal antibody epitopes to within 10-20 amino acids. Libraries of bacterial clones were constructed, each clone of which express a small peptide derived from the extracellular domain of human cadherin-5. The libraries were screened by standard colony lift methods using the cadherin-5 specific monoclonal antibodies as probes. Positive clones were analyzed by DNA sequencing to determine the precise amino acid sequence of the target epitope.
   [00085]  Two human cadherin-5 extracellular domain epitope libraries were constructed, one specific for domains 1-2 (EC1-2) and the other for domains 2-4 (EC2-4). DNA encoding either cadherin-5 EC1-2 or 2-4 was obtained by restriction enzyme digestion and gel purification of the appropriate insert from pMAL bacterial expression clones (described in Example 4B). DNase I was used to randomly cleave the insert DNA into fragments averaging 50 to 150 bp in size. The resulting fragments were first treated with T4 DNA polymerase to form blunt DNA ends and then with Tth DNA polymerase which adds a single dA residue to the 3' end. The prepared DNA fragments were ligated into the kit plasmid vector (pTOPE-1) which is designed for single stranded DNA sequencing. The resulting constructs were transformed into the kit NovaBlue DE3 competent cells, plated on LB agar plates containing 50 ug/ml carbenicillin and 15 ug/ml tetracycline, and grown overnight at 37° C. The EC1-2 library contained 75% recombinants and the EC2-4 library contained 40% recombinants.
   [00086]  Each cadherin-5 epitope library was plated to yield approximately 10,000 colonies with inserts. Standard colony lifts were performed using nitrocellulose filters. The bacterial colonies transferred onto the nitrocellulose filters were lysed and the protein was denatured using standard protocols. Immunoscreening of the bacterial colonies was performed using a monoclonal antibody of the invention as a probe. Monoclonal antibodies domain-mapped to cadherin-5 EC3 or EC4 were screned on the EC2-4 epitope library. Monoclonal antibodies domain-mapped to cadherin-5 EC2 were screened on both the EC 1-2 and EC2-4 epitope libraries. Positive colonies were selected, replated and rescreened to verify positive isolates. Single-stranded DNA sequencing was performed on all positive clones.
   [00087]  The DNA sequences of the positive clones resulting from the screening with one monoclonal antibody, were analyzed in a group. The translated DNA sequence of all clones was analyzed to determine the smallest region of homology shared among clones. Putative epitopes were identified as regions of 5-10 amino acids common in multiple clones. See Table 3 below for results. TABLE 3 ______________________________________ Monoclonal Cadherin-5 Antibody Subdomain Epitope ______________________________________ 30Q8A 4 DREVYPWNL (Amino acids 430 to 439 of SEQ ID NO: 50) 45C6A 2 FTHRLFN (Amino acids 147 to 153 of SEQ ID NO: 50) 30Q6F 2 VTLQDINDNFP (Amino acids 242 to 252 of SEQ ID NO: 50) 30S2F 3 GSLFVEDP (Amino acids 274 to 281 of SEQ ID NO: 50) ______________________________________
   [00088]  To confirm the identified epitopes, epitope peptides were used in a competitive ELISA assay. Peptides were ordered from Macromolecular Resources at Colorado State University in Fort Collins, Colo. Putative epitope peptides were tested for their ability to block the appropriate monoclonal antibody from binding to either cadherin-5 fusion protein or HUVECs. Competitive ELISA assays were performed on 96-well flat bottom tissue culture microtiter plates coated with a monolayer of fixed and permeabilize HUVECs. The plates were blocked using 250 μl/well of 2% BSA (Gibco, fraction 5), in 1× CMF-PBS for one hour at room temperature. The plates were then washed twice with 0.5% BSA (Gibco) in 1× CMF-PBS. Before adding the hybridoma supernatants to the plates, the various cadherin-5 monoclonal antibody supernatants were preincubated for 1 hour at room temperature with either the appropriate peptide or an irrelevant peptide as a negative control. Dilutions of all peptides were made to place 10000, 3000, 1000, 300, 100, 30, 10, 3, and 1 ng of competing peptide per well. After the preincubation, 50 μl of the supernatant/peptide mixture was transferred to the coated plates and allowed to incubate for one hour at room temperature. The plates were washed as described and then 150 μl/well of a 1/3500 dilution of horseradish peroxidase conjugated goat-anti-mouse IgG (Fc specific) (Jackson, West Grove Pa.) was added and allowed to incubate for one hour at room temperature. The plates were washed as described and 150/d/well of substrate (1 mg/ml o-phenylenediamine (Sigma,) and 0.1 μl/ml 30% H.sub.2 O.sub.2 in 100 mM citrate, pH 4.5) was added and allowed to develop for 8 minutes at room temperature. The reaction was stopped by the addition of 100 μl/well of 15% H.sub.2 SO.sub.4. The plates were read at A.sub.490 nm using a Dynatech MR5000 plate reader.
   [00089]  The results were tabulated as percent inhibition of signal caused by the competing peptide. For the 30Q8A supernatant the results were as follows: the inhibition was 90% or greater from 10000 ng/well to 100 ng/well. At 30 ng/well the inhibition was 82%; at 10 ng/well, 73%; at 3 ng/well, 34%; and at 1 ng/well, 22%. The irrelevant peptide control showed no significant inhibition of signal. For the 45C6A supernatant the results were as follows: the inhibition was 90% or greater at 10000 ng/well through 100 ng/well. At 30 ng/well the inhibition was 82%; at 10 ng/well it was 57%; at 3 ng/well it was 19%; and at 1 ng/well it was 2%. The irrelevant control peptide showed no significant pattern of inhibition of signal.

EXAMPLE 5

   [00090]  Human cadherins-4 and -5 and rat cadherin-8 were expressed in mouse fibroblast L cells (ATCC CCL1.3) which do not normally express cadherins.
   [00091]  A. Construction of Expression Vectors
   [00092]  The cDNA sequences encoding human cadherins-4 and -5 which are described in Example 2 and the cDNA sequence encoding rat cadherin-8 which is described in Example 1 were subcloned into the multicloning site of expression vector pRC/RSV (Invitrogen).
   [00093]  Cadherin-4 DNA sequences were isolated by an in vivo excision procedure from the λZapII clone (described in Example 2) containing the entire coding sequence of cadherin-4. Using a helper virus, the sequences were excised from λZapII in the form of Bluescript plasmid. The plasmid was then cut with HindIII and blunt-ended with T4 polymerase. The resulting DNA fragment was redigested with SpeI to generate a cadherin-4 cDNA fragment having a blunt end and a SpeI sticky end. The fragment was purified by agarose gel electrophoresis and subcloned into the pRC/RSV expression vector that had been previously digested with SpeI and XbaI (the XbaI end was blunt-ended with T4 polymerase).
   [00094]  The λgt11 clone containing the entire coding sequence of cadherin-5 (described in Example 2) was cut with EcoRI and the resulting fragment containing the cadherin-5 sequences was purified by agarose gel electrophoresis. The purified fragment was then subcloned into the EcoRI site of the Bluescript plasmid. Cadherin-5 sequences were cut from the resulting construct with HincII and XbaI and subcloned into the NotI-XbaI site of the pRC/RSV vector.
   [00095]  The full length cDNA encoding rat cadherin-8 was excised from the Uni-ZAP clone described in Example 1 by digestion with KpnI, followed by blunt-ending and re-digestion with SpeI. The cadherin-8 encoding fragment was purified by agarose gel electrophoresis and was subcloned into the pRC/RSV vector which had been digested with XbaI, blunt-ended and redigested with SpeI.
   [00096]  B. Transfection of L Cells
   [00097]  Mouse fibroblast L cells were transfected with the human cadherin-4and -5 and rat cadherin-8 expression constructs by a Ca.sup.2+ phosphate precipitation method and stable transfectants were obtained by G418 selection. Cadherin-4 and -8 transfectant cells showed a morphology similar to that of parental L cells (fibroblastic), but cadherin-5 transfectant cells exhibited a flattened morphology. Neuro 2a cells (ATCC CCL131) were also transfected by a Ca.sup.2+ phosphate precipitation procedure with the cadherin-4 and cadherin-8 expression constructs. Cadherin-4 transfectants showed epithelial structure, suggesting that cadherin-4 has activity in epithelial structure formation and may be involved in the neural tissue development.
   [00098]  C. Northern and Western Blot Assays of Cadherin mRNA and Protein Expression in Transfected Cells
   [00099]  Both cadherin-4, -5 and -8 transfectants showed mRNA of the expected size of 3.5 kb, 3.2 kb and 3 kb, respectively, in Northern blot analysis using the appropriate full length human cDNAs as a probe. (See Example 6A for a description of the Northern blot assay.)
   [00100]  For Western blots, cadherin-4, -5 and -8 transfectants were washed with PBS and SDS-PAGE sample buffer was added directly to the cells. SDS-PAGE (Laemmli) was carried out and gels were blotted electrophoretically onto PVDF membrane. The membranes were incubated in TBS containing 5% skim milk for 2 hours at room temperature and then were incubated with the appropriate polyclonal antibody in TBS containing 0.05% Tween 20 for 1 hour at room temperature. After four washes (of 5 minutes each) with TBS containing 0.05% Tween 20, the membranes were incubated with alkaline phosphatase conjugated anti-rabbit IgG antibody (Promega Corp., Madison, Wis.) in TBS containing 0.05% Tween 20 for 1 hour at room temperature. The membranes were then washed again four times with TBS containing 0.05% Tween 20 at room temperature and developed by using Promega Western blue. Cadherin-4, -5 and -8 polyclonal antibodies each reacted with a band of about 130 KD.
   [00101]  D. Calcium Protection from Trypsin Digestion
   [00102]  Since cadherins have been shown to be protected from trypsin digestion by Ca.sup.2+, the effect of Ca.sup.2+ on trypsin treatment (0.01% soybean trypsin for 30 minutes at 37° C.) of human cadherin-4 and -5 and rat cadherin-8 expressed on the surface of transfected L cells was examined. Two mM Ca.sup.2 + protected the cadherin-4 from the trypsin digestion, but cadherin-5 and cadherin-8 were digested easily even in the presence of 1-5 mM of Ca.sup.2+.
   [00103]  E. Cell-Cell Adhesion Assay
   [00104]  The cell-cell adhesion activity of the transfected cells was assayed by a re-aggregation assay as described in Yoshida-Noro et al., Devel. Biol., 101, 19-27 (1984). Briefly, transfectants were grown to near confluency and then dispersed into single cells with mild trypsin treatment (0.01% for 15 minutes) in the presence of 2 mM Ca.sup.2+. After washing, the trypsinized cells were incubated in Hepes buffered saline (HBS) containing 2 mM CaCl.sub.2, 1% BSA and 20 μg/ml deoxynuclease on a rotary shaker at 50 rpm for 30 to 60 minutes and then cell aggregation was monitored. Cadherin-4 transfectant cells aggregated within 30 minutes and formed relatively large aggregates, whereas cadherin-5 transfectant cells did not aggregate under the same conditions. However, cadherin-5 transfectants gradually re-aggregated and formed relatively small aggregate after prolonged incubation (4-5 hours or more). Similarly, cadherin-8 transfectants did not show significant cell adhesion activity. Parental L cells did not show cell adhesion under the same conditions. The sensitivity of cadherin-5 and cadherin-8 to trypsin digestion may account for the reduced cell adhesion seen in the reaggregation assay because the transfected L cells are initially dispersed with trypsin in the assay.

EXAMPLE 6

   [00105]  The expression of mRNAs encoding cadherins of the invention was examined in rat brain, kidney, liver, lung and skin and in various human cells by Northern blot analysis. The expression of cadherin protein was also examined in endothelial cells and leukocytes by immunofluorescence or immunoblotting.
   [00106]  A. Northern Blot Assays of Rat Tissue and Human Cells
   [00107]  Poly(A).sup.+ RNA from rat brain, kidney, liver, lung and skin was prepared as described in Example 1 for rat brain. The RNA preparations were then electrophoresed in an 0.8% agarose gel under denaturing conditions and transferred onto a nitrocellulose filter. Northern blot analyses were carried out according to a method described in Thomas, Proc. Natl. Acad. Sci. USA, 77, 5201-5202 (1980). Filters were hybridized with rat cadherin PCR fragments (described in Example 1 ) labeled with .sup.32 P, including fragments corresponding to cadherins-4 through -11. The final hybridization wash was in 0.2× standard saline citrate containing 0.1% sodium dodecyl sulfate at 65° C. for 10 minutes.
   [00108]  Cadherin-4 and cadherin-8 through -10 mRNAs were detected only in rat brain. The cadherin-8 PCR fragment hybridized to a major band of about 3.5 kb and a minor band of about 4.5 kb in rat brain. The mRNAs detected may be alternative splicing products and may correspond to the truncated and full length cadherin-8 clones described in Example 1. Cadherin-6 and -7 probes gave weak signals on rat brain mRNA even after prolonged exposure. Cadherin-5, -6 and -11 mRNAs were detected in rat brain and other rat tissues including cadherin-5 mRNA in lung and kidney, cadherin-6 mRNA in kidney, and cadherin-11 mRNA in liver.
   [00109]  The expression of cadherin-8 and -11 in cultured human SK-N-SH neuroblastoma cells (ATCC HTB11), U251MG glioma cells and Y79 retinoblastoma cells (ATCC HTB 18) was also assayed by Northern blot. Human cDNAs encoding cadherins-8 and -11 (described in Example 2) were labelled with 32P and used as probes of poly(A).sup.+ RNA prepared from the cells using an Invitrogen FastTrack kit.
   [00110]  The Northern blot procedure detected cadherin-8 RNA in the neuroblastoma and retinoblastoma cell lines, while cadherin-11 RNA was detected only in neuroblastoma cells. These results indicate that at least some of the cadherins of the invention are expressed in neurons and glial cells and/or their precursor cells.
   [00111]  Cadherin-5 RNA was detected by Northern blot assay of HUVECs (Clonetics), but was not detected in A431 human epidermoid carcinoma cells (ATCC CRL1555) or IMR90 human fibroblast cells (ATCC CCL186).
   [00112]  B. Immunoflourescence of Endothelial Cells and Immunoblotting of Leukocytes
   [00113]  Cultured endothelial cells isolated from bovine aorta, bovine brain microvasculature and human umbilical vein were subjected to immunofluorescence microscopy using anti-cadherin-5 polyclonal antibodies. Cadherin-5 protein at the cell junctions which was in close association with the peripheral actin microfilaments was labelled.
   [00114]  In contrast, when freshly isolated leukocytes (human PMN, lymphocytes and monocytes) or the monocyte-like cell line U937 were analyzed for the expression of cadherin-5 by immunoblotting using polyclonal antibodies and a monoclonal antibody (3006E) to cadherin-5, no cadherin-5 was detected. Furthermore, using a pan-cadherin antibody [Geiger et al., J. Cell Science, 97: 607-614 (1990)] specific for the cytoplasmic tail, no other cadherins were detected in these cell populations.
   [00115]  C. Expression of Cadherin-4 in Osteoblasts
   [00116]  The expression of cadherin-4 has been studied in a human model of osteoblast precursors [model described in Civitelli et al., J. Clin Invest. 91: 1888-1896 (1993)]. These cells, isolated from the bone marrow of ribs from adult donors, differentiate into more mature osteoblasts in the presence of 10.sup.-7 M dexamthasone (dex) as demonstrated by increased alkaline phosphatase activity at 1 week, expression of matrix proteins at 1-4 weeks, and induction of calcification at 4 weeks. The developing osteoblasts express cadherin-4 as assessed by Northern analysis and immunocytochemistry. By immunocytochemistry, cadherin-4 was found to be distributed to both the cell surface and the cell cytoplasm. Northern analysis confirms that cadherin-4 is expressed by these cells and also shows that steady state levels of cadherin-4 mRNA increase significantly within the first week of dex treatment.
   [00117]  Two human osteogenic sarcoma cell lines, SaOS (ATCC HTB 85) and MG-63 (ATCC CRL 1427) also express cadherin-4 as assessed by Northern analysis and immunocytochemistry.

EXAMPLE 7

   [00118]  Three in vitro transendothelial migration assays were utilized to show that cadherin-5 may participate in the movement of leukocytes across the intercellular junctions of endothelium.
   [00119]  A. Transmigration Assays
   [00120]  The migration of leukocytes (either human polymorphonuclear neutrophils or rat T cells) was followed for specific periods of time (15 minutes for PMNs and 2 hours for T cells). Immunofluorescent labeling of leukocytes using antibodies to specific cellular markers was used distinguish between leukocytes and endothelium. The polyclonal antibodies described in Example 4 were used to measure changes in the distribution of cadherin-5. An antibody (Novocastra Laboratories Ltd., United Kingdom) to PE-CAM1 (CD31) which is an intercellular junction molecule in endothelium was used as a control.
   [00121]  The role of cadherin-5 in the transmigration of polymorphonuclear neutrophils (PMNs) across HUVEcs was analyzed. The system utilized, which is described in Furie et al., J. Immunol., 143: 3309-3317 (1989), has been characterized with regard to electrical resistance of the endothelium and the adhesion molecules used in transmigration. HUVEcs were isolated in the absence of growth factor and cultured on human amniotic connective tissue in a two-chamber system. PMN migration on IL1β-treated HUVEcs has previously been shown to involve E-selectin and β.sub.2 integrins (CD11/CD18). See Furie et al., J. Immunol., 148: 2395-2484 (1992).
   [00122]  In the first assay, transmigration of PMNs was followed as an 11 minute time course on HUVEcs pretreated for four hours with IL1β (1.5 U/ml) (Collaborative Research Inc., Beford, Mass.). Prior to addition of neutrophils, antibodies to cadherin-5 heavily labelled the cell junctions of the HUVEcs in a continuous pattern. Pretreatment of the endothelial monolayer with IL1β appears to increase the distribution of cadherin-5 in the HUVEc monolayer compared to a control untreated culture. In the second assay, chemotaxis of PMNs across HUVEcs was stimulated by leukotriene B.sub.4 (LTB.sub.4) (Sigma) which was placed in the bottom chamber at 10.sup.-7 M while neutrophils were added to the upper chamber. Chemotaxis of PMNs to LTB.sub.4 across the endothelial monolayer was previously shown to be blocked by antibodies to CD11a, CD11b and ICAM-1. [See Furie et al., Blood, 78: 2089-2097 (1991)] In both assays, PMNs were identified with anti-CD45 antibody (Becton Dickinson, San Jose, Calif.).
   [00123]  In both assays during the 11-minute time course, the majority of the PMNs that adhered also transmigrated. Addition of neutrophils caused a rapid redistribution and regional loss of cadherin-5 even at the earliest time point (3 minutes). CD31 was also lost at sites of disruption of the monolayer, but in general appeared to be more stable during the transmigration process. The loss of cadherin-5 may be due to, for example, proteases released from the neutrophils during transmigration or to loss of cell surface expression of cadherin-5 as a result of loss of cell contact.
   [00124]  In a third assay, CD4 antigen activated rat T cells were utilized instead of PMNs (for a two-hour time course). Rat brain microvascular endothelium was grown on Transwell 5 micron polycarbonate membranes (Costar, Cambridge, Mass.). T cells were identified using an anti-CD4 antibody (Serotee, Indianapolis, Ind.). In this assay, the loss of cadherin-5 immunolabeling did not occur during transendothelial migration even though 10% of the T cells had crossed the endothelium after two hours. These results demonstrate differential effects of PMN versus T cells on intercellular junctions during tranendothelial migration. Analysis by con focal microscopy suggests that CD4 antigen-activated T cells and PMNs have a ligand that is able to interact with cadherin-5 on the endothelium during transmigration. Photomicrographs from confocal analysis show that during leukocyte transendothelial migration leukocytes can be found spanning the intercellular junction. The leukocyte separates the cell junction and cadherin-5 remains on adjacent cells even though the endothelial cells are not in contact.
   [00125]  B. Adhesion of PMNs and T Cells to Cadherin-5
   [00126]  To quantitate the binding of PMNs and activated T-cells to cadherin-5, a cell-substrate adhesion assay was developed. This assay utilized plate-bound fusion proteins containing various extracellular subdomains of cadherin-5 (EC1-2 or EC2-4, see Example 4) and measured the binding of dye-labelled leukocytes to cadherin-5 protein using a cytofluor 2300 (Millipore, Bedford, Mass.).
   [00127]  The purified fusion proteins were absorbed to styrene plates and the binding of dye-labeled leukocytes to the fusion proteins was compared to binding to maltose binding protein and heat denatured bovine serum albumin (BSA) which was used to block nonspecific binding. The fusion proteins were dissolved in PBS Ca.sup.2+ and Mg.sup.2+, diluted into coating buffer and incubated overnight at 4° C. The plates were blocked with heat denatured BSA and then incubated with calcien (Molecular Probes, Eugene, Oreg.)-labelled cells for 1 hour at 37° C. Results of the assay are presented in FIG. 1 wherein the relative fluorescence values reported are the mean value of three samples.
   [00128]  PMNs bound to fusion proteins comprising the EC2-4 of cadherin-5, but preferentially bound to fusion proteins comprising EC1-2. These results are consistent with presence of cadherin subdomain 2 sequences in both fusion proteins. CD4 antigen activated T cells bound EC2-4 fusion protein. All these results, which indicate that PMNs interact with a more terminal or exposed subdomain of cadherin-5, are consistent with the rate that these cell types cross the endothelium, PMNs transmigrate in a few minutes and T cells require 30-60 minutes. The binding of U937 cells could be blocked in a dose dependent manner by polyclonal antisera made to the cadherin-5 EC2-4 subdomains.
   [00129]  The results presented in the foregoing paragraph in combination with the results presented in Example 6B that leukocytes do not express cadherins suggests that the counter ligand to which cadherin-5 binds on leukocytes is a distantly related cadherin or is not a cadherin. Cadherin binding has previously been thought to be homotypic.

EXAMPLE 8

   [00130]  Expression of cadherin-5 in the blood-brain barrier in the endothelium of the cerebral cortex was assayed by Western blot and immunocytochemistry.
   [00131]  A SDS lysate was prepared by boiling bovine or macaque capillaries in SDS sample buffer for 2 minutes and then drawing the extract through a 25 G syringe needle. The extract was centrifuged in a microfuge for 15 minutes at 4 ° C. Protein concentration in the supernatant was determined by the BCA method (Pierce) using bovine serum albumin as a standard. Samples of the supernatent (75 μg) were separated by SDS-PAGE (Laemmli) and electrophoretically transferred to nitrocellulose. The nitrocellulose was blocked with 5% milk and 10% FBS in Tris-buffered saline, pH 8.0, containing 0.05% Tween 20. Cadherin-5 specific monoclonal antibodies (30Q4H and 45C6A) were added. After washing to remove unbound antibody, the filters were incubated with alkaline phosphatase-conjugated anti-mouse IgG (Promega, Madison, Wis.). Reactive bands were visualized by addition of NBT/BCIP (Sigma, St. Louis, Mo.). Expression of cadherin-5 was detected in the freshly isolated bovine and macaque capillaries.
   [00132]  The Western blot results were confirmed by immunocytochemistry using the cadherin-5 antibodies 30Q4H and 45C6A. Macaque cerebral cortex was incubated in 15% sucrose in PBS for 30 minutes at 4° C. and embedded in OCT compound (Tissue-Tek, Elkhart, Ind.) in cryomolds and quickly frozen. Six micron sections were cut and placed on glass slides. The slides were washed with PBS and fixed in 3% p-formaldehyde for 5 minutes. To permeabilize the tissue sections the slides were immersed in -20° C. acetone for 10 minutes and air dried. The sections were blocked with 2% goat serum and 1% BSA in PBS for 30 minutes and then incubated with the primary antisera for 1 hour at room temperature. The sections were rinsed 3 times in PBS containing 0.1% BSA and incubated with biotinylated anti-rabbit or anti-mouse IgG (Vector Laboratories, Burlingame, Calif.) in 1% BSA in PBS for 30 minutes. After rinsing 3 times, strepavidin-conjugated with horseradish peroxidase (Vector Laboratories) was added for 30 minutes and washed 3 times. Immunolabeling was detected by reaction with diaminobenzoic acid in the presence of NiCl.sub.2. The monoclonal antibody 45C6A only appeared to label larger vessels and the monoclonal antibody 30Q4H labeled both large and microvessels. The cell junctions of cerebral capillaries were labelled with the anti-cadherin-5 antibodies in a localized site.
   [00133]  These results and the results presented in Example 7 suggest cadherin-5 is involved in maintenance of the blood-brain barrier and that cadherin-5 peptides or cadherin-5 specific monoclonal antibodies may be able to open the blood-brain barrier.

EXAMPLE 9

   [00134]  Patent Cooperation Treaty (PCT) International Publication No. WO 91/04745 discusses fragments of cell adhesion molecules and antibodies to cell adhesion molecules which are purported to disrupt microvascular and endothelial cell tight junctions.
   [00135]  Three cadherin-5 peptides corresponding to the cell binding domain [HAV region, Blaschuk et al., Devel. Biol., 139: 227-229 (1990)], the calcium binding region A1 and the calcium binding region B1 of E-cadherin [Ringwald et al., EMBO J., 6: 3647-3653 (1987)] were tested for the ability to affect the permeability of brain endothelium. The peptides utilized had the following sequences:
[00136]  Peptide 1 (Amino acids 114 to 128 of SEQ ID NO: 50) LTAVIVDKDTGENLE,
[00137]  Peptide 2 (Amino acids 132 to 145 of SEQ ID NO: 50) SFTIKVHDVNDNWP, and
[00138]  Peptide 3 (Amino acids 168 to 178 of SEQ ID NO: 50) SVTAVDADDPT, respectively.
   [00139]  Permeability was measured using a two-chamber culture system (Costar). Rat brain microvascular endothelium was grown on 12 mm Transwell filters with 3 micron pores (Costar) in the culture system. When the monolayers were confluent, two weeks after plating, .sup.3 H-inulin (201 mCi/g) (New England Nuclear, Boston, Mass.) was added to the upper chamber. Cadherin-5 peptide at 100 μg/ml was added to both the upper and lower chambers. Radioactivity appearing in the bottom chamber was measured at 15 minute intervals over a two hour time course carried out at 37° C. and was compared to the radioactivity appearing in the bottom chamber of cultures where no peptide was added or where no endothelial cells were present.
   [00140]  Both peptides 1 and 3 increased endothelium permeability in comparison to control cultures. The increase in permeability obtained with peptide 3 was 2.5-fold and the increase with peptide 1 was 1.5-fold over the controls. Peptide 2 had no effect on permeability.

EXAMPLE 10

   [00141]  The functional properties of cadherins involve not only specific intercellular interactions, but also involve intracellular interactions with the cytoskeleton. Immunoprecipitation experiments utilizing the cadherin-5-specific rabbit polyclonal antibodies and the monoclonal antibody 30Q8A (see Example 4) were performed to determine with which proteins cadherin-5 interacts on an intracellular level.
   [00142]  Endothelial cells were metabolically labeled overnight with 50 μCi/ml of [.sup.35 S]-methionine and were then extracted with 0.5% Triton X-100 in 10mM HEPES pH 7.4, 0.15M NaCl, 2 mM EDTA, 2 mM EGTA, 1 mM phenanthroline and protease inhibitors. The inhibitors included 1 mM PMSF, 10 μg/ml aprotinin, leupeptin, pepstatin A, antipain, soybean trypsin inhibitor, 100 μg/ml chymostatin and TPCK, 40 μg/ml of TPCK and bestatin, 50 μg/ml of benzamidine, 1 mM o-vanidate and 20 mM NaF. After 20 minutes on ice, the cells were scraped and centrifuged in a microfuge for 30 minutes at 4° C. The supernatant was precleared and either polyclonal anti-cadherin-5 or normal rabbit serum was added and incubated overnight at 4° C. Protein A-sepharose (Pharmacia, Piscataway, N.J.) was added for 2 hours at 4° C. and centrifuged. A first low stringency wash with 10 mM HEPES pH 7.4, 0.15M NaCl, 2 mM EDTA and 2 mM EGTA containing 1% Triton X-100, 0.5% DOC and 0.2% SDS was performed. A second high stringency wash was performed with the same buffer containing 2% SDS. A final wash was then performed with Tris-buffered saline, and the samples were boiled and analyzed on SDS/PAGE (7%). Three bands with molecular weights of 104 KD, 95 KD, and 82 KD were identified as associated with cadherin-5.
   [00143]  Three intracellular proteins, termed catenins, have previously been identified by their ability to bind to the cytoplasmic domain of E-cadherin. These proteins have been designated α, β, and δ catenins and have molecular weights of 102 KD, 88 KD and 80 KD, respectively [Ozawa et al., EMBO J. 8: 1711-1717 (1989)]. The association of catenins with E-cadherin seem to be required for E-cadherin function because deletion of the cytoplasmic domain of E-cadherin results in loss of cell adhesion function and catenin binding. The molecular cloning of α-catenin has shown it to be a vinculin-like protein [Nagafuki et al., Cell, 65: 849-857 (1991); Herrenkenecht et al., Proc. Natl. Acad. Sci. USA, 88: 9156-9160 (1991)]. The amino acid sequence of the Xenopus β-catenin [McCrea et al., Science, 254: 1359-1361 (1991)] exhibits 63% similarity to the human protein plakoglobin [Franke et al., Proc. Natl. Acad. Sci. USA, 86: 4027-4031 (1989)]. Plakoglobin has been localized to both the cytoplasmic region of desmosome and adherens junctions in epithelial cells. The desmonsomal component desmoglein I interacts with plakoglobin and is a member of the cadherin superfamily [Koch et al., Eur. J. Cell. Biol., 53: 1-12 (1990)]. Plakoglobin has a molecular weight of 82 KD and may be the δ-catenin [Peifer et al., J. Cell Biol., 118: 681-691 (1992)]. Even though endothelial cells lack desmosome, they have been shown to contain plakoglobin-associated with intercellular junctions [Franke et al., Biol. of the Cell, 59: 205-218 (1987)]. Other cytoskeletal elements associated with cadherins are ankyrin and fodrin [Nelson et al., J. Cell Biol., 110: 349-357 (1990)].
   [00144]  A. Association of Cadherin-5 with Plakoglobin
   [00145]  To identify whether plakoglobin was one of the proteins complexed to cadherin-5, an unlabeled lysate of bovine aortic endothelial cells was made and immunoprecipitation was carried out as described above using anti-cadherin-5 antibody. The unlabelled immunoprecipitates were separated by SDS/PAGE and then electrophoretically transferred to nitrocellulose. The membrane was blocked with 5% milk in Tris-buffered saline, pH 8.0, containing 0.05% Tween 20 (TBST) and then was incubated with the murine monoclonal antibody PG5.1 (IBI Research Products, Cambridge, Mass.) to plakoglobin in blocking solution (1:20) for 1 hour at room temperature. The membrane was washed with TBST and then incubated with goat anti-mouse IgG conjugated to alkaline phosphatase. An 82 KD protein was identified using NBT/BCIP under both low and high stringency wash conditions. These results demonstrate that plakoglobin is associated with the cytoplasmic domain of cadherin-5 in endothelium. Immunofluorescence studies of regenerated endothelium show that cadherin-5 and plakoglobin are localized to the cell junctions and are coordinately regulated.
   [00146]  B. Association of Cadherins-4 and -5 with Catenins
   [00147]  Immunoprecipitations of cadherins-4 and -5 from transfected cells (Example 5) were performed. Metabolically labelled cadherin-4 and 5 transfectants were solubilized with Triton X-100 and NP40 and immunoprecipitated with the appropriate anti-cadherin-4 polyclonal antibody or anti-cadherin-5 polyclonal (or 30Q8A monoclonal) antibody. Under stringent washing conditions, cadherin-4 co-precipitated with 105 KD and 95 KD bands, whereas cadherin-5 co-precipitated with only a 95 KD band. Similar results were obtained when immunoprecipitations from HUVEcs were performed. In immunoblot analysis of the immunoprecipitated sample of cadherin-5 transfectants and HUVECS, anti-cadherin-5 antibody stained an approximately 130 KD band, anti-α-catenin antibody (IG5) stained an approximately 105 KD band, and anti-β-catenin antibody (12F7) stained an approximately 95 KD band, and antiplakoglobin antibody (PG5.1, IBL Research Product Corporation, Boston, Mass.) stained an 85 KD band. The anti-catenin antibodies are described in Johnson et al., Exp. Cell. Reg. 207: 252-260 (1993). In similar immunoblot analyses of the immunoprecipitated sample of cadherin-4 transfectants, anti-cadherin-4 antibody stained an approximately 130 KD band, anti-α-catenin antibody stained a 105 KD band, and anti-β-catenin antibody and anti-plakoglobin antibody stained 95 KD and 85 KD bands, respectively.
   [00148]  Furthermore, the levels of α-catenin, β-catenin and plakoglobin protein were significantly increased in caderin-4 and -5 transfectants when compared to levels in parental L cells.
   [00149]  The interaction of cadherins-4 and -5 with plakoglobin and the interactions of cadherins-4 and -5 with α- and β-catenin may therefore be targets for modulation of the activity of the cadherins.

EXAMPLE 11

   [00150]  As is described in Example 5, cadherin-4 transfectants exhibit a significant level of cell aggregation activity while cadherin-5 transfectants do not exhibit a significant level of cell aggregation activity under the same conditions. Therefore, the chimeric cadherin molecules comprising the extracellular and transmembrane domains of one of the two cadherins and the cytoplasmic domain of the other cadherin were constructed to investigate the role of the cadherin extracellular and cytoplasmic domains in cell-cell aggregation.
   [00151]  A. Construction of the Cadherin-4/-5 Chimeric Molecules
   [00152]  A chimeric molecule including the extracellular and transmembrane domains of cadherin-4 (amino acids 1 to 759 of SEQ ID NO: 48) and the cytoplasmic domain of cadherin-5 (amino acids 621 to 780 of SEQ ID NO: 50) was constructed and designated "chimeric cadherin-4." A chimeric molecule including the extracellular and transmembrane domains of cadherin-5 (amino acids 1 to 621 of SEQ ID NO: 50) and the cytoplasmic domain of cadherin-4 (amino acids 763 to 916 of SEQ ID NO: 48) was also constructed and was designated "chimeric cadherin-5."
   [00153]  The cDNAs containing the entire coding sequences of cadherin-4 (SEQ ID NO: 47) and cadherin-5 (SEQ ID NO: 49) were cut out from Bluescript clones described in Example 2A by HindIII digestion, followed by blunting and SpeI digestion, or by EcoRV and XbaI digestion. The cDNAs were then subcloned into the plasmid pRc/RSV digested with SpeI and XbaI or with HindIII and XbaI.
   [00154]  Chimeric cadherin-4 and chimeric cadherin-5 were prepared as follows. A MroI sequence was introduced near the N-terminus of the cadherin-4 cytoplasmic domain that corresponds to the MroI site of the cadherin-5 cytoplasmic domain by PCR using an upstream primer corresponding to 5' noncoding region of the cadherin-4 DNA and a mutagenic downstream primer corresponding to a region near the N-terminus of the cadherin-4 cytoplasmic domain and containing a MroI sequence at its 5' end. The PCR product was subcloned into the Sinai site of Bluescript SK. Next, the DNA corresponding to the cytoplasmic domain of cadherin-5 was cut from the pRc/RSV plasmid by SpeI digestion followed by blunting and MroI digestion. The resulting cadherin-5 DNA fragment was subcloned into the cadherin-4 Bluescript construct which had been digested with MroI and EcoRV downstream of cadherin-4 sequences to generate an insert encoding chimeric cadherin-4. The entire Bluescript insert encoding chimeric cadherin-4 was then subcloned into the multicloning site of the pRc/RSV vector.
   [00155]  To generate a DNA insert encoding chimeric cadherin-5, the cadherin-5 pRc/RSV plasmid was cut with MroI and XbaI and the DNA fragment including vector sequences and encoding the extracellular and transmembrane domains of cadherin-5 was purified by agarose gel electrophoresis. DNA sequences encoding the cadherin-4 cytoplasmic domain were amplified from the cadherin-4 pRc/RSV plasmid by PCR using an upstream mutagenic primer containing a MroI site at its 5' end and a downstream mutagenic primer containing XbaI site at its 3' end. The amplified product was disgested with MroI and XbaI and was subcloned into the agarose electrophoresis-purified cadherin-5 pRC/RSV plasmid fragment immediately downstream of the cadherin-5 extracellular and transmembrane domain sequences.
   [00156]  The resulting chimeric cadherin-4 and chimeric cadherin-5 constructs were then transformed into E. coli NM522 cells, and the vectors were isolated from the E. coli cells using the Quiagen plasmid purification kit (Chatsworth, Calif.).
   [00157]  L cells were then transfected with the vectors by the calcium phosphate method using a Pharmacia CellPhect transfection kit. The transfectant cells were isolated by the combination of G418 selection and fluorescence activated cell sorting (FACS) as described by Ozawa et al., supra. The chimeric cadherin-4 transfectants resembled wild type cadherin-5 transfectants in exhibiting flattened morphology while chimeric cadherin-5 transfectants were similar to cadherin-4 transfectants, suggesting a unique effect of the cadherin-5 cytoplasmic domain on cell shape. The expressed chimeric proteins were about 130 kDa in molecular weight and were localized at the cell periphery.
   [00158]  B. Cell aggregation Assay
   [00159]  Aggregation of the L cell transfectants was assayed. Briefly, single cell suspensions were prepared from monolayers by treatment with 0.01% trypsin in the presence 1 mM EGTA for 25 minutes, followed by pipetting. The resultant cells were collected by centrifugation and washed with Ca.sup.2+ -free Hepes-buffered saline (HBS). The collected cells were suspended in HBS containing 0.5% BSA. The cells were then incubated in HBS containing 0.5% BSA, 2 mM CaCl.sub.2 and 20 μg/ml of DNase for 20-60 minutes, or in a 1:1 mixture of HBS and DMEM for incubation for longer periods of time on a rotary shaker at 37° C. Parental L cells did not show significant cell aggregation for at least 3 hours under these conditions.
   [00160]  Cadherin-4 transfectants aggregated within 30 minutes in the assay (Example 5), but cadherin-5 transfectants did not aggregate under the same conditions, suggesting that the cadherin extracellular domain plays an important role domain in cell-cell aggregation activity because the cadherin-5 extracellular domain does not exhibit strong aggregation activity even when linked to the cadherin-4 cytoplasmic domain. These results indicate that cadherin-5 is functionally as well as structurally distinct from cadherin-4.
   [00161]  C. Immunoprecipitation and Immunoblot Using Cadherin-Specific Antibodies
   [00162]  Chimeric cadherin-4 co-precipitated with proteins of the same molecular weight as wild-type cadherin-5 and chimeric cadherin-5 co-precipitated with proteins of the same molecular weight as wild-type cadherin-4. See Examples 10A and 10B.
   [00163]  While the present invention has been described in terms of preferred embodiments, it is understood that variations and improvements will occur to those skilled in the art. Thus, only such limitations as appear in the appended claims should be placed on the scope of the invention. __________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 62 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: ThrAlaProProTyrAsp 15 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GAATTCACNGCNCCNCCNTAYGA23 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: PheLysLysLeuAlaAsp 15 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: GAATTCTCNGCNARYTTYTTRAA23 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "The amino acid at this position is a proline or a glycine." (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "The amino acid at this position is a leucine, an isoleucine or a valine." (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 5 (D) OTHER INFORMATION: /note= "The amino acid at this position is a phenylalanine or a tyrosine." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: LysXaaXaaAspXaaGlu 15 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GAATTCAARSSNNTNGAYTWYGA23 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 1 (D) OTHER INFORMATION: /note= "The amino acid at this position is an asparagine or an aspartic acid." (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "The amino acid at this position is an alanine or a proline." (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: XaaGluXaaProXaaPhe 15 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: GAATTCRAANNNNGGNGSYTCRT23 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 117 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: TCCCTGCTGGTCTTCGACTACGAAGGCAGCGGTTCTACTGCAGGCTCTGTCAGCTCCCTG60 AACTCCTCCAGCTCCGGGGATCAAGATTACGACTACTTGAATGACTGGGGGCCCCGG117 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: SerLeuLeuValPheAspTyrGluGlySerGlySerThrAlaGlySer 151015 ValSerSerLeuAsnSerSerSerSerGlyAspGlnAspTyrAspTyr 202530 LeuAsnAspTrpGlyProArg 35 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ACACTGCACATCTACGGCTACGAGGGCACAGAGTCCATCGCAGAGTCCCTCAGCTCCCTG60 AGCACCAATTCCTCCGACTCTGACATCGACTATGACTTCCTCAATGACTGGGGACCCAGG120 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: ThrLeuHisIleTyrGlyTyrGluGlyThrGluSerIleAlaGluSer 151015 LeuSerSerLeuSerThrAsnSerSerAspSerAspIleAspTyrAsp 202530 PheLeuAsnAspTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: TCCTTGGCCACCTATGCCTACGAAGGAACTGGCTCGGTGGCCGACTCCCTGAGCTCACTA60 GAATCAGTGACCACAGATGGAGACCAAGATTATGACTATTTGAGTGACTGGGGCCCTCGA120 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: SerLeuAlaThrTyrAlaTyrGluGlyThrGlySerValAlaAspSer 151015 LeuSerSerLeuGluSerValThrThrAspGlyAspGlnAspTyrAsp 202530 TyrLeuSerAspTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: TCGCTTCAGACTTATGCATTTGAAGGAAATGGCTCAGTAGCTGAATCTCTCAGTTCTTTA60 GATTCTAACAGCTCGAACTCTGATCAGAATTATGACTACCTTAGTGACTGGGGTCCTCTC120 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: SerLeuGlnThrTyrAlaPheGluGlyAsnGlySerValAlaGluSer 151015 LeuSerSerLeuAspSerAsnSerSerAsnSerAspGlnAsnTyrAsp 202530 TyrLeuSerAspTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: TCCATTCAGATTTATGGCTATGAAGGCCGAGGGTCTGTGGCTGGCTCTCTCAGCTCGTTG60 GAGTCCACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGGTCCCCGC120 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: SerIleGlnIleTyrGlyTyrGluGlyArgGlySerValAlaGlySer 151015 LeuSerSerLeuGluSerThrThrSerAspSerAspGlnAsnPheAsp 202530 TyrLeuSerAspTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: TCCTTGGCCACTTACGCCTATGAAGGGAATGATTCTGTAGCCAATTCTCTCAGCTCCTTA60 GAATCTCTCACAGCTGATTGTACCCAGGATTATGACTACCTTAGTGACTGGGGGCCACGC120 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: SerLeuAlaThrTyrAlaTyrGluGlyAsnAspSerValAlaAsnSer 151015 LeuSerSerLeuGluSerLeuThrAlaAspCysAsnGlnAspTyrAsp 202530 TyrLeuSerAspTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: TCGCTGGCTACCTATGCCTATGAAGGAAACGACTCTGTTGCTGAATCTCTGAGCTCCTTA60 GAATCAGGTACCACTGAAGGAGACCAAAACTACGATTACCTTCGAGAATGGGGGCCTCGG120 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: SerLeuAlaThrTyrAlaTyrGluGlyAsnAspSerValAlaGluSer 151015 LeuSerSerLeuGluSerGlyThrThrGluGlyAspGlnAsnTyrAsp 202530 TyrLeuArgGluTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 120 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: TCCATCCAAATCTATGGTTATGAGGGCAGGGGTTCCGTGGCTGGGTCCCTGAGCTCCTTG60 GAGTCTGCCACCACAGATTCGGACCTGGACTACGACTATCTACAGAACTGGGGACCTCGG120 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: SerIleGlnIleTyrGlyTyrGluGlyArgGlySerValAlaGlySer 151015 LeuSerSerLeuGluSerAlaThrThrAspSerAspLeuAspTyrAsp 202530 TyrLeuGlnAsnTrpGlyProArg 3540 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 150 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: AAGCGGTTTGATTACGAGATCTCTGCCTTTCACACCCTGCTGATCAAAGTGGAGAATGAG60 GACCCATTGGTACCCGACGTCTCCTATGGCCCCAGCTCCACGGCCACTGTCCACATCACG120 GTCTTGGATGTCAACGAGGGACCAGTCTTC150 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: LysArgPheAspTyrGluIleSerAlaPheHisThrLeuLeuIleLys 151015 ValGluAsnGluAspProLeuValProAspValSerTyrGlyProSer 202530 SerThrAlaThrValHisIleThrValLeuAspValAsnGluGlyPro 354045 ValPhe 50 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 150 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: AAGGGTATGGATTATGAGCTGAACCGTGCCTCCATGCTGACCATAATGGTGTCCAACCAG60 GCGCCCCTGGCCAGCGGGATCCAGATGTCCTTCCAGTCCACAGTGGGGGTAACCATCTCT120 GTCACCGATGTCAACGAAGCCCCCTACTTC150 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: LysGlyMetAspTyrGluLeuAsnArgAlaSerMetLeuThrIleMet 151015 ValSerAsnGlnAlaProLeuAlaSerGlyIleGlnMetSerPheGln 202530 SerThrValGlyValThrIleSerValThrAspValAsnGluAlaPro 354045 TyrPhe 50 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: AAACGACTGGATTTTGAACTCATCCAGCAGTACACGTTCCACATCGAGGCCACAGACCCC60 ACTATCAGACTCGGATACCTGAGCAGCACTGCGGGCAAAAACAAAGCCAAGATCATCATC120 AATGTCCTAGATGTGGATGAGCCCCCTGTTTTC153 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: LysArgLeuAspPheGluLeuIleGlnGlnTyrThrPheHisIleGlu 151015 AlaThrAspProThrIleArgLeuGlyTyrLeuSerSerThrAlaGly 202530 LysAsnLysAlaLysIleIleIleAsnValLeuAspValAspGluPro 354045 ProValPhe 50 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: AAGGGTTTGGATTTTGAAAAGAAGAAAGTGTATACCCTTAAAGTGGAAGCCTCCAATCCT60 TATGTTGAGCCACGATTTCTCTACTTGGGGCCTTTCAAAGATTCAGCCACGGTTAGAATT120 GTGGTGGAGGATGTAGATGAACCTCCTGCCTTC153 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: LysGlyLeuAspPheGluLysLysLysValTyrThrLeuLysValGlu 151015 AlaSerAsnProTyrValGluProArgPheLeuTyrLeuGlyProPhe 202530 LysAspSerAlaThrValArgIleValValGluAspValAspGluPro 354045 ProAlaPhe 50 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: AAGCCTCTGGACTTTGAGACCAAAAAATCCTATACTCTGAAGGTGGAGGCAGCCAATATC60 CACATCGACCCACGTTTCAGTGGCAGGGGACCCTTTAAAGATACAGCAACAGTCAAAATT120 GTTGTAGAGGATGCTGATGAGCCTCCGGTCTTC153 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: AspAlaLeuAspPheGluThrLysLysSerTyrThrLeuLysValGlu 151015 AlaAlaAsnIleHisIleAspProArgPheSerGlyArgGlyProPhe 202530 LysAspThrAlaThrValLysIleValValGluAspAlaAspGluPro 354045 ProValPhe 50 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 152 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: AAGGGGGTGGACTATGAAGCCAAAACAAGTTATACCCTGCGCATAGAAGCTGCAAATCGA60 GATGCTGATCCCCGGTTTCTGAGCTTGGGTCCATTCAGTGACACAACAACAGTTAAGATA120 ATTGTGGAAGACGTGGATGAACCCCCGTACTC152 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: LysGlyValAspTyrGluAlaLysThrSerTyrThrLeuArgIleGlu 151015 AlaAlaAsnArgAspAlaAspProArgPheLeuSerLeuGlyProPhe 202530 SerAspThrThrThrValLysIleIleValGluAspValAspGluPro 354045 ProTyrSer 50 (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: AAGCCACTTGACTATGAGAACCGAAGACTATATACACTGAAGGTGGAGGCAGAAAATACC60 CATGTGGATCCACGTTTTTACTATTTAGGGCCATTCAAAGATACAACAATTGTAAAAATC120 TCCATAGAAGACGTGGATGAGCCACCCCCCTTT153 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: LysProLeuAspTyrGluAsnArgArgLeuTyrThrLeuLysValGlu 151015 AlaGluAsnThrHisValAspProArgPheTyrTyrLeuGlyProPhe 202530 LysAspThrThrIleValLysIleSerIleGluAspValAspGluPro 354045 ProProPhe 50 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: AGGGGTGTGGATTATGAAACCAAAAGAGCATATAGCTTGAAGGTAGAGGCGGCCAATGTA60 CACATTGATCCGAAGTTCATCAGCAATGGACCTTTCAAGGACACAGTGACTGTCAAGATT120 GCAGTAGAAGATGCCAATGAGCCCCCTCCCTTC153 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: ArgGlyValAspTyrGluThrLysArgAlaTyrSerLeuLysValGlu 151015 AlaAlaAsnValHisIleAspProLysPheIleSerAsnGlyProPhe 202530 LysAspThrValThrValLysIleAlaValGluAspAlaAsnGluPro 354045 ProProPhe 50 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3136 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: GGCACGAGCGCAAGCCGGGGAGCGCTCGGCCCAGAATTAGTGGATGGATTTGGAATCTCC60 CTGCCTCCTCCAAGCTCCGCCACTGCCACTTTAGGCAGAGACCTGAGCGTCAACACGCGA120 GCCGTACTTTTAGGCTGCGGACACTGAGCCCAGCGCGCCAGCTTCGCATCTCCGCACCAG180 GCTCCACAGCTCGGAGAGGCATGAACGCGATCCGGAGGAGACTACCCTGCGCGCGGGGAT240 CCGTGGACATTAGCCGCTCTCGGGAACTGACCCCCAGCTCCTTCAGCCATTTATGAATCC300 AGAGGCTTGAGATTTTTTTCCGCATCCCGGAGCCCGACCTGAGAAATTTCAATGAAAAGG360 AAAGTCAATGGATCGTGGTCTTGGAAAAGCTGCTTAGACATGTCTGTTTCCCGGCTCTCT420 GAACCCGTGGCAGAGCTGTAAGTAAGCGCTTCACAGTGCGTGATGAATTGGATGGCTTCG480 GACCCGAGGCAAAAAAAATAATTGTCTCATTTTCGTGCTGATTTGCTTAACTGGTGGGAC540 CATGCCAGAAAGGCTAGCTGAGACGCTTTTGGACCTCTGGACTCCATTAATAATATTATG600 GATTACTCTTCCCTCTTTTGTGTACATGGCTCCGATGAATCAGGCTCACGTTTTAACTAC660 TGGATCCCCTTTGGAACTAAGCAGGCAGAGTGAAGAAATGCGGATTTTGAACCGCTCCAA720 AAGAGGTTGGGTTTGGAATCAAATGTTTGTTCTGGAAGAATTTTCTGGACCTGAACCGAT780 TCTCGTTGGCCGGTTACACACAGATCTGGATCCTGGGAGCAAAAAAATCAAGTATATCCT840 ATCGGGTGATGGAGCCGGCACAATCTTTCAAATAAACGATATAACTGGAGACATCCATGC900 TATCAAAAGACTTGACCGAGAGGAAAAGGCTGAGTATACGTTAACAGCTCAGGCAGTGGA960 CTGGGAGACAAACAAACCTCTCGAGCCTCCTTCTGAATTTATTATTAAGGTTCAAGACAT1020 CAACGACAATGCCCCCGAGTTTCTCAATGGACCTTACCATGCTACTGTTCCAGAGATGTC1080 CATCTTGGGTACATCTGTCACTAATGTAACGGCCACTGATGCTGACGATCCAGTTTATGG1140 AAACAGTGCAAAGTTGGTTTACAGTATCTTGGAGGGACAGCCGTATTTTTCCATTGAGCC1200 TGAAACAGCTATTATAAAAACTGCCCTTCCTAACATGGACAGAGAGGCCAAGGAGGAATA1260 CCTGGTTGTAATTCAAGCCAAAGATATGGGTGGGCATTCCGGTGGTCTGTCTGGAACCAC1320 GACACTCACAGTGACGCTTACCGATGTGAATGACAATCCTCCAAAATTTGCTCAAAGTTT1380 GTATCACTTCTCAGTACCAGAAGATGTGGTCCTTGGCACTGCAATAGGAAGGGTTAAAGC1440 CAATGACCAGGATATTGGTGAAAATGCACAATCTTCCTATGACATCATTGATGGAGATGG1500 GACAGCACTATTTGAAATCACTTCTGATGCCCAGGCACAGGATGGTGTTATAAGACTAAG1560 AAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACTCTGAAGGTGGAGGCAGCCAATAT1620 CCACATCGACCCACGTTTCAGTGGCAGGGGACCCTTTAAAGATACAGCAACAGTCAAAAT1680 TGTTGTAGAGGATGCTGATGAGCCTCCGGTCTTCTCTTCACCGACTTACCTCCTTGAAGT1740 TCATGAAAATGCTGCCTTGAACTCTGTGATTGGCCAAGTGACAGCTCGTGACCCTGATAT1800 CACTTCCAGCCCAATAAGGTTTTCCATTGACCGCCACACTGACTTGGAGAGACAGTTCAA1860 CATCAATGCAGATGATGGGAAGATAACACTGGCGACCCCACTGGACAGAGAACTAAGTGT1920 GTGGCACAACATCTCCATCATTGCTACTGAGATCAGGAACCACAGTCAGATATCGCGAGT1980 GCCTGTTGCTATTAAAGTGCTGGATGTCAATGACAACGCCCCTGAATTCGCGTCCGAATA2040 TGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTCATTCAAACAGTAAGCGCCAT2100 GGACAAAGACGATCCCAAAAATGGACATTTTTTCTTGTACAGTCTTCTTCCAGAAATGGT2160 CAACAACCCAAATTTCACCATCAAGAAAAACGAAGATAATTCCCTGAGCATTCTGGCAAA2220 ACATAATGGATTCAACCGCCAGAAGCAAGAAGTCTACCTTCTGCCTATCGTGATCAGTGA2280 CAGTGGGAACCCCCCTCTGAGTAGCACCAGTACCCTGACCATCCGCGTCTGTGGCTGTAG2340 CAATGACGGCGTGGTTCAGTCGTGCAATGTCGAAGCTTATGTCCTTCCTATTGGGCTCAG2400 TATGGGCGCGTTAATTGCTATATTAGCCTGCATCATTTTGCTGCTCGTCATTGTGGTTCT2460 GTTCGTTACCCTGAGGCGGCATAAAAATGAACCACTAATAATCAAAGATGATGAAGACGT2520 TCGAGAAAACATCATTCGCTACGACGACGAAGGAGGCGGGGAGGAGGACACAGAGGCTTT2580 TGACATTGCAACTTTGCAAAACCCAGATGGAATTAATGGATTTTTACCCCGTAAGGATAT2640 TAAACCAGATTTGCAGTTTATGCCAAGGCAAGGGCTTGCTCCAGTTCCAAATGGTGTTGA2700 TGTCGATGAATTTATAAATGTAAGGCTTCATGAGGCAGATAATGACCCCACGGCCCCACC2760 ATATGACTCCATTCAGATTTATGGCTATGAAGGCCGAGGGTCTGTGGCTGGCTCTCTCAG2820 CTCGTTGGAGTCCACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGG2880 TCCCCGCTTTAAGAGACTGGGCGAACTCTACTCTGTTGGTGAAAGTGACAAAGAAACTTG2940 ACAGTGGATTACATAAATAATCAATGGAACTGAGCATTCTGTAATATTCTAGGGTCACTC3000 CCCTTAGATGCAACAAATGTGGCTATTTGTTTTAGAGGCAAGTTTAGCACCAATCATCTA3060 TAAACTCAACCACATTTTAATGTTGAACCAAAAAAAATAATAAAAAATAAAAAGTATATG3120 TTAGGAGGTGAAAAAA3136 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 799 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: MetProGluArgLeuAlaGluThrLeuLeuAspLeuTrpThrProLeu 151015 IleIleLeuTrpIleThrLeuProSerPheValTyrMetAlaProMet 202530 AsnGlnAlaHisValLeuThrThrGlySerProLeuGluLeuSerArg 354045 GlnSerGluGluMetArgIleLeuAsnArgSerLysArgGlyTrpVal 505560 TrpAsnGlnMetPheValLeuGluGluPheSerGlyProGluProIle 65707580 LeuValGlyArgLeuHisThrAspLeuAspProGlySerLysLysIle 859095 LysTyrIleLeuSerGlyAspGlyAlaGlyThrIlePheGlnIleAsn 100105110 AspIleThrGlyAspIleHisAlaIleLysArgLeuAspArgGluGlu 115120125 LysAlaGluTyrThrLeuThrAlaGlnAlaValAspTrpGluThrAsn 130135140 LysProLeuGluProProSerGluPheIleIleLysValGlnAspIle 145150155160 AsnAspAsnAlaProGluPheLeuAsnGlyProTyrHisAlaThrVal 165170175 ProGluMetSerIleLeuGlyThrSerValThrAsnValThrAlaThr 180185190 AspAlaAspAspProValTyrGlyAsnSerAlaLysLeuValTyrSer 195200205 IleLeuGluGlyGlnProTyrPheSerIleGluProGluThrAlaIle 210215220 IleLysThrAlaLeuProAsnMetAspArgGluAlaLysGluGluTyr 225230235240 LeuValValIleGlnAlaLysAspMetGlyGlyHisSerGlyGlyLeu 245250255 SerGlyThrThrThrLeuThrValThrLeuThrAspValAsnAspAsn 260265270 ProProLysPheAlaGlnSerLeuTyrHisPheSerValProGluAsp 275280285 ValValLeuGlyThrAlaIleGlyArgValLysAlaAsnAspGlnAsp 290295300 IleGlyGluAsnAlaGlnSerSerTyrAspIleIleAspGlyAspGly 305310315320 ThrAlaLeuPheGluIleThrSerAspAlaGlnAlaGlnAspGlyVal 325330335 IleArgLeuArgLysProLeuAspPheGluThrLysLysSerTyrThr 340345350 LeuLysValGluAlaAlaAsnIleHisIleAspProArgPheSerGly 355360365 ArgGlyProPheLysAspThrAlaThrValLysIleValValGluAsp 370375380 AlaAspGluProProValPheSerSerProThrTyrLeuLeuGluVal 385390395400 HisGluAsnAlaAlaLeuAsnSerValIleGlyGlnValThrAlaArg 405410415 AspProAspIleThrSerSerProIleArgPheSerIleAspArgHis 420425430 ThrAspLeuGluArgGlnPheAsnIleAsnAlaAspAspGlyLysIle 435440445 ThrLeuAlaThrProLeuAspArgGluLeuSerValTrpHisAsnIle 450455460 SerIleIleAlaThrGluIleArgAsnHisSerGlnIleSerArgVal 465470475480 ProValAlaIleLysValLeuAspValAsnAspAsnAlaProGluPhe 485490495 AlaSerGluTyrGluAlaPheLeuCysGluAsnGlyLysProGlyGln 500505510 ValIleGlnThrValSerAlaMetAspLysAspAspProLysAsnGly 515520525 HisPhePheLeuTyrSerLeuLeuProGluMetValAsnAsnProAsn 530535540 PheThrIleLysLysAsnGluAspAsnSerLeuSerIleLeuAlaLys 545550555560 HisAsnGlyPheAsnArgGlnLysGlnGluValTyrLeuLeuProIle 565570575 ValIleSerAspSerGlyAsnProProLeuSerSerThrSerThrLeu 580585590 ThrIleArgValCysGlyCysSerAsnAspGlyValValGlnSerCys 595600605 AsnValGluAlaTyrValLeuProIleGlyLeuSerMetGlyAlaLeu 610615620 IleAlaIleLeuAlaCysIleIleLeuLeuLeuValIleValValLeu 625630635640 PheValThrLeuArgArgHisLysAsnGluProLeuIleIleLysAsp 645650655 AspGluAspValArgGluAsnIleIleArgTyrAspAspGluGlyGly 660665670 GlyGluGluAspThrGluAlaPheAspIleAlaThrLeuGlnAsnPro 675680685 AspGlyIleAsnGlyPheLeuProArgLysAspIleLysProAspLeu 690695700 GlnPheMetProArgGlnGlyLeuAlaProValProAsnGlyValAsp 705710715720 ValAspGluPheIleAsnValArgLeuHisGluAlaAspAsnAspPro 725730735 ThrAlaProProTyrAspSerIleGlnIleTyrGlyTyrGluGlyArg 740745750 GlySerValAlaGlySerLeuSerSerLeuGluSerThrThrSerAsp 755760765 SerAspGlnAsnPheAspTyrLeuSerAspTrpGlyProArgPheLys 770775780 ArgLeuGlyGluLeuTyrSerValGlyGluSerAspLysGluThr 785790795 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3043 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: GGCACGAGCGCAAGCCGGGGAGCGCTCGGCCCAGAATTAGTGGATGGATTTGGAATCTCC60 CTGCCTCCTCCAAGCTCCGCCACTGCCACTTTAGGCAGAGACCTGAGCGTCAACACGCGA120 GCCGTACTTTTAGGCTGCGGACACTGAGCCCAGCGCGCCAGCTTCGCATCTCCGCACCAG180 GCTCCACAGCTCGGAGAGGCATGAACGCGATCCGGAGGAGACTACCCTGCGCGCGGGGAT240 CCGTGGACATTAGCCGCTCTCGGGAACTGACCCCCAGCTCCTTCAGCCATTTATGAATCC300 AGAGGCTTGAGATTTTTTTCCGCATCCCGGAGCCCGACCTGAGAAATTTCAATGAAAAGG360 AAAGTCAATGGATCGTGGTCTTGGAAAAGCTGCTTAGACATGTCTGTTTCCCGGCTCTCT420 GAACCCGTGGCAGAGCTGTAAGTAAGCGCTTCACAGTGCGTGATGAATTGGATGGCTTCG480 GACCCGAGGCAAAAAAAATAATTGTCTCATTTTCGTGCTGATTTGCTTAACTGGTGGGAC540 CATGCCAGAAAGGCTAGCTGAGACGCTTTTGGACCTCTGGACTCCATTAATAATATTATG600 GATTACTCTTCCCTCTTTTGTGTACATGGCTCCGATGAATCAGGCTCACGTTTTAACTAC660 TGGATCCCCTTTGGAACTAAGCAGGCAGAGTGAAGAAATGCGGATTTTGAACCGCTCCAA720 AAGAGGTTGGGTTTGGAATCAAATGTTTGTTCTGGAAGAATTTTCTGGACCTGAACCGAT780 TCTCGTTGGCCGGTTACACACAGATCTGGATCCTGGGAGCAAAAAAATCAAGTATATCCT840 ATCGGGTGATGGAGCCGGCACAATCTTTCAAATAAACGATATAACTGGAGACATCCATGC900 TATCAAAAGACTTGACCGAGAGGAAAAGGCTGAGTATACGTTAACAGCTCAGGCAGTGGA960 CTGGGAGACAAACAAACCTCTCGAGCCTCCTTCTGAATTTATTATTAAGGTTCAAGACAT1020 CAACGACAATGCCCCCGAGTTTCTCAATGGACCTTACCATGCTACTGTTCCAGAGATGTC1080 CATCTTGGGTACATCTGTCACTAATGTAACGGCCACTGATGCTGACGATCCAGTTTATGG1140 AAACAGTGCAAAGTTGGTTTACAGTATCTTGGAGGGACAGCCGTATTTTTCCATTGAGCC1200 TGAAACAGCTATTATAAAAACTGCCCTTCCTAACATGGACAGAGAGGCCAAGGAGGAATA1260 CCTGGTTGTAATTCAAGCCAAAGATATGGGTGGGCATTCCGGTGGTCTGTCTGGAACCAC1320 GACACTCACAGTGACGCTTACCGATGTGAATGACAATCCTCCAAAATTTGCTCAAAGTTT1380 GTATCACTTCTCAGTACCAGAAGATGTGGTCCTTGGCACTGCAATAGGAAGGGTTAAAGC1440 CAATGACCAGGATATTGGTGAAAATGCACAATCTTCCTATGACATCATTGATGGAGATGG1500 GACAGCACTATTTGAAATCACTTCTGATGCCCAGGCACAGGATGGTGTTATAAGACTAAG1560 AAAGCCTCTGGACTTTGAGACCAAAAAATCCTATACTCTGAAGGTGGAGGCAGCCAATAT1620 CCACATCGACCCACGTTTCAGTGGCAGGGGACCCTTTAAAGATACAGCAACAGTCAAAAT1680 TGTTGTAGAGGATGCTGATGAGCCTCCGGTCTTCTCTTCACCGACTTACCTCCTTGAAGT1740 TCATGAAAATGCTGCCTTGAACTCTGTGATTGGCCAAGTGACAGCTCGTGACCCTGATAT1800 CACTTCCAGCCCAATAAGGTTTTCCATTGACCGCCACACTGACTTGGAGAGACAGTTCAA1860 CATCAATGCAGATGATGGGAAGATAACACTGGCGACCCCACTGGACAGAGAACTAAGTGT1920 GTGGCACAACATCTCCATCATTGCTACTGAGATCAGGAACCACAGTCAGATATCGCGAGT1980 GCCTGTTGCTATTAAAGTGCTGGATGTCAATGACAACGCCCCTGAATTCGCGTCCGAATA2040 TGAGGCATTTTTATGTGAAAATGGAAAACCCGGCCAAGTAAATATCTCCATGTTGTTAAT2100 ACTGAATATGTTTGTATACAACTGTTTCCTAGTTAATTAACCTGCATTACTTCCTGATTT2160 TGCATTGGTTGGATTTACAAAGTCACAGGCAGGAAACTCCTCCAAGCGGTAACAGAAGGG2220 AATATTTGTCTTTCTCAGATGTTAATTCTCTTCTAACTTAGGAACCAATTGGCTCAGAAA2280 GTGTGATGATCTGCTCTGCTCTGACCCCAGCCAAATCACTGTCTTAAAATACATCACATA2340 TGGGTGATGGCTGGGGACAGTCTTACAGTGCAGAAGGTTGAAATCGCCATCAATTGGCAA2400 GAATCTAAAGAATAGCTCATGGGAAGCATGCATTTTTGTTTTATGTTGAAAAGAAGATTA2460 ATGCACAAATGTGGAATGCAAAAAAACACAGTAGTTTATAGAAAGCTCTATGTAGTGGTA2520 CTTATGTCTGTACACATATTTGCAAGTTTAGTAAACATAATGTAGACATCAAATTGTTAG2580 ATATGCCCCTAAGGCATTTCAATATGTAGAGGTAAGACTCCTAAGGCATAGATGGGGATA2640 ATGAAGACAAAAATAAAGGGCAGAAAAATGTATAAAATAGAACAGACAGAAATACACTAA2700 AGATCTAAAGATAGAAGCAGGAAAGAGGGGAGGGAGGGAGGGAGACAGGGCTGGAAGAAG2760 ATAGGGTGGGAGGGAGGGAAGGAGAGTCAAGGCTCAGGGTGTGGGGGGGAAGGTAAAATG2820 CAAAACAAAATCTACAGAAACCACTATACTCTGAATGTCAAAATGCAACTAACCTATGTA2880 AAATCACCCAACCACATGTGTAATAGATTTATTTTAACGAGGTGCCGGAGTACTGTATGT2940 TTAAGAAATTTATCATTTTTCAACTTCCTAATTTATTTCTGGATGGTGACATTTTAATTT3000 AAATAAACAGCAGCTGACAGCATGAAAAAAAAAAAAAAAAAAA3043 (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 532 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: MetProGluArgLeuAlaGluThrLeuLeuAspLeuTrpThrProLeu 151015 IleIleLeuTrpIleThrLeuProSerPheValTyrMetAlaProMet 202530 AsnGlnAlaHisValLeuThrThrGlySerProLeuGluLeuSerArg 354045 GlnSerGluGluMetArgIleLeuAsnArgSerLysArgGlyTrpVal 505560 TrpAsnGlnMetPheValLeuGluGluPheSerGlyProGluProIle 65707580 LeuValGlyArgLeuHisThrAspLeuAspProGlySerLysLysIle 859095 LysTyrIleLeuSerGlyAspGlyAlaGlyThrIlePheGlnIleAsn 100105110 AspIleThrGlyAspIleHisAlaIleLysArgLeuAspArgGluGlu 115120125 LysAlaGluTyrThrLeuThrAlaGlnAlaValAspTrpGluThrAsn 130135140 LysProLeuGluProProSerGluPheIleIleLysValGlnAspIle 145150155160 AsnAspAsnAlaProGluPheLeuAsnGlyProTyrHisAlaThrVal 165170175 ProGluMetSerIleLeuGlyThrSerValThrAsnValThrAlaThr 180185190 AspAlaAspAspProValTyrGlyAsnSerAlaLysLeuValTyrSer 195200205 IleLeuGluGlyGlnProTyrPheSerIleGluProGluThrAlaIle 210215220 IleLysThrAlaLeuProAsnMetAspArgGluAlaLysGluGluTyr 225230235240 LeuValValIleGlnAlaLysAspMetGlyGlyHisSerGlyGlyLeu 245250255 SerGlyThrThrThrLeuThrValThrLeuThrAspValAsnAspAsn 260265270 ProProLysPheAlaGlnSerLeuTyrHisPheSerValProGluAsp 275280285 ValValLeuGlyThrAlaIleGlyArgValLysAlaAsnAspGlnAsp 290295300 IleGlyGluAsnAlaGlnSerSerTyrAspIleIleAspGlyAspGly 305310315320 ThrAlaLeuPheGluIleThrSerAspAlaGlnAlaGlnAspGlyVal 325330335 IleArgLeuArgLysProLeuAspPheGluThrLysLysSerTyrThr 340345350 LeuLysValGluAlaAlaAsnIleHisIleAspProArgPheSerGly 355360365 ArgGlyProPheLysAspThrAlaThrValLysIleValValGluAsp 370375380 AlaAspGluProProValPheSerSerProThrTyrLeuLeuGluVal 385390395400 HisGluAsnAlaAlaLeuAsnSerValIleGlyGlnValThrAlaArg 405410415 AspProAspIleThrSerSerProIleArgPheSerIleAspArgHis 420425430 ThrAspLeuGluArgGlnPheAsnIleAsnAlaAspAspGlyLysIle 435440445 ThrLeuAlaThrProLeuAspArgGluLeuSerValTrpHisAsnIle 450455460 SerIleIleAlaThrGluIleArgAsnHisSerGlnIleSerArgVal 465470475480 ProValAlaIleLysValLeuAspValAsnAspAsnAlaProGluPhe 485490495 AlaSerGluTyrGluAlaPheLeuCysGluAsnGlyLysProGlyGln 500505510 ValAsnIleSerMetLeuLeuIleLeuAsnMetPheValTyrAsnCys 515520525 PheLeuValAsn 530 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2490 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: GGCACGAGGGCCAGTTGAGCCAGAGTCAGAATTTGTGATCAAAATTCACGATATCAACGA60 CAATGAGCCTACATTCCCAGAAGAAATTTATACAGCCAGCGTTCCTGAAATGTCTGTTGT120 AGGTACTTCTGTGGTGCAAGTCACAGCTACAGATGCCGATGACCCTTCATATGGAAACAG180 CGCCAGAGTCATTTACAGCATACTTCAAGGGCAGCCTTATTTCTCTGTGGAACCAGAAAC240 AGGTATCATAAGGACAGCTCTACCAAACATGAACAGAGAGAACAAGGAACAGTACCAGGT300 GGTTATTCAAGCCAAGGACATGGGCGGTCAGATGGGGGGTCTGTCTGGAACCACCACAGT360 GAACATCACTCTCACAGATGTCAACGACAATCCTCCTCGCTTCCCCCAAAACACCATCCA420 TCTGCGAGTTCTTGAATCCTCTCCAGTTGGCACAGCTGTGGGAAGTGTAAAAGCCACCGA480 TGCTGACACGGGGAAAAATGCCGAAGTGGATTACCGCATTATTGATGGAGATGGCACAGA540 TATGTTTGACATTATAACTGAGAAGGACACACAGGAAGGCATCATCACTGTGAAAAAGCC600 ACTTGACTATGAGAACCGAAGACTATATACTCTGAAGGTGGAGGCAGAAAATACCCATGT660 GGATCCACGTTTTTACTATTTAGGGCCATTCAAAGATACAACAATTGTAAAAATCTCCAT720 AGAAGACGTGGATGAGCCTCCAGTTTTCAGTCGATCCTCCTATCTGTTTGAGGTTCATGA780 GGATATTGAAGTGGGCACAATCATCGGTACTGTAATGGCAAGAGACCCAGATTCTACTTC840 CAGTCCCATCAGATTTACTTTAGATCGCCATACTGATCTTGACAGGATCTTTAACATTCA900 TTCTGGAAACGGATCACTTTATACATCAAAGCCACTTGATCGTGAACTATCTCAATGGCA960 CAACCTTACCGTCATAGCTGCCGAGATCAATAATCCTAAAGAAACAACTCGTGTGTCTGT1020 TTTTGTGAGGATTTTGGATGTTAATGACAACGCTCCACAATTTGCTGTGTTTTATGACAC1080 ATTTGTATGTGAAAATGCCAGACCAGGACAGCTGATACAGACAATAAGTGCAGTTGACAA1140 AGATGACCCCTTAGGTGGACAGAAGTTCTTCTTCAGTTTGGCTGCTGTGAATCCTAACTT1200 CACAGTGCAAGACAATGAAGACAACACTGCCAGAATTTTAACCAGAAAGAATGGCTTCAA1260 CCGTCATGAAATAAGCACCTACCTACTGCCGGTAGTGATATCTGATAATGACTACCCCAT1320 TCAGAGCAGCACTGGCACCCTGACGATCCGTGTTTGCGCCTGTGACAGCCAGGGCAACAT1380 GCAGTCCTGCAGTGCCGAAGCCCTGCTCCTTCCTGCTGGCCTCAGCACTGGCGCCTTGAT1440 CGCCATTCTTCTCTGCATCATCATTCTGCTGGTTATAGTAGTCCTCTTTGCAGCCCTGAA1500 AAGGCAACGGAAGAAAGAGCCTCTGATTTTATCCAAAGAAGACATCAGAGACAACATTGT1560 GAGCTATAACGACGAAGGTGGCGGAGAGGAGGACACCCAACCCTTTGATATTGGAACCCT1620 GAGGAATCCTGCAGCTATCGAGGAGAAAAAGCTGCGGCGAGATATCATTCCTGAAACGTT1680 ATTTATACCGCGGCGGACTCCTACGGCCCCGGATAACACGGATGTCCGGGATTTCATTAA1740 TGAGCGCCTCAAAGAGCACGACTTGGACCCCACTGCGCCTCCCTACGACTCGCTGGCTAC1800 CTATGCCTATGAAGGAAACGACTCTGTTGCTGAATCTCTGAGCTCCTTAGAATCAGGTAC1860 CACTGAAGGAGACCAAAACTACGATTACCTTCGAGAATGGGGGCCTCGGTTTAATAAACT1920 AGCAGAAATGTACGGTGGTGGTGAGAGCGACAAAGACGCTTAGCCTGGCCCCTGAGCTCT1980 GTTCAACGAGATACGTAACTTTGCAGACATTGTCTCCACTTCACAATATTTGATATTCAG2040 GAGAAAAAATTCCTGCCACTCAGCACAAGTTTCCCACCTATTTCTTAATTTGTTCATTAA2100 TTATATTAATTCCTTCCTGTAGAATGTCTCATGGGATATATACGACATTTTATTTAATCA2160 CTTCCAAGAGCCAAAGCTATGGAAATTCAATGTTGCCCATCTTAGTAAATAAAAGAAACC2220 CGAGCAGGATAGTTCTCCCTTAAGCAACCTCACGAACAAGTCGCTTCTGTTAGATACACG2280 TCTTGCCCTTGCAAATGAAGCTTTGAAAAGACGAAGAAAACATTTAAGATGTATCCTGTT2340 CTGTACATTAAGTTTAAAAAAAAAAGTCCATGTGGTGTTAGTAGGTGTGATATGCAGCCT2400 GGTATACGAGCATTCGTGCAATTTCATTTCATCAAATTCTATCTGCTAATGTTTTATATT2460 TATATTTTTGTATTTATTTTTTAAAAAAAA2490 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 653 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: AlaArgGlyProValGluProGluSerGluPheValIleLysIleHis 151015 AspIleAsnAspAsnGluProThrPheProGluGluIleTyrThrAla 202530 SerValProGluMetSerValValGlyThrSerValValGlnValThr 354045 AlaThrAspAlaAspAspProSerTyrGlyAsnSerAlaArgValIle 505560 TyrSerIleLeuGlnGlyGlnProTyrPheSerValGluProGluThr 65707580 GlyIleIleArgThrAlaLeuProAsnMetAsnArgGluAsnLysGlu 859095 GlnTyrGlnValValIleGlnAlaLysAspMetGlyGlyGlnMetGly 100105110 GlyLeuSerGlyThrThrThrValAsnIleThrLeuThrAspValAsn 115120125 AspAsnProProArgPheProGlnAsnThrIleHisLeuArgValLeu 130135140 GluSerSerProValGlyThrAlaValGlySerValLysAlaThrAsp 145150155160 AlaAspThrGlyLysAsnAlaGluValAspTyrArgIleIleAspGly 165170175 AspGlyThrAspMetPheAspIleIleThrGluLysAspThrGlnGlu 180185190 GlyIleIleThrValLysLysProLeuAspTyrGluAsnArgArgLeu 195200205 TyrThrLeuLysValGluAlaGluAsnThrHisValAspProArgPhe 210215220 TyrTyrLeuGlyProPheLysAspThrThrIleValLysIleSerIle 225230235240 GluAspValAspGluProProValPheSerArgSerSerTyrLeuPhe 245250255 GluValHisGluAspIleGluValGlyThrIleIleGlyThrValMet 260265270 AlaArgAspProAspSerThrSerSerProIleArgPheThrLeuAsp 275280285 ArgHisThrAspLeuAspArgIlePheAsnIleHisSerGlyAsnGly 290295300 SerLeuTyrThrSerLysProLeuAspArgGluLeuSerGlnTrpHis 305310315320 AsnLeuThrValIleAlaAlaGluIleAsnAsnProLysGluThrThr 325330335 ArgValSerValPheValArgIleLeuAspValAsnAspAsnAlaPro 340345350 GlnPheAlaValPheTyrAspThrPheValCysGluAsnAlaArgPro 355360365 GlyGlnLeuIleGlnThrIleSerAlaValAspLysAspAspProLeu 370375380 GlyGlyGlnLysPhePhePheSerLeuAlaAlaValAsnProAsnPhe 385390395400 ThrValGlnAspAsnGluAspAsnThrAlaArgIleLeuThrArgLys 405410415 AsnGlyPheAsnArgHisGluIleSerThrTyrLeuLeuProValVal 420425430 IleSerAspAsnAspTyrProIleGlnSerSerThrGlyThrLeuThr 435440445 IleArgValCysAlaCysAspSerGlnGlyAsnMetGlnSerCysSer 450455460 AlaGluAlaLeuLeuLeuProAlaGlyLeuSerThrGlyAlaLeuIle 465470475480 AlaIleLeuLeuCysIleIleIleLeuLeuValIleValValLeuPhe 485490495 AlaAlaLeuLysArgGlnArgLysLysGluProLeuIleLeuSerLys 500505510 GluAspIleArgAspAsnIleValSerTyrAsnAspGluGlyGlyGly 515520525 GluGluAspThrGlnProPheAspIleGlyThrLeuArgAsnProAla 530535540 AlaIleGluGluLysLysLeuArgArgAspIleIleProGluThrLeu 545550555560 PheIleProArgArgThrProThrAlaProAspAsnThrAspValArg 565570575 AspPheIleAsnGluArgLeuLysGluHisAspLeuAspProThrAla 580585590 ProProTyrAspSerLeuAlaThrTyrAlaTyrGluGlyAsnAspSer 595600605 ValAlaGluSerLeuSerSerLeuGluSerGlyThrThrGluGlyAsp 610615620 GlnAsnTyrAspTyrLeuArgGluTrpGlyProArgPheAsnLysLeu 625630635640 AlaGluMetTyrGlyGlyGlyGluSerAspLysAspAla 645650 (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3048 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: CGCCGGCGGGGAAGATGACCGCGGGCGCCGGCGTGCTCCTTCTGCTGCTCTCGCTCTCCG60 GCGCGCTCCGGGCCCATAATGAGGATCTTACAACTAGAGAGACCTGCAAGGCTGGGTTCT120 CTGAAGATGATTACACGGCATTAATCTCCCAAAATATTCTAGAAGGGGAAAAGCTACTTC180 AAGTCAAGTTCAGCAGCTGTGTGGGGACCAAGGGGACACAATATGAGACCAACAGCATGG240 ACTTCAAAGTTGGGGCAGATGGGACAGTCTTCGCCACCCGGGAGCTGCAGGTCCCCTCCG300 AGCAGGTGGCGTTCACGGTGACTGCATGGGACAGCCAGACAGCAGAGAAATGGGACGCCG360 TGGTGCGGTTGCTGGTGGCCCAGACCTCGTCCCCGCACTCTGGACACAAGCCGCAGAAAG420 GAAAGAAGGTCGTGGCTCTGGACCCCTCTCCGCCTCCGAAGGACACCCTGCTGCCGTGGC480 CCCAGCACCAGAACGCCAACGGGCTGAGGCGGCGCAAACGGGACTGGGTCATCCCACCCA540 TCAACGTGCCCGAGAACTCGCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGATCCGGTCCG600 ACAAAGACAATGACATCCCCATCCGGTACAGCATCACGGGAGTGGGTGCCGACCAGCCCC660 CCATGGAGGTCTTCAGCATTAACTCCATGTCCGGCCGGATGTACGTCACAAGGCCCATGG720 ACCGGGAGGAGCACGCCTCTTACCACCTCCGAGCCCACGCTGTGGACATGAATGGCAACA780 AGGTGGAGAACCCCATCGACCTGTACATCTACGTCATCGACATGAATGACAACCACCCTG840 AGTTCATCAACCAGGTCTACAACTGCTCCGTGGACGAGGGCTCCAAGCCAGGCACCTACG900 TGATGACCATCACGGCCAACGATGCTGACGACAGCACCACGGCCAACGGGATGGTGCGGT960 ACCGGATCGTGACCCAGACCCCACAGAGCCCGTCCCAGAATATGTTCACCATCAACAGCG1020 AGACTGGAGATATCGTCACAGTGGCGGCTGGCTGGGACCGAGAGAAAGTTCAGCAGTACA1080 CAGTCATCGTTCAGGCCACAGATATGGAAGGAAATCTCAACTATGGCCTCTCAAACACAG1140 CCACAGCCATCATCACGGTGACAGATGTGAATGACAACCCGTCAGAATTTACCGCCAGCA1200 CGTTTGCAGGGGAGGTCCCCGAAAACAGCGTGGAGACCGTGGTCGCAAACCTCACGGTGA1260 TGGACCGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTTTACCGCATCATCAGTGGGG1320 ATCCATCCGGGCACTTCAGCGTCCGCACAGACCCCGTAACCAACGAGGGCATGGTCACCG1380 TGGTGAAGGCAGTCGACTACGAGCTCAACAGAGCTTTCATGCTGACAGTGATGGTGTCCA1440 ACCAGGCGCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGTGACCA1500 TCTCCATCATGGACATCAACGAGGCTCCCTACTTCCCCTCAAACCACAAGCTGATCCGCC1560 TGGAGGAGGGCGTGCCCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGACC1620 GGTTCATGCAGCAGGCTGTGAGATACTCAAAGCTGTCAGACCCAGCGAGCTGGCTGCACA1680 TCAATGCCACCAACGGCCAGATCACCACGGTGGCAGTGCTGGACCGTGAGTCCCTCTACA1740 CCAAAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTGACAATGGGATACCCCCGGCCA1800 GCGGCACCGGGACCCTCCAGATCTATCTCATTGACATCAACGACAACGCCCCTGAGCTGC1860 TGCCCAAGGAGGCGCAGATCTGCGAGAGGCCCAACCTGAACGCCATCAACATCACGGCGG1920 CCGACGCTGACGTGCACCCCAACATCGGCCCCTACGTCTTCGAGCTGCCCTTTGTCCCGG1980 CGGCCGTGCGGAAGAACTGGACCATCACCCGCCTGAACGGTGACTATGCCCAACTCAGCT2040 TGCGCATCCTGTACCTGGAGGCCGGGATGTATGACGTCCCCATCATCGTCACAGACTCTG2100 GAAACCCTCCCCTGTCCAACACGTCCATCATCAAAGTCAAGGTGTGCCCATGTGATGACA2160 ACGGGGACTGCACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGCACCGGTGCCATCG2220 TGGCCATCCTCATCTGCATCCTCATCCTGCTGACCATGGTCCTGCTGTTTGTCATGTGGA2280 TGAAGCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCCCGAGGACGACG2340 TCCGCGAAAAGATCCTCAAGTATGACGAGGAAGGCGGTGGCGAGGAGGACCAGGACTACG2400 ACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGCG2460 TGCGTCGCGTGGATGAGCGGCCGGTGGGCCCTGAGCCCCAGTACCCGATCAGGCCCATGG2520 TGCCGCACCCAGGCGACATCGGTGACTTCATCAATGAGGGACTCCGCGCTGCTGACAACG2580 ACCCCACGGCACCCCCCTATGACTCCCTGCTGGTCTTCGACTACGAGGGGAGCGGCTCCA2640 CCGCAGGCTCCGTCAGCTCCCTGAACTCATCCAGTTCCGGGGACCAAGACTACGATTACC2700 TCAACGACTGGGGCCCCAGATTCAAGAAGCTGGCGGACATGTATGGAGGTGGTGAAGAGG2760 ATTGACTGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA2820 GGACTGAGCAGAGGCGGCCGGTCTTCCCGACTCCCTGCGGCTGTGTCCTTAGTGCTGTTA2880 GGAGGCCCCCCAATCCCCACGTTGAGCTGTCTAGCATGAGCACCCACCCCCACAGCGCCC2940 TGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTC3000 TGTCTTCACTTGAATTTCCTAGAACAGAAGCACTGTTTTTAAAAAAAG3048 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 916 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: MetThrAlaGlyAlaGlyValLeuLeuLeuLeuLeuSerLeuSerGly 151015 AlaLeuArgAlaHisAsnGluAspLeuThrThrArgGluThrCysLys 202530 AlaGlyPheSerGluAspAspTyrThrAlaLeuIleSerGlnAsnIle 354045 LeuGluGlyGluLysLeuLeuGlnValLysPheSerSerCysValGly 505560 ThrLysGlyThrGlnTyrGluThrAsnSerMetAspPheLeuValGly 65707580 AlaAspGlyThrValPheAlaThrArgGluLeuGlnValProSerGlu 859095 GlnValAlaPheThrValThrAlaTrpAspSerGlnThrAlaGluLys 100105110 TrpAspAlaValValArgLeuLeuValAlaGlnThrSerSerProHis 115120125 SerGlyHisLysProGlnLysGlyLysLysValValAlaLeuAspPro 130135140 SerProProProLysAspThrLeuLeuProTrpProGlnHisGlnAsn 145150155160 AlaAsnGlyLeuArgArgArgLysArgAspTrpValIleProProIle 165170175 AsnValProGluAsnSerArgGlyProPheProGlnGlnLeuValArg 180185190 IleArgSerAspLysAspAsnAspIleProIleArgTyrSerIleThr 195200205 GlyValGlyAlaAspGlnProProMetGluValPheSerIleAsnSer 210215220 MetSerGlyArgMetTyrValThrArgProMetAspArgGluGluHis 225230235240 AlaSerTyrHisLeuArgAlaHisAlaValAspMetAsnGlyAsnLys 245250255 ValGluAsnProIleAspLeuTyrIleTyrValIleAspMetAsnAsp 260265270 AsnHisProGluPheIleAsnGlnValTyrAsnCysSerValAspGlu 275280285 GlySerLysProGlyThrTyrValMetThrIleThrAlaAsnAspAla 290295300 AspAspSerThrThrAlaAsnGlyMetValArgTyrArgIleValThr 305310315320 GlnThrProGlnSerProSerGlnAsnMetPheThrIleAsnSerGlu 325330335 ThrGlyAspIleValThrValAlaAlaGlyTrpAspArgGluLysVal 340345350 GlnGlnTyrThrValIleValGlnAlaThrAspMetGluGlyAsnLeu 355360365 AsnTyrGlyLeuSerAsnThrAlaThrAlaIleIleThrValThrAsp 370375380 ValAsnAspAsnProSerGluPheThrAlaSerThrPheAlaGlyGlu 385390395400 ValProGluAsnSerValGluThrValValAlaAsnLeuThrValMet 405410415 AspArgAspGlnProHisSerProAsnTrpAsnAlaValTyrArgIle 420425430 IleSerGlyAspProSerGlyHisPheSerValArgThrAspProVal 435440445 ThrAsnGluGlyMetValThrValValLysAlaValAspTyrGluLeu 450455460 AsnArgAlaPheMetLeuThrValMetValSerAsnGlnAlaProLeu 465470475480 AlaSerGlyIleGlnMetSerPheGlnSerThrAlaGlyValThrIle 485490495 SerIleMetAspIleAsnGluAlaProTyrPheProSerAsnHisLys 500505510 LeuIleArgLeuGluGluGlyValProProGlyThrValLeuThrThr 515520525 PheSerAlaValAspProAspArgPheMetGlnGlnAlaValArgTyr 530535540 SerLysLeuSerAspProAlaSerTrpLeuHisIleAsnAlaThrAsn 545550555560 GlyGlnIleThrThrValAlaValLeuAspArgGluSerLeuTyrThr 565570575 LysAsnAsnValTyrGluAlaThrPheLeuAlaAlaAspAsnGlyIle 580585590 ProProAlaSerGlyThrGlyThrLeuGlnIleTyrLeuIleAspIle 595600605 AsnAspAsnAlaProGluLeuLeuProLysGluAlaGlnIleCysGlu 610615620 ArgProAsnLeuAsnAlaIleAsnIleThrAlaAlaAspAlaAspVal 625630635640 HisProAsnIleGlyProTyrValPheGluLeuProPheValProAla 645650655 AlaValArgLysAsnTrpThrIleThrArgLeuAsnGlyAspTyrAla 660665670 GlnLeuSerLeuArgIleLeuTyrLeuGluAlaGlyMetTyrAspVal 675680685 ProIleIleValThrAspSerGlyAsnProProLeuSerAsnThrSer 690695700 IleIleLysValLysValCysProCysAspAspAsnGlyAspCysThr 705710715720 ThrIleGlyAlaValAlaAlaAlaGlyLeuGlyThrGlyAlaIleVal 725730735 AlaIleLeuIleCysIleLeuIleLeuLeuThrMetValLeuLeuPhe 740745750 ValMetTrpMetLysArgArgGluLysGluArgHisThrLysGlnLeu 755760765 LeuIleAspProGluAspAspValArgGluLysIleLeuLysTyrAsp 770775780 GluGluGlyGlyGlyGluGluAspGlnAspTyrAspLeuSerGlnLeu 785790795800 GlnGlnProGluAlaMetGlyHisValProSerLysAlaProGlyVal 805810815 ArgArgValAspGluArgProValGlyProGluProGlnTyrProIle 820825830 ArgProMetValProHisProGlyAspIleGlyAspPheIleAsnGlu 835840845 GlyLeuArgAlaAlaAspAsnAspProThrAlaProProTyrAspSer 850855860 LeuLeuValPheAspTyrGluGlySerGlySerThrAlaGlySerVal 865870875880 SerSerLeuAsnSerSerSerSerGlyAspGlnAspTyrAspTyrLeu 885890895 AsnAspTrpGlyProArgPheLysLysLeuAlaAspMetTyrGlyGly 900905910 GlyGluGluAsp 915 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3164 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: CTCCACTCACGCTCAGCCCTGGACGGACAGGCAGTCCAACGGAACAGAAACATCCCTCAG60 CCCACAGGCACGATCTGTTCCTCCTGGGAAGATGCAGAGGCTATGATGCTCCTCGCCACA120 TCGGGCGCCTGCCTGGGCCTGCTGGCAGTGGCAGCAGTGGCAGCAGCAGGTGCTAACCCT180 GCCCAACGGGACACCCACAGCCTGCTGCCCACCCACCGGCGCCAAAAGAGAGATTGGATT240 TGGAACCAGATGCACATTGATGAAGAGAAAAACACCTCACTTCCCCATCATGTAGGCAAG300 ATCAAGTCAAGCGTGAGTCGCAAGAATGCCAAGTACCTGCTCAAAGGAGAATATGTGGGC360 AAGGTCTTCCGGGTCGATGCAGAGACAGGAGACGTGTTCGCCATTGAGAGGCTGGACCGG420 GAGAATATCTCAGAGTACCACCTCACTGCTGTCATTGTGGACAAGGACACTGGCGAAAAC480 CTGGAGACTCCTTCCAGCTTCACCATCAAAGTTCATGACGTGAACGACAACTGGCCTGTG540 TTCACGCATCGGTTGTTCAATGCGTCCGTGCCTGAGTCGTCGGCTGTGGGGACCTCAGTC600 ATCTCTGTGACAGCAGTGGATGCAGACGACCCCACTGTGGGAGACCACGCCTCTGTCATG660 TACCAAATCCTGAAGGGGAAAGAGTATTTTGCCATCGATAATTCTGGACGTATTATCACA720 ATAACGAAAAGCTTGGACCGAGAGAAGCAGGCCAGGTATGAGATCGTGGTGGAAGCGCGA780 GATGCCCAGGGCCTCCGGGGGGACTCGGGCACGGCCACCGTGCTGGTCACTCTGCAAGAC840 ATCAATGACAACTTCCCCTTCTTCACCCAGACCAAGTACACATTTGTCGTGCCTGAAGAC900 ACCCGTGTGGGCACCTCTGTGGGCTCTCTGTTTGTTGAGGACCCAGATGAGCCCCAGAAC960 CGGATGACCAAGTACAGCATCTTGCGGGGCGACTACCAGGACGCTTTCACCATTGAGACA1020 AACCCCGCCCACAACGAGGGCATCATCAAGCCCATGAAGCCTCTGGATTATGAATACATC1080 CAGCAATACAGCTTCATAGTCGAGGCCACAGACCCCACCATCGACCTCCGATACATGAGC1140 CCTCCCGCGGGAAACAGAGCCCAGGTCATTATCAACATCACAGATGTGGACGAGCCCCCC1200 ATTTTCCAGCAGCCTTTCTACCACTTCCAGCTGAAGGAAAACCAGAAGAAGCCTCTGATT1260 GGCACAGTGCTGGCCATGGACCCTGATGCGGCTAGGCATAGCATTGGATACTCCATCCGC1320 AGGACCAGTGACAAGGGCCAGTTCTTCCGAGTCACAAAAAAGGGGGACATTTACAATGAG1380 AAAGAACTGGACAGAGAAGTCTACCCCTGGTATAACCTGACTGTGGAGGCCAAAGAACTG1440 GATTCCACTGGAACCCCCACAGGAAAAGAATCCATTGTGCAAGTCCACATTGAAGTTTTG1500 GATGAGAATGACAATGCCCCGGAGTTTGCCAAGCCCTACCAGCCCAAAGTGTGTGAGAAC1560 GCTGTCCATGGCCAGCTGGTCCTGCAGATCTCCGCAATAGACAAGGACATAACACCACGA1620 AACGTGAAGTTCAAATTCATCTTGAATACTGAGAACAACTTTACCCTCACGGATAATCAC1680 GATAACACGGCCAACATCACAGTCAAGTATGGGCAGTTTGACCGGGAGCATACCAAGGTC1740 CACTTCCTACCCGTGGTCATCTCAGACAATGGGATGCCAAGTCGCACGGGCACCAGCACG1800 CTGACCGTGGCCGTGTGCAAGTGCAACGAGCAGGGCGAGTTCACCTTCTGCGAGGATATG1860 GCCGCCCAGGTGGGCGTGAGCATCCAGGCAGTGGTAGCCATCTTACTCTGCATCCTCACC1920 ATCACAGTGATCACCCTGCTCATCTTCCTGCGGCGGCGGCTCCGGAAGCAGGCCCGCGCG1980 CACGGCAAGAGCGTGCCGGAGATCCACGAGCAGCTGGTCACCTACGACGAGGAGGGCGGC2040 GGCGAGATGGACACCACCAGCTACGATGTGTCGGTGCTCAACTCGGTGCGCCGCGGCGGG2100 GCCAAGCCCCCGCGGCCCGCGCTGGACGCCCGGCCTTCCCTCTATGCGCAGGTGCAGAAG2160 CCACCGAGGCACGCGCCTGGGGCACACGGAGGGCCCGGGGAGATGGCAGCCATGATCGAG2220 GTGAAGAAGGACGAGGCGGACCACGACGGCGACGGCCCCCCCTACGACACGCTGCACATC2280 TACGGCTACGAGGGCTCCGAGTCCATAGCCGAGTCCCTCAGCTCCCTGGGCACCGACTCA2340 TCCGACTCTGACGTGGATTACGACTTCCTTAACGACTGGGGACCCAGGTTTAAGATGCTG2400 GCTGAGCTGTACGGCTCGGACCCCCGGGAGGAGCTGCTGTATTAGGCGGCCGAGGTCACT2460 CTGGGCCTGGGGACCCAAACCCCCTGCAGCCCAGGCCAGTCAGACTCCAGGCACCACAGC2520 CTCCAAAAATGGCAGTGACTCCCCAGCCCAGCACCCCTTCCTCGTGGGTCCCAGAGACCT2580 CATCAGCCTTGGGATAGCAAACTCCAGGTTCCTGAAATATCCAGGAATATATGTCAGTGA2640 TGACTATTCTCAAATGCTGGCAAATCCAGGCTGGTGTTCTGTCTGGGCTCAGACATCCAC2700 ATAACCCTGTCACCCACAGACCGCCGTCTAACTCAAAGACTTCCTCTGGCTCCCCAAGGC2760 TGCAAAGCAAAACAGACTGTGTTTAACTGCTGCAGGGTCTTTTTCTAGGGTCCCTGAACG2820 CCCTGGTAAGGCTGGTGAGGTCCTGGTGCCTATCTGCCTGGAGGCAAAGGCCTGGACAGC2880 TTGACTTGTGGGGCAGGATTCTCTGCAGCCCATTCCCAAGGGAGACTGACCATCATGCCC2940 TCTCTCGGGAGCCCTAGCCCTGCTCCAACTCCATACTCCACTCCAAGTGCCCCACCACTC3000 CCCAACCCCTCTCCAGGCCTGTCAAGAGGGAGGAAGGGGCCCCATGGCAGCTCCTGACCT3060 TGGGTCCTGAAGTGACCTCACTGGCCTGCCATGCCAGTAACTGTGCTGTACTGAGCACTG3120 AACCACATTCAGGGAAATGGCTTATTAAACTTTGAAGCAACTGT3164 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 780 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: MetMetLeuLeuAlaThrSerGlyAlaCysLeuGlyLeuLeuAlaVal 151015 AlaAlaValAlaAlaAlaGlyAlaAsnProAlaGlnArgAspThrHis 202530 SerLeuLeuProThrHisArgArgGlnLysArgAspTrpIleTrpAsn 354045 GlnMetHisIleAspGluGluLysAsnThrSerLeuProHisHisVal 505560 GlyLysIleLysSerSerValSerArgLysAsnAlaLysTyrLeuLeu 65707580 LysGlyGluTyrValGlyLysValPheArgValAspAlaGluThrGly 859095 AspValPheAlaIleGluArgLeuAspArgGluAsnIleSerGluTyr 100105110 HisLeuThrAlaValIleValAspLysAspThrGlyGluAsnLeuGlu 115120125 ThrProSerSerPheThrIleLysValHisAspValAsnAspAsnTrp 130135140 ProValPheThrHisArgLeuPheAsnAlaSerValProGluSerSer 145150155160 AlaValGlyThrSerValIleSerValThrAlaValAspAlaAspAsp 165170175 ProThrValGlyAspHisAlaSerValMetTyrGlnIleLeuLysGly 180185190 LysGluTyrPheAlaIleAspAsnSerGlyArgIleIleThrIleThr 195200205 LysSerLeuAspArgGluLysGlnAlaArgTyrGluIleValValGlu 210215220 AlaArgAspAlaGlnGlyLeuArgGlyAspSerGlyThrAlaThrVal 225230235240 LeuValThrLeuGlnAspIleAsnAspAsnPheProPhePheThrGln 245250255 ThrLysTyrThrPheValValProGluAspThrArgValGlyThrSer 260265270 ValGlySerLeuPheValGluAspProAspGluProGlnAsnArgMet 275280285 ThrLysTyrSerIleLeuArgGlyAspTyrGlnAspAlaPheThrIle 290295300 GluThrAsnProAlaHisAsnGluGlyIleIleLysProMetLysPro 305310315320 LeuAspTyrGluTyrIleGlnGlnTyrSerPheIleValGluAlaThr 325330335 AspProThrIleAspLeuArgTyrMetSerProProAlaGlyAsnArg 340345350 AlaGlnValIleIleAsnIleThrAspValAspGluProProIlePhe 355360365 GlnGlnProPheTyrHisPheGlnLeuLysGluAsnGlnLysLysPro 370375380 LeuIleGlyThrValLeuAlaMetAspProAspAlaAlaArgHisSer 385390395400 IleGlyTyrSerIleArgArgThrSerAspLysGlyGlnPhePheArg 405410415 ValThrLysLysGlyAspIleTyrAsnGluLysGluLeuAspArgGlu 420425430 ValTyrProTrpTyrAsnLeuThrValGluAlaLysGluLeuAspSer 435440445 ThrGlyThrProThrGlyLysGluSerIleValGlnValHisIleGlu 450455460 ValLeuAspGluAsnAspAsnAlaProGluPheAlaLysProTyrGln 465470475480 ProLysValCysGluAsnAlaValHisGlyGlnLeuValLeuGlnIle 485490495 SerAlaIleAspLysAspIleThrProArgAsnValLysPheLysPhe 500505510 IleLeuAsnThrGluAsnAsnPheThrLeuThrAspAsnHisAspAsn 515520525 ThrAlaAsnIleThrValLysTyrGlyGlnPheAspArgGluHisThr 530535540 LysValHisPheLeuProValValIleSerAspAsnGlyMetProSer 545550555560 ArgThrGlyThrSerThrLeuThrValAlaValCysLysCysAsnGlu 565570575 GlnGlyGluPheThrPheCysGluAspMetAlaAlaGlnValGlyVal 580585590 SerIleGlnAlaValValAlaIleLeuLeuCysIleLeuThrIleThr 595600605 ValIleThrLeuLeuIlePheLeuArgArgArgLeuArgLeuGlnAla 610615620 ArgAlaHisGlyLysSerValProGluIleHisGluGlnLeuValThr 625630635640 TyrAspGluGluGlyGlyGlyGluMetAspThrThrSerTyrAspVal 645650655 SerValLeuAsnSerValArgArgGlyGlyAlaLysProProArgPro 660665670 AlaLeuAspAlaArgProSerLeuTyrAlaGlnValGlnLysProPro 675680685 ArgHisAlaProGlyAlaHisGlyGlyProGlyGluMetAlaAlaMet 690695700 IleGluValLysLysAspGluAlaAspHisAspGlyAspGlyProPro 705710715720 TyrAspThrLeuHisIleTyrGlyTyrGluGlySerGluSerIleAla 725730735 GluSerLeuSerSerLeuGlyThrAspSerSerAspSerAspValAsp 740745750 TyrAspPheLeuAsnAspTrpGlyProArgPheLysMetLeuAlaGlu 755760765 LeuTyrGlySerAspProArgGluGluLeuLeuTyr 770775780 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1369 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: TGTAGATGAGCCACCTGTCTTCAGCAAACTGGCCTACATCTTACAAATAAGAGAAGATGC60 TCAGATAAACACCACAATAGGCTCCGTCACAGCCCAAGATCCAGATGCTGCCAGGAATCC120 TGTCAAGTACTCTATAGATCGACACACAGATATGGACAGAATATTCAACATTGATTCTGG180 AAATGGTTCGATTTTTACATCGAAACTTCTTGACCGAGAAACACTGCTATGGCACAACAT240 TACAGTGATAGCAACAGAGATCAATAATCCAAAGCAAAGTAGTCGAGTACCTCTATATAT300 TAAAGTTCTAGATGTCAATGACAACGCCCCAGAATTTGCTGAGTTCTATGAAACTTTTGT360 CTGTGAAAAAGCAAAGGCAGATCAGTTGATTCAGACCTTGCATGCTGTTAGCAAGGATGA420 CCCTTATAGTGGGCACCAATTTTCGTTTTCCTTGGCCCCTGAAGCAGCCAGTGGCTCAAA480 CTTTACCATTCAAGACAACAAAGACAACACGGCGGGAATCTTAACTCGGAAAAATGGCTA540 TAATAGACACGAGATGAGCACCTATCTCTTGCCTGTGGTCATTTCAGACAACGACTACCC600 AGTTCAAAGCAGCACTGGGACAGTGACTGTCCGGGTCTGTGCATGTGACCACCACGGGAA660 CATGCAATCCTGCCATGCGGAGGCGCTCATCCACCCCACGGGACTGAGCACGGGGGCTCT720 GGTTGCCATCCTTCTGTGCATCGTGATCCTACTAGTGACAGTGGTGCTGTTTGCAGCTCT780 GAGGCGGCAGCGAAAAAAAGAGCCTTTGATCATTTCCAAAGAGGACATCAGAGATAACAT840 TGTCAGTTACAACGACGAAGGTGGTGGAGAGGAGGACACCCAGGCTTTTGATATCGGCAC900 CCTGAGGAATCCTGAAGCCATAGAGGACAACAAATTACGAAGGGACATTGTGCCCGAAGC960 CCTTTTCCTACCCCGACGGACTCCAACAGCTCGCGACAACACCGATGTCAGAGATTTCAT1020 TAACCAAAGGTTAAAGGAAAATGACACGGACCCCACTGCCCCGCCATACGACTCCCTGGC1080 CACTTACGCCTATGAAGGCACTGGCTCCGTGGCGGATTCCCTGAGCTCGCTGGAGTCAGT1140 GACCACGGATGCAGATCAAGACTATGATTACCTTTAGTGACTGGGACCTCGATTCAAAAA1200 GCTTGCAGATATGTATGGAGGAGTGGACAGTGACAAAGACTCCTAATCTGTTGCCTTTTT1260 CATTTTCCAATACGACACTGAAATATGTGAAGTGGCTATTTCTTTATATTTATCCACTAC1320 TCCGTGAAGGCTTCTCTGTTCTACCCGTTCCAAAAGCCAATGGCTGCAG1369 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 414 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: ValAspGluProProValPheSerLysLeuAlaTyrIleLeuGlnIle 151015 ArgGluAspAlaGlnIleAsnThrThrIleGlySerValThrAlaGln 202530 AspProAspAlaAlaArgAsnProValLysTyrSerIleLysArgHis 354045 ThrAspMetAspArgIlePheAsnIleAspSerGlyAsnGlySerIle 505560 PheThrSerLysLeuLeuLysArgGluThrLeuLeuTrpHisAsnIle 65707580 ThrValIleAlaThrGluIleAsnAsnProLysGlnSerSerArgVal 859095 ProLeuTyrIleLysValLeuAspValAsnAspAsnAlaProGluPhe 100105110 AlaGluPheTyrGluThrPheValCysGluLysAlaLysAlaAspGln 115120125 LeuIleGlnThrLeuHisAlaValAspLysAspAspProTyrSerGly 130135140 HisGlnPheSerPheSerLeuAlaProGluAlaAlaSerGlySerAsn 145150155160 PheThrIleGlnAspAsnLysAspAsnThrAlaGlyIleLeuThrArg 165170175 LysAsnGlyTyrAsnArgHisGluMetSerThrTyrLeuLeuProVal 180185190 ValIleSerAspAsnAspTyrProValGlnSerSerThrGlyThrVal 195200205 ThrValArgValCysAlaCysAspHisHisGlyAsnMetGlnSerCys 210215220 HisAlaGluAlaLeuIleHisProThrGlyLeuSerThrGlyAlaLeu 225230235240 ValAlaIleLeuLeuCysIleValIleLeuLeuValThrValValLeu 245250255 PheAlaAlaLeuArgArgGlnArgLysLysGluProLeuIleIleSer 260265270 LysGluAspIleArgAspAsnIleValSerTyrAsnAspGluGlyGly 275280285 GlyGluGluAspThrGlnAlaPheAspIleGlyThrLeuArgAsnPro 290295300 GluAlaIleGluAspAsnLysLeuArgArgAspIleValProGluAla 305310315320 LeuPheLeuProArgArgThrProThrAlaArgAspAsnThrAspVal 325330335 ArgAspPheIleAsnGlnArgLeuLysGluAsnAspThrAspProThr 340345350 AlaProProTyrAspSerLeuAlaThrTyrAlaTyrGluGlyThrGly 355360365 SerValAlaAspSerLeuSerSerLeuGluSerValThrThrAspAla 370375380 AspGlnAspTyrAspTyrLeuSerAspTrpGlyProArgPheLysLys 385390395400 LeuAlaAspMetTyrGlyGlyValAspSerAspLysAspSer 405410 (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2550 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: CAGGAAATGCTCTTGGATCTCTGGACTCCATTAATAATATTATGGATTACTCTTCCCCCT60 TGCATTTACATGGCTCCGATGAATCAGTCTCAAGTTTTAATGAGTGGATCCCCTTTGGAA120 CTAAACAGTCTGGGTGAAGAACAGCGAATTTTGAACCGCTCCAAAAGAGGCTGGGTTTGG180 AATCAAATGTTTGTCCTGGAAGAGTTTTCTGGACCTGAACCGATTCTTGTTGGCCGGCTA240 CACACAGACCTGGATCCTGGGAGCAAAAAAATCAAGTATATCCTATCAGGTGATGGAGCT300 GGGACCATATTTCAAATAAATGATGTAACTGGAGATATCCATGCTATAAAAAGACTTGAC360 CGGGAGGAAAAGGCTGAGTATACCCTAACAGCTCAAGCAGTGGACTGGGAGACAAGCAAA420 CCTCTGGAGCCTCCTTCTGAATTTATTATTAAAGTTCAAGACATCAATGACAATGCACCA480 GAGTTTCTTAATGGACCCTATCATGCTACTGTGCCAGAAATGTCCATTTTGGGTACATCT540 GTCACTAACGTCACTGCGACCGACGCTGATGACCCAGTTTATGGAAACAGTGCAAAGTTG600 GTTTATAGTATATTGGAAGGGCAGCCTTATTTTTCCATTGAGCCTGAAACAGCTATTATA660 AAAACTGCCCTTCCCAACATGGACAGAGAAGCCAAGGAGGAGTACCTGGTTGTTATCCAA720 GCCAAAGATATGGGTGGACACTCTGGTGGCCTGTCTGGGACCACGACACTTACAGTGACT780 CTTACTGATGTTAATGACAATCCTCCAAAATTTGCACAGAGCCTGTATCACTTCTCAGTA840 CCGGAAGATGTGGTTCTTGGCACTGCAATAGGAAGGGTGAAGGCCAATGATCAGGATATT900 GGTGAAAATGCACAGTCATCATATGATATCATCGATGGAGATGGAACAGCACTTTTTGAA960 ATCACTTCTGATGCCCAGGCCCAGGATGGCATTATAAGGCTAAGAAAACCTCTGGACTTT1020 GAGACCAAAAAATCCTATACGCTAAAGGATGAGGCAGCCAATGTCCATATTGACCCACGC1080 TTCAGTGGCAGGGGGCCCTTTAAAGACACGGCGACAGTCAAAATCGTGGTTGAAGATGCT1140 GATGAGCCTCCGGTCTTCTCTTCACCGACTTACCTACTTGAAGTTCATGAAAATGCTGCT1200 CTAAACTCCGTGATTGGGCAAGTGACTGCTCGTGACCCTGATATCACTTCCAGTCCTATA1260 AGGTTTTCCATCGACCGGCACACTGACCTGGAGAGGCAGTTCAACATTAATGCAGACGAT1320 GGGAAGATAACGCTGGCAACACCACTTGACAGAGAATTAAGTGTATGGCACAACATAACA1380 ATCATTGCTACTGAAATTAGGAACCACAGTCAGATATCACGAGTACCTGTTGCTATTAAA1440 GTGCTGGATGTCAATGACAACGCCCCTGAATTCGCATCCGAATATGAGGCATTTTTATGT1500 GAAAATGGAAAACCCGGCCAAGTCATTCAAACTGTTAGCGCCATGGACAAAGATGATCCC1560 AAAAACGGACATTATTTCTTATACAGTCTCCTTCCAGAAATGGTCAACAATCCGAATTTC1620 ACCATCAAGAAAAATGAAGATAATTCCCTCAGTATTTTGGCAAAGCATAATGGATTCAAC1680 CGCCAGAAGCAAGAAGTCTATCTTTTACCAATCATAATCAGTGATAGTGGAAATCCTCCA1740 CTGAGCAGCACTAGCACCTTGACAATCAGGGTCTGTGGCTGCAGCAATGACGGTGTCGTC1800 CAGTCTTGCAATGTCGAAGCTTATGTCCTTCCAATTGGACTCAGTATGGGCGCCTTAATT1860 GCCATATTAGCATGCATCATTTTGCTGTTAGTCATCGTGGTGCTGTTTGTAACTCTACGG1920 CGGCATCAAAAAAATGAACCATTAATTATCAAAGATGATGAAGACGTTCGAGAAAACATC1980 ATTCGCTACGATGATGAAGGAGGAGGGGAGGAGGACACAGAGGCTTTTGACATTGCAACT2040 TTACAAAATCCAGATGGAATTAATGGATTTTTACCCCGTAAGGATATTAAACCAGATTTG2100 CAGTTTATGCCAAGGCAAGGGCTTGCTCCAGTTCCAAATGGTGTTGATGTCGATGAATTT2160 ATAAATGTAAGGCTGCATGAGGCAGATAATGATCCCACAGCCCCGCCATATGACTCCATT2220 CAAATATATGGCTATGAAGGCCGAGGGTCAGTGGCTGGCTCCCTCAGCTCCTTGGAGTCC2280 ACCACATCAGACTCAGACCAGAATTTTGACTACCTCAGTGACTGGGGTCCCCGCTTTAAG2340 AGACTGGGCGAACTCTACTCTGTTGGTGAAAGTGACAAAGAAACTTGACAGTGGATTATA2400 AATAAATCACTGGAACTGAGCATTCTGTAATATTCTAGGGTCACTCCCCTTAGATACAAC2460 CAATGTGGCTATTTGTTTAGAGGCAAGTTTAGCACCAGTCATCTATAACTCAACCACATT2520 TAATGTTGACAAAAAGATAATAAATAAAAA2550 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 793 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: MetLeuLeuAspLeuTrpThrProLeuIleIleLeuTrpIleThrLeu 151015 ProProCysIleTyrMetAlaProMetAsnGlnSerGlnValLeuMet 202530 SerGlySerProLeuGlnLeuAsnSerLeuGlyGluGluGlnArgIle 354045 LeuAsnArgSerLysArgGlyTrpValTrpAsnGlnMetPheValLeu 505560 GluGluPheSerGlyProGluProIleLeuValGlyArgLeuHisThr 65707580 AspLeuAspProGlySerLysLysIleLysTyrIleLeuSerGlyAsp 859095 GlyAlaGlyThrIlePheGlnIleAsnAspValThrGlyAspIleHis 100105110 AlaIleLysArgLeuAspArgGluGluLysAlaGluTyrThrLeuThr 115120125 AlaGlnAlaValAspTrpGluThrSerLysProLeuGluProProSer 130135140 GluPheIleIleLysValGlnAspIleAsnAspAsnAlaProGluPhe 145150155160 LeuAsnGlyProTyrHisAlaThrValProGluMetSerIleLeuGly 165170175 ThrSerValThrAsnValThrAlaThrAspAlaAspAspProValTyr 180185190 GlyAsnSerAlaLysLeuValTyrSerIleLeuGluGlyGlnProTyr 195200205 PheSerIleGluProGluThrAlaIleIleLysThrAlaLeuProAsn 210215220 MetAspArgGluAlaLysGluGluTyrLeuValValIleGlnAlaLys 225230235240 AspMetGlyGlyHisSerGlyGlyLeuSerGlyThrThrThrLeuThr 245250255 ValThrLeuThrAspValAsnAspAsnProProLysPheAlaGlnSer 260265270 LeuTyrHisPheSerValProGluAspValValLeuGlyThrAlaIle 275280285 GlyArgValLysAlaAsnAspGlnAspIleGlyGluAsnAlaGlnSer 290295300 SerTyrAspIleIleAspGlyAspGlyThrAlaLeuPheGluIleThr 305310315320 SerAspAlaGlnAlaGlnAspGlyIleIleArgLeuArgLysProLeu 325330335 AspPheGluThrLysLysSerTyrThrLeuLysAspGluAlaAlaAsn 340345350 ValHisIleAspProArgPheSerGlyArgGlyProPheLysAspThr 355360365 AlaThrValLysIleValValGluAspAlaAspGluProProValPhe 370375380 SerSerProThrTyrLeuLeuGluValHisGluAsnAlaAlaLeuAsn 385390395400 SerValIleGlyGlnValThrAlaArgAspProAspIleThrSerSer 405410415 ProIleArgPheSerIleAspArgHisThrAspLeuGluArgGlnPhe 420425430 AsnIleAsnAlaAspAspGlyLysIleThrLeuAlaThrProLeuAsp 435440445 ArgGluLeuSerValTrpHisAsnIleThrIleIleAlaThrGluIle 450455460 ArgAsnHisSerGlnIleSerArgValProValAlaIleLysValLeu 465470475480 AspValAsnAspAsnAlaProGluPheAlaSerGluTyrGluAlaPhe 485490495 LeuCysGluAsnGlyLysProGlyGlnValIleGlnThrValSerAla 500505510 MetAspLysAspAspProLysAsnGlyHisTyrPheLeuTyrSerLeu 515520525 LeuProGluMetValAsnAsnProAsnPheThrIleLysLysAsnGlu 530535540 AspAsnSerLeuSerIleLeuAlaLysHisAsnGlyPheAsnArgGln 545550555560 LysGlnGluValTyrLeuLeuProIleIleIleSerAspSerGlyAsn 565570575 ProProLeuSerSerThrSerThrLeuThrIleArgValCysGlyCys 580585590 SerAsnAspGlyValValGlnSerCysAsnValGluAlaTyrValLeu 595600605 ProIleGlyLeuSerMetGlyAlaLeuIleAlaIleLeuAlaCysIle 610615620 IleLeuLeuLeuValIleValValLeuPheValThrLeuArgArgHis 625630635640 GlnLysAsnGluProLeuIleIleLysAspAspGluAspValArgGlu 645650655 AsnIleIleArgTyrAspAspGluGlyGlyGlyGluGluAspThrGlu 660665670 AlaPheAspIleAlaThrLeuGlnAsnProAspGlyIleAsnGlyPhe 675680685 LeuProArgLysAspIleLysProAspLeuGlnPheMetProArgGln 690695700 GlyLeuAlaProValProAsnGlyValAspValAspGluPheIleAsn 705710715720 ValArgLeuHisGluAlaAspAsnAspProThrAlaProProTyrAsp 725730735 SerIleGlnIleTyrGlyTyrGluGlyArgGlySerValAlaGlySer 740745750 LeuSerSerLeuGluSerThrThrSerAspSerAspGlnAsnPheAsp 755760765 TyrLeuSerAspTrpGlyProArgPheLysArgLeuGlyGluLeuTyr 770775780 SerValGlyGluSerAspLysGluThr 785790 (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 730 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 2..730 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGT46 AsnSerSerSerValProGlyAspProLeuGluSerThrCysSer 151015 GCTGAAGCCCTGCTCCTCCCTGCCGGCCTCAGCACTGGGGCCTTGATC94 AlaGluAlaLeuLeuLeuProAlaGlyLeuSerThrGlyAlaLeuIle 202530 GCCATCCTCCTCTGCATCATCATTCTACTGGTTATAGTAGTACTGTTT142 AlaIleLeuLeuCysIleIleIleLeuLeuValIleValValLeuPhe 354045 GCAGCTCTGAAAAGACAGCGAAAAAAAGAGCCTCTGATCTTGTCAAAA190 AlaAlaLeuLysArgGlnArgLysLysGluProLeuIleLeuSerLys 505560 GAAGATATCAGAGACAACATTGTGAGCTATAACGATGAGGGTGGTGGA238 GluAspIleArgAspAsnIleValSerTyrAsnAspGluGlyGlyGly 657075 GAGGAGGACACCCAGGCCTTTGATATCGGCACCCTGAGGAATCCTGCA286 GluGluAspThrGlnAlaPheAspIleGlyThrLeuArgAsnProAla 80859095 GCCATTGAGGAAAAAAAGCTCCGGCGAGATATTATTCCAGAAACGTTA334 AlaIleGluGluLysLysLeuArgArgAspIleIleProGluThrLeu 100105110 TTTATTCCTCGGAGGACTCCTACAGCTCCAGATAACACGGACGTCCGG382 PheIleProArgArgThrProThrAlaProAspAsnThrAspValArg 115120125 GATTTCATTAATGAAAGGCTAAAAGAGCATGATCTTGACCCCACCGCA430 AspPheIleAsnGluArgLeuLysGluHisAspLeuAspProThrAla 130135140 CCCCCCTACGACTCACTTGCAACCTATGCCTATGAAGGAAATGATTCC478 ProProTyrAspSerLeuAlaThrTyrAlaTyrGluGlyAsnAspSer 145150155 ATTGCTGAATCTCTGAGTTCATTAGAATCAGGTACTACTGAAGGAGAC526 IleAlaGluSerLeuSerSerLeuGluSerGlyThrThrGluGlyAsp 160165170175 CAAAACTACGATTACCTCCGAGAATGGGGCCCTCGGTTTAATAAGCTA574 GlnAsnTyrAspTyrLeuArgGluTrpGlyProArgPheAsnLysLeu 180185190 GCAGAAATGTATGGTGGTGGGGAAAGTGACAAAGACTCTTAACGTAGG622 AlaGluMetTyrGlyGlyGlyGluSerAspLysAspSer*ArgArg 195200205 ATATATGTTCTGTTCAAACAAGAGAAAGTAACTCTACCCATGCTGTCT670 IleTyrValLeuPheLysGlnGluLysValThrLeuProMetLeuSer 210215220 CCACTTCACAATATTTGATATTCAGGAGCATTTCCTGCAGTCAGCACA718 ProLeuHisAsnIle*TyrSerGlyAlaPheProAlaValSerThr 225230235 ATTTTTTTCTCA730 IlePhePheSer 240 (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 241 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: AsnSerSerSerValProGlyAspProLeuGluSerThrCysSerAla 151015 GluAlaLeuLeuLeuProAlaGlyLeuSerThrGlyAlaLeuIleAla 202530 IleLeuLeuCysIleIleIleLeuLeuValIleValValLeuPheAla 354045 AlaLeuLysArgGlnArgLysLysGluProLeuIleLeuSerLysGlu 505560 AspIleArgAspAsnIleValSerTyrAsnAspGluGlyGlyGlyGlu 65707580 GluAspThrGlnAlaPheAspIleGlyThrLeuArgAsnProAlaAla 859095 IleGluGluLysLysLeuArgArgAspIleIleProGluThrLeuPhe 100105110 IleProArgArgThrProThrAlaProAspAsnThrAspValArgAsp 115120125 PheIleAsnGluArgLeuLysGluHisAspLeuAspProThrAlaPro 130135140 ProTyrAspSerLeuAlaThrTyrAlaTyrGluGlyAsnAspSerIle 145150155160 AlaGluSerLeuSerSerLeuGluSerGlyThrThrGluGlyAspGln 165170175 AsnTyrAspTyrLeuArgGluTrpGlyProArgPheAsnLysLeuAla 180185190 GluMetTyrGlyGlyGlyGluSerAspLysAspSerArgArgIleTyr 195200205 ValLeuPheLysGlnGluLysValThrLeuProMetLeuSerProLeu 210215220 HisAsnIleTyrSerGlyAlaPheProAlaValSerThrIlePhePhe 225230235240 Ser (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2625 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: CGGCAGCCCTGACGTGATGAGCTCAACCAGCAGAGACATTCCATCCCAAGAGAGGTCTGC60 GTGACGCGTCCGGGAGGCCACCCTCAGCAAGACCACCGTACAGTTGGTGGAAGGGGTGAC120 AGCTGCATTCTCCTGTGCCTACCACGTAACCAAAAATGAAGGAGAACTACTGTTTACAAG180 CCGCCCTGGTGTGCCTGGGCATGCTGTGCCACAGCCATGCCTTTGCCCCAGAGCGGCGGG240 GGCACCTGCGGCCCTCCTTCCATGGGCACCATGAGAAGGGCAAGGAGGGGCAGGTGCTAC300 AGCGCTCCAAGCGTGGCTGGGTCTGGAACCAGTTCTTCGTGATAGAGGAGTACACCGGGC360 CTGACCCCGTGCTTGTGGGCAGGCTTCATTCAGATATTGACTCTGGTGATGGGAACATTA420 AATACATTCTCTCAGGGGAAGGAGCTGGAACCATTTTTGTGATTGATGACAAATCAGGGA480 ACATTCATGCCACCAAGACGTTGGATCGAGAAGAGAGAGCCCAGTACACGTTGATGGCTC540 AGGCGGTGGACAGGGACACCAATCGGCCACTGGAGCCACCGTCGGAATTCATTGTCAAGG600 TCCAGGACATTAATGACAACCCTCCGGAGTTCCTGCACGAGACCTATCATGCCAACGTGC660 CTGAGAGGTCCAATGTGGGAACGTCAGTAATCCAGGTGACAGCTTCAGATGCAGATGACC720 CCACTTATGGAAATAGCGCCAAGTTAGTGTACAGTATCCTCGAAGGACAACCCTATTTTT780 CGGTGGAAGCACAGACAGGTATCATCAGAACAGCCCTACCCAACATGGACAGGGAGGCCA840 AGGAGGAGTACCACGTGGTGATCCAGGCCAAGGACATGGGTGGACATATGGGCGGACTCT900 CAGGGACAACCAAAGTGACGATCACACTGACCGATGTCAATGACAACCCACCAAAGTTTC960 CGCAGAGGCTATACCAGATGTCTGTGTCAGAAGCAGCCGTCCCTGGGGAGGAAGTAGGAA1020 GAGTGAAAGCTAAAGATCCAGACATTGGAGAAAATGGCTTAGTCACATACAATATTGTTG1080 ATGGAGATGGTATGGAATCGTTTGAAATCACAACGGACTATGAAACACAGGAGGGGGTGA1140 TAAAGCTGAAAAAGCCTGTAGATTTTGAAACCGAAAGAGCCTATAGCTTGAAGGTAGAGG1200 CAGCCAACGTGCACATCGACCCGAAGTTTATCAGCAATGGCCCTTTCAAGGACACTGTGA1260 CCGTCAAGATCTCAGTAGAAGATGCTGATGAGCCCCCTATGTTCTTGGCCCCAAGTTACA1320 TCCACGAAGTCCAAGAAAATGCAGCTGCTGGCACCGTGGTTGGGAGAGTGCATGCCAAAG1380 ACCCTGATGCTGCCAACAGCCCGATAAGGTATTCCATCGATCGTCACACTGACCTCGACA1440 GATTTTTCACTATTAATCCAGAGGATGGTTTTATTAAAACTACAAAACCTCTGGATAGAG1500 AGGAAACAGCCTGGCTCAACATCACTGTCTTTGCAGCAGAAATCCACAATCGGCATCAGG1560 AAGCCCAAGTCCCAGTGGCCATTAGGGTCCTTGATGTCAACGATAATGCTCCCAAGTTTG1620 CTGCCCCTTATGAAGGTTTCATCTGTGAGAGTGATCAGACCAAGCCACTTTCCAACCAGC1680 CAATTGTTACAATTAGTGCAGATGACAAGGATGACACGGCCAATGGACCAAGATTTATCT1740 TCAGCCTACCCCCTGAAATCATTCACAATCCAAATTTCACAGTCAGAGACAACCGAGATA1800 ACACAGCAGGCGTGTACGCCCGGCGTGGAGGGTTCAGTCGGCAGAAGCAGGACTTGTACC1860 TTCTGCCCATAGTGATCAGCGATGGCGGCATCCCGCCCATGAGTAGCACCAACACCCTCA1920 CCATCAAAGTCTGCGGGTGCGACGTGAACGGGGCACTGCTCTCCTGCAACGCAGAGGCCT1980 ACATTCTGAACGCCGGCCTGAGCACAGGCGCCCTGATCGCCATCCTCGCCTGCATCGTCA2040 TTCTCCTGGTCATTGTAGTATTGTTTGTGACCCTGAGAAGGCAAAAGAAAGAACCACTCA2100 TTGTCTTTGAGGAAGAAGATGTCCGTGAGAACATCATTACTTATGATGATGAAGGGGGTG2160 GGGAAGAAGACACAGAAGCCTTTGATATTGCCACCCTCCAGAATCCTGATGGTATCAATG2220 GATTTATCCCCCGCAAAGACATCAAACCTGAGTATCAGTACATGCCTAGACCTGGGCTCC2280 GGCCAGCGCCCAACAGCGTGGATGTCGATGACTTCATCAACACGAGAATACAGGAGGCAG2340 ACAATGACCCCACGGCTCCTCCTTATGACTCCATTCAAATCTACGGTTATGAAGGCAGGG2400 GCTCAGTGGCCGGGTCCCTGAGCTCCCTAGAGTCGGCCACCACAGATTCAGACTTGGACT2460 ATGATTATCTACAGAACTGGGGACCTCGTTTTAAGAAACTAGCAGATTTGTATGGTTCCA2520 AAGACACTTTTGATGACGATTCTTAACAATAACGATACAAATTTGGCCTTAAGAACTGTG2580 TCTGGCGTTCTCAAGAATCTAGAAGATGTGTAACAGGTATTTTTT2625 (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 796 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: MetLysGluAsnTyrCysLeuGlnAlaAlaLeuValCysLeuGlyMet 151015 LeuCysHisSerHisAlaPheAlaProGluArgArgGlyHisLeuArg 202530 ProSerPheHisGlyHisHisGluLysGlyLysGluGlyGlnValLeu 354045 GlnArgSerLysArgGlyTrpValTrpAsnGlnPhePheValIleGlu 505560 GluTyrThrGlyProAspProValLeuValGlyArgLeuHisSerAsp 65707580 IleAspSerGlyAspGlyAsnIleLysTyrIleLeuSerGlyGluGly 859095 AlaGlyThrIlePheValIleAspAspLysSerGlyAsnIleHisAla 100105110 ThrLysThrLeuAspArgGluGluArgAlaGlnTyrThrLeuMetAla 115120125 GlnAlaValAspArgAspThrAsnArgProLeuGluProProSerGlu 130135140 PheIleValLysValGlnAspIleAsnAspAsnProProGluPheLeu 145150155160 HisGluThrTyrHisAlaAsnValProGluArgSerAsnValGlyThr 165170175 SerValIleGlnValThrAlaSerAspAlaAspAspProThrTyrGly 180185190 AsnSerAlaLysLeuValTyrSerIleLeuGluGlyGlnProTyrPhe 195200205 SerValGluAlaGlnThrGlyIleIleArgThrAlaLeuProAsnMet 210215220 AspArgGluAlaLysGluGluTyrHisValValIleGlnAlaLysAsp 225230235240 MetGlyGlyHisMetGlyGlyLeuSerGlyThrThrLysValThrIle 245250255 ThrLeuThrAspValAsnAspAsnProProLysPheProGlnArgLeu 260265270 TyrGlnMetSerValSerGluAlaAlaValProGlyGluGluValGly 275280285 ArgValLysAlaLysAspProAspIleGlyGluAsnGlyLeuValThr 290295300 TyrAsnIleValAspGlyAspGlyMetGluSerPheGluIleThrThr 305310315320 AspTyrGluThrGlnGluGlyValIleLysLeuLysLysProValAsp 325330335 PheGluThrGluArgAlaTyrSerLeuLysValGluAlaAlaAsnVal 340345350 HisIleAspProLysPheIleSerAsnGlyProPheLysAspThrVal 355360365 ThrValLysIleSerValGluAspAlaAspGluProProMetPheLeu 370375380 AlaProSerTyrIleHisGluValGlnGluAsnAlaAlaAlaGlyThr 385390395400 ValValGlyArgValHisAlaLysAspProAspAlaAlaAsnSerPro 405410415 IleArgTyrSerIleAspArgHisThrAspLeuAspArgPhePheThr 420425430 IleAsnProGluAspGlyPheIleLysThrThrLysProLeuAspArg 435440445 GluGluThrAlaTrpLeuAsnIleThrValPheAlaAlaGluIleHis 450455460 AsnArgHisGlnGluAlaGlnValProValAlaIleArgValLeuAsp 465470475480 ValAsnAspAsnAlaProLysPheAlaAlaProTyrGluGlyPheIle 485490495 CysGluSerAspGlnThrLysProLeuSerAsnGlnProIleValThr 500505510 IleSerAlaAspAspLysAspAspThrAlaAsnGlyProArgPheIle 515520525 PheSerLeuProProGluIleIleHisAsnProAsnPheThrValArg 530535540 AspAsnArgAspAsnThrAlaGlyValTyrAlaArgArgGlyGlyPhe 545550555560 SerArgGlnLysGlnAspLeuTyrLeuLeuProIleValIleSerAsp 565570575 GlyGlyIleProProMetSerSerThrAsnThrLeuThrIleLysVal 580585590 CysGlyCysAspValAsnGlyAlaLeuLeuSerCysAsnAlaGluAla 595600605 TyrIleLeuAsnAlaGlyLeuSerThrGlyAlaLeuIleAlaIleLeu 610615620 AlaCysIleValIleLeuLeuValIleValValLeuPheValThrLeu 625630635640 ArgArgGlnLysLysGluProLeuIleValPheGluGluGluAspVal 645650655 ArgGluAsnIleIleThrTyrAspAspGluGlyGlyGlyGluGluAsp 660665670 ThrGluAlaPheAspIleAlaThrLeuGlnAsnProAspGlyIleAsn 675680685 GlyPheIleProArgLysAspIleLysProGluTyrGlnTyrMetPro 690695700 ArgProGlyLeuArgProAlaProAsnSerValAspValAspAspPhe 705710715720 IleAsnThrArgIleGlnGluAlaAspAsnAspProThrAlaProPro 725730735 TyrAspSerIleGlnIleTyrGlyTyrGluGlyArgGlySerValAla 740745750 GlySerLeuSerSerLeuGluSerAlaThrThrAspSerAspLeuAsp 755760765 TyrAspTyrLeuGlnAsnTrpGlyProArgPheLysLysLeuAlaAsp 770775780 LeuTyrGlySerLysAspThrPheAspAspAspSer 785790795 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2521 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: CGGTGGAGGCCACAGACACCTCAAACCTGGATTCCACAATTCTACGTTAAGTGTTGGAGT60 TTTTATTACTCTGCTGTAGGAAAGCCTTTGCCAATGCTTACAAGGAACTGTTTATCCCTG120 CTTCTCTGGGTTCTGTTTGATGGAGGTCTCCTAACACCACTACAACCACAGCCACAGCAG180 ACTTTAGCCACAGAGCCAAGAGAAAATGTTATCCATCTGCCAGGACAACGGTCACATTTC240 CAACGTGTTAAACGTGGCTGGGTATGGAATCAATTTTTTGTGCTGGAAGAATACGTGGGC300 TCCGAGCCTCAGTATGTGGGAAAGCTCCATTCCGACTTAGACAAGGGAGAGGGCACTGTG360 AAATACACCCTCTCAGGAGATGGCGCTGGCACCGTTTTTACCATTGATGAAACCACAGGG420 GACATTCATGCAATAAGGAGCCTAGATAGAGAAGAGAAACCTTTCTACACTCTTCGTGCT480 CAGGCTGTGGACATAGAAACCAGAAAGCCCCTGGAGCCTGAATCAGAATTCATCATCAAA540 GTGCAGGATATTAATGATAATGAGCCAAAGTTTTTGGATGGACCTTATGTTGCTACTGTT600 CCAGAAATGTCTCCTGTGGGTGCATATGTACTCCAGGTCAAGGCCACAGATGCAGATGAC660 CCGACCTATGGAAACAGTGCCAGAGTCGTTTACAGCATTCTTCAGGGACAACCTTATTTC720 TCTATTGATCCCAAGACAGGTGTTATTAGAACAGCTTTGCCAAACATGGACAGAGAAGTC780 AAAGAACAATATCAAGTACTCATCCAAGCCAAGGATATGGGAGGACAGCTTGGAGGATTA840 GCCGGAACAACAATAGTCAACATCACTCTCACCGATGTCAATGACAATCCACCTCGATTC900 CCCAAAAGCATCTTCCACTTGAAAGTTCCTGAGTCTTCCCCTATTGGTTCAGCTATTGGA960 AGAATAAGAGCTGTGGATCCTGATTTTGGACAAAATGCAGAAATTGAATACAATATTGTT1020 CCAGGAGATGGGGGAAATTTGTTTGACATCGTCACAGATGAGGATACACAAGAGGGAGTC1080 ATCAAATTGAAAAAGCCTTTAGATTTTGAAACAAAGAAGGCATACACTTTCAAAGTTGAG1140 GCTTCCAACCTTCACCTTGACCACCGGTTTCACTCGGCGGGCCCTTTCAAAGACACAGCT1200 ACGGTGAAGATCAGCGTGCTGGACGTAGATGAGCCACCGGTTTTCAGCAAGCCGCTCTAC1260 ACCATGGAGGTTTATGAAGACACTCCGGTAGGGACCATCATTGGCGCTGTCACTGCTCAA1320 GACCTGGATGTAGGCAGCGGTGCTGTTAGGTACTTCATAGATTGGAAGAGTGATGGGGAC1380 AGCTACTTTACAATAGATGGAAATGAAGGAACCATCGCCACTAATGAATTACTAGACAGA1440 GAAAGCACTGCGCAGTATAATTTCTCCATAATTGCGAGTAAAGTTAGTAACCCTTTATTG1500 ACCAGCAAAGTCAATATACTGATTAATGTCTTAGATGTAAATGAATTTCCTCCAGAAATA1560 TCTGTGCCATATGAGACAGCCGTGTGTGAAAATGCCAAGCCAGGACAGATAATTCAGATA1620 GTCAGTGCTGCAGACCGAGATCTTTCACCTGCTGGGCAACAATTCTCCTTTAGATTATCA1680 CCTGAGGCTGCTATCAAACCAAATTTTACAGTTCGTGACTTCAGAAACAACACAGCGGGG1740 ATTGAAACCCGAAGAAATGGATACAGCCGCAGGCAGCAAGAGTTGTATTTCCTCCCTGTT1800 GTAATAGAAGACAGCAGCTACCCTGTCCAGAGCAGCACAAACACAATGACTATTCGAGTC1860 TGTAGATGTGACTCTGATGGCACCATCCTGTCTTGTAATGTGGAAGCAATTTTTCTACCT1920 GTAGGACTTAGCACTGGGGCGTTGATTGCAATTCTACTATGCATTGTTATACTCTTAGCC1980 ATAGTTGTACTGTATGTAGCACTGCGAAGGCAGAAGAAAAAGCACACCCTGATGACCTCT2040 AAAGAAGACATCAGAGACAACGTCATCCATTACGATGATGAAGGAGGTGGGGAGGAAGAT2100 ACCCAGGCTTTCGACATCGGGGCTCTGAGAAACCCAAAAGTGATTGAGGAGAACAAAATT2160 CGCAGGGATATAAAACCAGACTCTCTCTGTTTACCTCGTCAGAGACCACCCATGGAAGAT2220 AACACAGACATAAGGGATTTCATTCATCAAAGGCTACAGGAAAATGATGTAGATCCAACT2280 GCCCCACCAATCGATTCACTGGCCACATATGCCTACGAAGGGAGTGGGTCCGTGGCAGAG2340 TCCCTCAGCTCTATAGACTCTCTCACCACAGAAGCCGACCAGGACTATGACTATCTGACA2400 GACTGGGGACCCCGCTTTAAAGTCTTGGCAGACATGTTTGGCGAAGAAGAGAGTTATAAC2460 CCTGATAAAGTCACTTAAGGGAGTCGTGGAGGCTAAAATACAACCGAGAGGGGAGATTTT2520 T2521 (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 794 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: MetLeuThrArgAsnCysLeuSerLeuLeuLeuTrpValLeuPheAsp 151015 GlyGlyLeuLeuThrProLeuGlnProGlnProGlnGlnThrLeuAla 202530 ThrGluProArgGluAsnValIleHisLeuProGlyGlnArgSerHis 354045 PheGlnArgValLysArgGlyTrpValTrpAsnGlnPhePheValLeu 505560 GluGluTyrValGlySerGluProGlnTyrValGlyLysLeuHisSer 65707580 AspLeuAspLysGlyGluGlyThrValLysTyrThrLeuSerGlyAsp 859095 GlyAlaGlyThrValPheThrIleAspGluThrThrGlyAspIleHis 100105110 AlaIleArgSerLeuAspArgGluGluLysProPheTyrThrLeuArg 115120125 AlaGlnAlaValAspIleGluThrArgLysProLeuGluProGluSer 130135140 GluPheIleIleLysValGlnAspIleAsnAspAsnGluProLysPhe 145150155160 LeuAspGlyProTyrValAlaThrValProGluMetSerProValGly 165170175 AlaTyrValLeuGlnValLysAlaThrAspAlaAspAspProThrTyr 180185190 GlyAsnSerAlaArgValValTyrSerIleLeuGlnGlyGlnProTyr 195200205 PheSerIleAspProLysThrGlyValIleArgThrAlaLeuProAsn 210215220 MetAspArgGluValLysGluGlnTyrGlnValLeuIleGlnAlaLys 225230235240 AspMetGlyGlyGlnLeuGlyGlyLeuAlaGlyThrThrIleValAsn 245250255 IleThrLeuThrAspValAsnAspAsnProProArgPheProLysSer 260265270 IlePheHisLeuLysValProGluSerSerProIleGlySerGlyIle 275280285 GlyArgIleArgAlaValAspProAspPheGlyGlnAsnAlaGluIle 290295300 GluTyrAsnIleValProGlyAspGlyGlyAsnLeuPheAspIleVal 305310315320 ThrAspGluAspThrGlnGluGlyValIleLysLeuLysLysProLeu 325330335 AspPheGluThrLysLysAlaTyrThrPheLysValGluAlaSerAsn 340345350 LeuHisLeuAspHisArgPheHisSerAlaGlyProPheLysAspThr 355360365 AlaThrValLysIleSerValLeuAspValAspGluProProValPhe 370375380 SerLysProLeuTyrThrMetGluValTyrGluAspThrProValGly 385390395400 ThrIleIleGlyAlaValThrAlaGlnAspLeuAspValGlySerGly 405410415 AlaValArgTyrPheIleAspTrpLysSerAspGlyAspSerTyrPhe 420425430 ThrIleAspGlyAsnGluGlyThrIleAlaThrAsnGluLeuLeuAsp 435440445 ArgGluSerThrAlaGlnTyrAsnPheSerIleIleAlaSerLysVal 450455460 SerAsnProLeuLeuThrSerLysValAsnIleLeuIleAsnValLeu 465470475480 AspValAsnGluPheProProGluIleSerValProTyrGluThrAla 485490495 ValCysGluAsnAlaLysProGlyGlnIleIleGlnIleValSerAla 500505510 AlaAspArgAspLeuSerProAlaGlyGlnGlnPheSerPheArgLeu 515520525 SerProGluAlaAlaIleLysProAsnPheThrValArgAspPheArg 530535540 AsnAsnThrAlaGlyIleGluThrArgArgAsnGlyTyrSerArgArg 545550555560 GlnGlnGluLeuTyrPheLeuProValValIleGluAspSerSerTyr 565570575 ProValGlnSerSerThrAsnThrMetThrIleArgValCysArgCys 580585590 AspSerAspGlyThrIleLeuSerCysAsnValGluAlaIlePheLeu 595600605 ProValGlyLeuSerThrGlyAlaLeuIleAlaIleLeuLeuCysIle 610615620 ValIleLeuLeuAlaIleValValLeuTyrValAlaLeuArgArgGln 625630635640 LysLysLysHisThrLeuMetThrSerLysGluAspIleArgAspAsn 645650655 ValIleHisTyrAspAspGluGlyGlyGlyGluGluAspThrGlnAla 660665670 PheAspIleGlyAlaLeuArgAsnProLysValIleGluGluAsnLys 675680685 IleArgArgAspIleLysProAspSerLeuCysLeuProArgGlnArg 690695700 ProProMetGluAspAsnThrAspIleArgAspPheIleHisGlnArg 705710715720 LeuGlnGluAsnAspValAspProThrAlaProProIleAspSerLeu 725730735 AlaThrTyrAlaTyrGluGlySerGlySerValAlaGluSerLeuSer 740745750 SerIleAspSerLeuThrThrGluAlaAspGlnAspTyrAspTyrLeu 755760765 ThrAspTrpGlyProArgPheLysValValAlaAspMetPheGlyGlu 770775780 GluGluSerTyrAsnProAspLysValThr 785790 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2690 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61: CTTCAAGGTTTTGCTGACTCAGTCTGGTAGTCAGAGTCTGCAGGAGAAGACAGTTCAAGG60 CAGGGCCTGGAGGATTGGATCAGTTTAGGGACAGGTCAAAGGCTGGCTTAGAGACCTTAG120 AGGCAGGTTGCTTGGGTCGTTGAATGCTAGTCTGGTCCTGAGAGCCCTTTTCTCTGGCAA180 CTGTGGACTCAGAGCTAACCAATTGTAGTTGGCAGTGGGGGTGAAGGGTGATCCAGAGGC240 CTGAGCTGCAGAGGGCACAAGAGAGAAAAGATGTCTTAGAAAGAGCTTTGAGAACATGCC300 TTGGCTGCTGGCAGGGACCTTGGATGGGGTAGTCTACACCCGGAAGTGCCTGCCTGCCAT360 CCTCTAGTGGCTGCCTTGCAAAATATGCTCAGTGCAGCCGCGTGCATGAATGAAAACGCC420 GCCGGGCGCTTCTAGTCGGACAAAATGCAGCCGAGAACTCCGCTCGTTCTGTGCGTTCTC480 CTGTCCCAGGTGCTGCTGCTAACATCTGCAGAAGATTTGGACTGCACTCCTGGATTTCAG540 CAGAAAGTGTTCCATATCAATCAGCCAGCTGAATTCATTGAGGACCAGTCAATTCTAAAC600 TTGACCTTCAGTGACTGTAAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATAC660 TTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAA720 ACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTC780 GGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCT840 GTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGA900 CAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAG960 TTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAG1020 AACACAGGGAGCGTCTCCGTGACACGGACCTTGGACAGAGAAGTAATCGCTGTTTATCAA1080 CTATTTGTGGAGACCACTGATGTCAATGGCAAAACTCTCGAGGGGCCGGTGCCTCTGGAA1140 GTCATTGTGATTGATCAGAATGACAACCGACCGATCTTTCGGGAAGGCCCCTACATCGGC1200 CACGTCATGGAAGGGTCACCCACAGGCACCACAGTGATGCGGATGACAGCCTTTGATGCA1260 GATGACCCAGCCACCGATAATGCCCTCCTGCGGTATAATATCCGTCAACAGACGCCTGAC1320 AAGCCATCTCCCAACATGTTCTACATCGATCCTGAGAAAGGAGACATTGTCACTGTTGTG1380 TCACCTGCGCTGCTGGACCGAGAGACTCTGGAAAATCCCAAGTATGAACTGATCATCGAG1440 GCTCAAGATATGGCTGGACTGGATGTTGGATTAACAGGCACGGCCACAGCCACGATCATG1500 ATCGATGACAAAAATGATCACTCACCAAAATTCACCAAGAAAGAGTTTCAAGCCACAGTC1560 GAGGAAGGAGCTGTGGGAGTTATTGTCAATTTGACAGTTGAAGATAAGGATGACCCCACC1620 ACAGGTGCATGGAGGGCTGCCTACACCATCATCAACGGAAACCCCGGGCAGAGCTTTGAA1680 ATCCACACCAACCCTCAAACCAACGAAGGGATGCTTTCTGTTGTCAAACCATTGGACTAT1740 GAAATTTCTGCCTTCCACACCCTGCTGATCAAAGTGGAAAATGAAGACCCACTCGTACCC1800 GACGTCTCCTACGGCCCCAGCTCCACAGCCACCGTCCACATCACTGTCCTGGATGTCAAC1860 GAGGGCCCAGTCTTCTACCCAGACCCCATGATGGTGACCAGGCAGGAGGACCTCTCTGTG1920 GGCAGCGTGCTGCTGACAGTGAATGCCACGGACCCCGACTCCCTGCAGCATCAAACCATC1980 AGGTATTCTGTTTACAAGGACCCAGCAGGTTGGCTGAATATTAACCCCATCAATGGGACT2040 GTTGACACCACAGCTGTGCTGGACCGTGAGTCCCCATTTGTCGACAACAGCGTGTACACT2100 GCTCTCTTCCTGGCAATTGACAGTGGCAACCCTCCCGCTACGGGCACTGGGACTTTGCTG2160 ATAACCCTGGAGGACGTGAATGACAATGCCCCGTTCATTTACCCCACAGTAGCTGAAGTC2220 TGTGATGATGCCAAAAACCTCAGTGTAGTCATTTTGGGAGCATCAGATAAGGATCTTCAC2280 CCGAATACAGATCCTTTCAAATTTGAAATCCACAAACAAGCTGTTCCTGATAAAGTCTGG2340 AAGATCTCCAAGATCAACAATACACACGCCCTGGTAAGCCTTCTTCAAAATCTGAACAAA2400 GCAAACTACAACCTGCCCATCATGGTGACAGATTCAGGGAAACCACCCATGACGAATATC2460 ACAGATCTCAGGGTACAAGTGTGCTCCTGCAGGAATTCCAAAGTGGACTGCAACGCGGCG2520 GGGGCCCTGCGCTTCAGCCTGCCCTCAGTCCTGCTCCTCAGCCTCTTCAGCTTAGCTTGT2580 CTGTGAGAACTCCTGACGTCTGAAGCTTGACTCCCAAGTTTCCATAGCAACAGGAAAAAA2640 AAAAAATCTATCCAAATCTGAAGATTGCGGTTTACAGCTATCGAACTTCG2690 (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 713 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: MetGlnProArgThrProLeuValLeuCysValLeuLeuSerGlnVal 151015 LeuLeuLeuThrSerAlaGluAspLeuAspCysThrProGlyPheGln 202530 GlnLysValPheHisIleAsnGlnProAlaGluPheIleGluAspGln 354045 SerIleLeuAsnLeuThrPheSerAspCysLysGlyAsnAspLysLeu 505560 ArgTyrGluValSerSerProTyrPheLysValAsnSerAspGlyGly 65707580 LeuValAlaLeuArgAsnIleThrAlaValGlyLysThrLeuPheVal 859095 HisAlaArgThrProHisAlaGluAspMetAlaGluLeuValIleVal 100105110 GlyGlyLysAspIleGlnGlySerLeuGlnAspIlePheLysPheAla 115120125 ArgThrSerProValProArgGlnLysArgSerIleValValSerPro 130135140 IleLeuIleProGluAsnGlnArgGlnProPheProArgAspValGly 145150155160 LysValValAspSerAspArgProGluArgSerLysPheArgLeuThr 165170175 GlyLysGlyValAspGlnGluProLysGlyIlePheArgIleAsnGlu 180185190 AsnThrGlySerValSerValThrArgThrLeuAspArgGluValIle 195200205 AlaValTyrGlnLeuPheValGluThrThrAspValAsnGlyLysThr 210215220 LeuGluGlyProValProLeuGluValIleValIleAspGlnAsnAsp 225230235240 AsnArgProIlePheArgGluGlyProTyrIleGlyHisValMetGlu 245250255 GlySerProThrGlyThrThrValMetArgMetThrAlaPheAspAla 260265270 AspAspProAlaThrAspAsnAlaLeuLeuArgTyrAsnIleArgGln 275280285 GlnThrProAspLysProSerProAsnMetPheTyrIleAspProGlu 290295300 LysGlyAspIleValThrValValSerProAlaLeuLeuAspArgGlu 305310315320 ThrLeuGluAsnProLysTyrGluLeuIleIleGluAlaGlnAspMet 325330335 AlaGlyLeuAspValGlyLeuThrGlyThrAlaThrAlaThrIleMet 340345350 IleAspAspLysAsnAspHisSerProLysPheThrLysLysGluPhe 355360365 GlnAlaThrValGluGluGlyAlaValGlyValIleValAsnLeuThr 370375380 ValGluAspLysAspAspProThrThrGlyAlaTrpArgAlaAlaTyr 385390395400 ThrIleIleAsnGlyAsnProGlyGlnSerPheGluIleHisThrAsn 405410415 ProGlnThrAsnGluGlyMetLeuSerValValLysProLeuAspTyr 420425430 GluIleSerAlaPheHisThrLeuLeuIleLysValGluAsnGluAsp 435440445 ProLeuValProAspValSerTyrGlyProSerSerThrAlaThrVal 450455460 HisIleThrValLeuAspValAsnGluGlyProValPheTyrProAsp 465470475480 ProMetMetValThrArgGlnGluAspLeuSerValGlySerValLeu 485490495 LeuThrValAsnAlaThrAspProAspSerLeuGlnHisGlnThrIle 500505510 ArgTyrSerValTyrLysAspProAlaGlyTrpLeuAsnIleAsnPro 515520525 IleAsnGlyThrValAspThrThrAlaValLeuAspArgGluSerPro 530535540 PheValAspAsnSerValTyrThrAlaLeuPheLeuAlaIleAspSer 545550555560 GlyAsnProProAlaThrGlyThrGlyThrLeuLeuIleThrLeuGlu 565570575 AspValAsnAspAsnAlaProPheIleTyrProThrValAlaGluVal 580585590 CysAspAspAlaLysAsnLeuSerValValIleLeuGlyAlaSerAsp 595600605 LysAspLeuHisProAsnThrAspProPheLysPheGluIleHisLys 610615620 GlnAlaValProAspLysValTrpLysIleSerLysIleAsnAsnThr 625630635640 HisAlaLeuValSerLeuLeuGlnAsnLeuAsnLysAlaAsnTyrAsn 645650655 LeuProIleMetValThrAspSerGlyLysProProMetThrAsnIle 660665670 ThrAspLeuArgValGlnValCysSerCysArgAsnSerLysValAsp 675680685 CysAsnAlaAlaGlyAlaLeuArgPheSerLeuProSerValIleLeu 690695700 LeuSerLeuPheSerLeuAlaCysLeu 705710 __________________________________________________________________________
(57)

What is claimed is:

1. A hybridoma cell line producing a monoclonal antibody capable of specifically binding to a cadherin selected from the group consisting of cadherin-4 (SEQ. ID. NO.: 48), cadherin-5, cadherin-6, cadherin-7, cadherin-8, cadherin-9, cadherin-10, cadherin-11 and cadherin-12.
2. A hybridoma cell line producing a monoclonal antibody capable of specifically binding to cadherin-5 selected from the group consisting of 30Q8A (ATCC HB11316), 30Q4H (ATCC HB11317), 45A5G (ATCC HB11318), 30S2F (ATCC HB11319), 45C6A (ATCC HB11320), 30T11G (ATCC 11324) and 64G11F (ATCC HB11527).
3. A monoclonal antibody produced by the hybridoma cell line of claim 2.
4. An antibody or antibody binding fragment capable of specifically binding to a cadherin selected from the group consisting of cadherin-4 (SEQ. ID. NO.: 48), cadherin-5, cadherin-6, cadherin-7, cadherin-8, cadherin-9, cadherin-10, cadherin-11 and cadherin-12.
5. An antibody or antibody binding fragment characterized by the ability to specifically bind to cadherin-5 and by the ability to separately bind to a synthetic peptide having an amino acid sequence selected from the group consisting of: ______________________________________ DREVYPWNL (Amino acids 430 to 439 of SEQ ID NO: 50); FTHRLFN (Amino acids 146 to 153 of SEQ ID NO: 50); VTLQDINDNFP (Amino acids 242 to 252 of SEQ ID NO: 50); and GSLFVEDP (Amino acids 274 to 281 of SEQ ID NO: 50). ______________________________________
6. A chimeric or humanized antibody capable of specifically binding to a cadherin selected from the group consisting of cadherin-4 (SEO. ID. NO.: 48), cadherin-5, cadherin-6, cadherin-7, cadherin-8, cadherin-9, cadherin-10, cadherin-11 and cadherin-12.
*****

Feedback