Methods For Cloning And Manipulating Genomes

METHODS FOR CLONING AND MANIPULATING GENOMES

INCORPORATION OF THE SEQUENCE LISTING

[0001] This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted concurrently herewith via EFS-Web as the sequence listing text file "SGI1270-2WO_ST25.txt", file size 106,496 bytes, created on May 19, 2010. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. § 1.52(e)(5).

BACKGROUND

[0002] The use of organisms that have advanced genetic systems as hosts for nucleic acid molecules isolated from a variety of species allows for the manipulation of the isolated nucleic acid sequences in the host. The ability to engineer organisms by cloning and modifying chromosomes and genomes in exogenous hosts is limited, however, by the size limitation on nucleic acid molecules that can be transferred to species such as yeast that have tractable genetics.

[0003] Nucleic acids cloned by conventional methods generally contain no more than a few genes, although larger nucleic acids (e.g., DNA) have been transferred into host cells. For example, the 16 kb mouse mitochondrial genome has been cloned in E. coli (Itaya et al, Nat Methods 5, 41 (2008); Yoon and Koob, Nucleic Acids Res 31, 1407 (2003)), Bacillus subtilis (Itaya et al. , Nat Methods 5, 41 (2008); Yoon and Koob, Nucleic Acids Res 31, 1407 (2003)), and yeast (Wheeler et al, Gene 198, 203 (1997)). The 139 kb maize chloroplast genome has been cloned in yeast (Gupta and Hoo, Plant Mol Biol 17, 361 (1991), and the 135 kb rice chloroplast genome has been cloned in B. subtilis (Itaya et al., Nat Methods 5, 41 (2008)). About 10% of the 1.8 Mb Haemophilus influenzae genome has been cloned as episomal elements in E. coli (Smailus et al. , Syst Synth Biol; 1, 139 (2007)). The 3.5 Mb Synechocystis PCC6803 genome was inserted in three noncontiguous regions into the B. subtilis genome, with the exception of the two ribosomal RNA operons (Itaya et al, PNAS USA 102, 15971 (2005)). A complete synthetic 0.6 Mb Mycoplasma genitalium genome has been assembled in yeast as a circular yeast centromeric plasmid (YCp) (Gibson et al, Science 319, 1215 (2008); Gibson et al, PNAS USA, 105(51):20404-9 (2008)). [0004] U.S. Patent No. 6,670, 154 describes methods for converting modified bacterial genomes into artificial yeast chromosomes by fusing the bacteria with yeast that linearize the modified genomes. U.S. Patent Application Publication No. 2005/0019924 describes nucleic acids and methods for introducing prokaryotic genomes into eukaryotic cells as circular molecules and conversion into artificial chromosomes. WO 02/057437 describes YAC vectors containing cytomegalovirus (CMV) genomes. U.S. Patent No. 7,083,971 describes a recombinatorial approach and system for cloning, manipulating, and delivering large nucleic acid segments. U.S. Patent Application Publication No. 2005/0003511 and Bradshaw et al. , Nucleic Acids Research, 23, 4850-56 (1995) describe yeast-bacterial shuttle vectors for cloning large regions of DNA by homologous recombination.

[0005] The disclosed cloning and manipulation methods, however, are limited by the size of donor nucleic acids that can be transferred into a host cell, and do not provide for manipulating and/or transferring a nucleic acid molecule propagated in a host cell back into a recipient cell that is related to the donor, nor do they address incompatibility issues among different cell types used in cloning with regard to foreign nucleic acids. Additional methods are needed for cloning large nucleic acids, such as chromosomes or genomes, into alternate heterelogous hosts, for manipulating the sequences of large nucleic acids in alternate hosts, and for transferring manipulated genomes back into recipient organisms that are similar to the donor organism, for example, organisms of the same genus (for example, from prokaryotic to eukaryotic cells and back).

[0006] To date, the barriers to transferring large nucleic acids, such as chromosomes and genomes, between organisms of different species or different genuses have not been overcome. For example transfer of the nucleic acids between species can be toxic to host, donor, and/or recipient cells. Manipulation and propagation of nucleic acids in organisms of different species, genuses, or groups and from prokaryotic to eukaryotic cells and back can also cause instability of the nucleic acids and inhibit their activation, such as expression of genes from the nucleic acids.

SUMMARY

[0007] Provided herein are methods, nucleic acids, and systems for transfer (cloning) of donor nucleic acids into host cells, for manipulation (e.g., modification) of donor nucleic acids, e.g., within host cells, and for transplantation of modified donor nucleic acids into recipient cells. The provided methods and other compositions are useful in transfer and manipulation of nucleic acids across branches of life, such as for manipulation of prokaryotic nucleic acids in eukaryotic host cells and transplant of the nucleic acids back into prokaryotic recipients.

[0008] The methods are useful for manipulation of donor nucleic acids of organisms having poor genetic systems by transfer into hosts having strong, well-characterized genetic systems, such as yeast. Thus, the methods, nucleic acids, and systems can be used for modifying nucleic acids of intractable organisms and to manipulate and engineer large nucleic acids, including genomes, for example, to produce synthetic genomes and cells, such as cells and genomes not previously in existence in the laboratory or in nature. The provided methods are useful for cloning, modifying, and transplanting nucleic acids and genomes that are larger than 300 kilobases (kb), such as genomes, including whole genomes and at least minimal genomes, and cellular, viral, and organelle genomes. Donor genomes can thereby be modified in host cells to produce modified donor genomes conferring one or more

phenotypes not otherwise exhibited by the native donor genome. Methods are particularly advantageous when such modified donor genomes are difficult to produce in the original cell type harboring the donor genome, or when synthetic genomes can be quickly assembled and modified in the host cell prior to transplanting the modified genome back into the original desired cell type for production of a phenotype or product of interest.

[0009] The compositions and methods identified and described in the present application allow for new methods of transferring nucleic acid molecules and genomes from intractable donor cells into host cells where they can be modified to alter the genotype, and thereby the phenotype, to alter the nucleic acid molecule or genome. The modifidied genomes can be modified in one or more ways using the host cell's genetic machinery. The provided methods also provide for isolating a modified nucleic acid molecule or genome from a host cell. The isolated modified nucleic acid molecule or genome can be methylated ex vivo. A recipient cell can be treated with the methods described herein to allow for transfer of a modified nucleic acid molecule or genome into the cell. A modified nucleic acid molecule or genome can then be further transferred into recipient cell, thereby altering the phenotype of the recipient cell to that of the modified nucleic acid molecule or genome. [0010] Provided herein is a method for cloning a donor genome, comprising: obtaining a donor genome from a donor cell or synthesizing a donor genome as one or more fragments; and introducing the donor genome and a host vector into a heterologous host cell, wherein the donor genome and the host vector are optionally joined prior to introduction into the host cell, thereby generating a host cell comprising the donor genome comprising the host vector, and further whereinthe donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length. In one embodiment, the donor genome is an essentially whole cellular, viral or organelle genome.

[0011] In the methods decribed herein, a donor genome and a host vector can be introduced into the host cell simultaneously or sequentially. If the donor genome and host vector are introduced into the host cell sequentially, the introduction can be in either order. Thus, in one embodiment, a donor genome can be introduced into the host cell followed by introduction of a host vector. Alternately, a host vector can be introduced into the host cell followed by introduction of a donor genome. In another embodiment, a host vector is joined with the donor genome prior to introduction into the host cell by transforming the host vector into a donor cell containing the donor genome.

[0012] The donor genome can be a single molecule. In one embodiment, a nucleic acid molecule containing a donor genome and a host vector can exist as a circular centromeric plasmid. Alternatively, the donor genome can exist as overlapping DNA fragments. A donor genome can be linearized or fragmented prior to introduction into the host cell.

[0013] Certain embodiments of the provided methods include further recovering the donor genome and host vector from the host cell.

[0014] In other embodiments, the methods further include introducing the donor genome into a recipient cell.

[0015] In yet other embodiments, the provided methods further include degrading or removing the genome of the recipient cell.

[0016] Donor genomes contemplated herein include, but are not limited to, a fungal genome, an archea genome, a cyanobacterial genome, an algal genome, a viral genome, a bacteriophage genome, an organelle genome, a mitochondrial genome, a chloroplast genome (e.g., a maize chloroplast genome, or a rice chloroplast genome), an organelle genome or a synthetic genome.

[0017] Host cells contemplated herein a eukaryotic cell or a prokaryotic cell. Host cells include, but are not limited to, a bacterial cell, a fungal cell, an insect cell, a plant cell or an algal cell. Host cells also include yeast cells.

[0018] A host vector described herein can be a centromeric plasmid. In one preferred embodiment, the host vector is a yeast centromeric plasmid and the host cell is a yeast cell.

[0019] A host vector described herein is a vector useful for homologous recombination.

[0020] Any of the methods described herein can further comprise modifying the donor genome within the host cell.

[0021] Furthermore, any of the methods described herein can further include recovering the donor genome comprising the host vector from the host cell. Optionally, the host vector can be removed from the donor genome. In one aspect, the methods further include introducing the recovered donor genome into a recipient cell.

[0022] The methods described herein can further include degrading or removing the endogenous genome of the recipient cell. When the method comprises the first instance of introduction of the donor genome into a recipient cell, the endogenous genome of the recipient cell is the native genome. Where multiple rounds of modifications occur (see, for example, Figures 1 and 16), the endogenous genome of the recipient cell may be a previously modified genome or a synthetic genome. Thus, in one embodiment, the provided methods further comprise modifying the donor genome in an iterative fashion.

[0023] A recovered donor genome may be methylated prior to introduction into a recipient cell by methylating one or more nucleotides in the donor genome.

[0024] A recipient cell can be, for example, a bacterial cell, a yeast cell, a fungal cell, an insect cell, a plant cell or an algal cell. In one aspect, a restriction endonuclease function of a recipient cell is absent, removed, or inactivated prior to introduction of the donor genome. For example, a restriction modification enzyme can be mutated in the recipient cell to render it inactive. [0025] In a preferred embodiment the donor genome is derived from a prokaryotic cell (either natural or synthetic) and cloned in a eukaryotic cell where it may be optionally modified, and then recovered and introduced back into a prokaryotyic cell. In certain preferred embodiments, the donor genome is derived from a bacterial cell (either natural or synthetic) and cloned in a yeast cell where it may be optionally modified, and then recovered and introduced back into a bacterial cell.

[0026] The methods provided herein further include introducing a second donor genome into the host cell where the second donor genome is different from the first donor genome, thereby producing a host cell containing two different donor genomes. Introducing the second donor genome can occur via mating the host cell containing the first donor genome with a second host cell containing the second donor genome. Introduction of the recovered donor genome into the recipient cell can phenotypically transform the recipient cell to a phenotype corresponding to the donor genome, incorporating any modifications thereto.

[0027] Provided herein is a process for making a cell which exhibits a phenotype encoded by a donor genome, said process comprising: (a) introducing into a host cell, the donor genome and a host vector suitable for cloning the donor genome in the host cell such that a product comprising the donor genome comprising the host vector is obtained; (b) recovering the product comprising the donor genome comprising the host vector obtained in step (a) from the host cell; (c) introducing the product of (b) into a recipient cell under conditions such that the recipient cell exhibits a phenotype encoded by the product; and (d) recovering the cell resulting from step (c); wherein the donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length and comprises the minimal components of nucleic acid material necessary for the recipient cell to exhibit the phenotype encoded by the donor genome. In one aspect, the method further comprises modifying the donor genome of (a) within the host cell. In another aspect, the method further comprises degrading or removing an endogenous genome of the recipient cell. In yet another aspect, the method further comprises modifying the donor genome of (a) within the host cell and degrading or removing an endogenous genome of the recipient cell. In certain embodiments, such processes may be automated. [0028] Provided herein is a cell which exhibits a desired phenotype encoded by a donor genome and not otherwise exhibited by the cell, wherein the cell is produced by the processes described herein.

[0029] Also provided herein is a cell which comprises a donor genome and exhibits a desired phenotype encoded by the donor genome and not otherwise exhibited by the cell, wherein the donor genome comprises greater than 300 kb of foreign genomic nucleic acid material and the minimal components of a genome necessary for the cell to exhibit the desired phenotype. Desired phenotypes may include the production of a expression product not native to the original cell, or modified (e.g, selective or regulated expression) or up- regulation of an existing expression product.

[0030] The provided methods also include cloning a plurality of genomes in a plurality of host cells. The plurality of genomes can be genomic variants. In one embodiment, introducing the plurality of genomes into host cells comprises introducing host vectors and a plurality of variant overlapping fragments into the host cells, thereby generating a

combinatorial library of variant genomes.

[0031] In one aspect, following recovery of a donor genome from a host cell, the provided methods comprise introducing the donor genome into a recipient cell and the recipient cell supports gene expression from the donor genome to a greater extent than the host cell.

[0032] In one aspect, the provided methods comprise modifying the donor genome in a host cell; and modifying the donor genome comprises inducing one or more substitutions, one or more deletions, one or more insertions, one or more rearrangements, one or more recombinations, one or more homologous recombinations, or a combination thereof, into the donor genome.

[0033] In another aspect, the method comprises modifying the donor genome; and modification of the donor genome effects or improves a property of the donor genome compared to the donor genome prior to modification.

[0034] The provided methods also include transplantation into a recipient cell where transplantation can be carried out in the presence of polyethylene glycol (PEG). Various sizes of PEG that can be used in the present methods include, but are not limited to, sizes ranging from PEG 4,000 to PEG 20,000. In one embodiment, the size is PEG 8,000. Various concentrations of PEG can be used in the disclosed methods such as, for example, from about 1% to about 20%. In one embodiment, PEG is used in a concentration of about 5%.

[0035] Provided herein is a vector for whole genome modification, comprising a prokaryotic genome that is at least a minimal genome; a prokaryotic replication origin; a prokaryotic selection marker; a transposase and inverted repeats; one or more nucleic acid sequences capable of supporting segregation and replication in a eukaryotic cell; and a eukaryotic selection marker. In one aspect of the provided methods, the eukaryotic cell is a yeast cell. The prokaryotic genome, prokaryotic replication origin and selection marker can be bacterial. In one embodiment, the nucleic acid supporting segregation and replication in a eukaryotic cell comprises one or more of a CEN nucleic acid and an ARS nucleic acid. In another embodiment, the prokaryotic genome comprises at least at or about 300 kb in length. In another embodiment, the vector is stable in a eukaryotic and in a prokaryotic cell.

Provided herein is a combinatorial library containing a plurality of vectors, wherein the prokaryotic genomes can be genome variants.

[0036] Provided herein is an isolated cell, a synthetic cell or a recombinant cell, comprising a foreign donor genome prepared by any of the methods described herein.

[0037] Provided herein is a yeast nucleic acid construct for seamless modification of target region within a target nucleic acid, comprising: a first portion of homology, containing homology to a portion of the target nucleic acid that is upstream or downstream of the target region along the length of the target nucleic acid; a nucleic acid encoding an endonuclease under the control of an inducible promotor; a nucleotide sequence recognized by the endonuclease; a yeast selectable marker; a second portion of homology, containing homology to a 5' portion of the target region; and a third portion of homology, containing homology to a 3' portion of the target region. In one embodiment, the second and third portions of homology flank the first portion of homology, the nucleic acid encoding the endonuclease, and the yeast selectable marker. The endonuclease recognition site can be adjacent to the second or the third homologous portion and can be on the opposite terminus of the construct relative to the first portion of homology. One or both of the second and third regions of homology comprises one or more substitutions, one or more deletions, one or more insertions, one or more rearrangements, one or more recombinations, one or more homologous recombinations, or one or more combinations thereof, compared to the homologous portion in the target nucleic acid.

[0038] Provided herein is a method for seamlessly introducing a modification in a target nucleic acid molecule, comprising: introducing a mutagenesis construct and a host vector into a host cell whereby the host vector recombines with the mutagenesis construct in the host cell, wherein the mutagenesis construct contains a first portion of homology to a 5' portion of the target nucleic acid molecule upstream of the modification; an endonuclease recognition site, a promoter, a gene encoding the endonuclease, and a selectable marker; a second repeat portion of homology that is homologous to the sequence of the genome upstream of a target locus; and a third portion of homology that is homologous to a 3' portion of the target region downstream of the modification; and incubating the cells under conditions whereby recombination occurs between the first portion of homology and the upstream or downstream portion, thereby seamlessly removing a portion of the construct, that promote one or more double-strand break cleavages in the nucleic acid molecule near the target site containing the construct, whereby a modification is seamlessly introduced into the target nucleic acid molecule.

[0039] Treatment to promote double-strand break cleavage can include expression of an endonuclease that cleaves the target nucleic acid molecule containing the construct at a recognition site, producing a double-strand break. In one aspect, the provided methods further comprise performing a selection step, thereby selecting cells in which the yeast selectable marker has been removed from the target nucleic acid.

[0040] The provided methods comprise transplantation into a recipient cell where transplantation is carried out by isolating the donor genome in the presence of agarose;

incubating the donor genome in the presence of a methyltransferase, whereby the donor genome is methylated; melting the agarose; and incubating the donor genome with the recipient cell. Incubation with a methyltransferase can be incubation with a crude cell extract.

[0041] The provided methods can further include incubating the donor genome in the presence of a proteinase after incubation with the methytransferase, thereby removing proteins. [0042] Typically, the donor genomes and the modified genomes contemplated herein are large nucleic acids. In one embodiment the donor genome is at least at or about or greater than about 100 kb, about 150 kb, about 200 kb, about 250 kb, about 300 kb, about 350 kb, about 400 kb, about 450 kb, about 500 kb, about 550 kb, about 600 kb about 600 kb, about 650 kb, about 700 kb, about 750 kb, about 800 kb, about 850 kb, about 900 kb, about 1 megabase (MB), about 1.1 MB, about 1.2 MB, about 1.3 MB, about 1.4 MB, about 1.5 MB, about 1.6 MB, about 1.7 MB, about 1.8 MB, about 1.9 MB, about 2 MB, about 2.5 MB, about 3 MB, about 3.5 MB, about 4 MB, 4 about.5 MB, or greater in length, or any number therebetween.

BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 illustrates various embodiments by which a donor genome and host vectors can be introduced (by transformation or cotransformation) into a host cell. One or more genome modifications can be made in the host cell. The modified genome can then be isolated and transplanted into a recipient cell.

[0044] Figures 2A-2C illustrate three methods for cloning bacterial genomes in yeast. (A) In order to be propagated by yeast upon transformation, a host vector can be incorporated into a bacterial genome by transformation of the bacterium; the recombined genome and host vector can be isolated and used to transform a yeast host cell. Alternatively, (B) a whole genome and an optionally linearlized host vector can be cotransformed into a yeast host cell, where the yeast host cell combines the vector and the bacterial genome by homologous recombination genome. In another scenario (C), a bacterial genome can be cloned by assembling multiple overlapping fragments and co-transforming the fragments into yeast host cell with a host vector where the bacterial genome fragments and host vector are combined by homologous recombination in the yeast host cell.

[0045] Figures 3A-3F illustrate yeast vector insertions in each of the M. genitalium, M. mycoides LC, and M. pneumoniae genomes, using the approach of Figure 2 A. Figures 3A, 3B and 3E illustrate two shuttle vectors used in the experiments. Figures 3C, 3D and 3F illustrate the location of the vector insertion in each genome. Mycoplasma markers are the spiralin promoters, tetM, and lacZ; yeast vector features are CEN, ARS and HIS3; the E. coli plasmid backbone is ampicillin resistance (ampR) and pUC19 origin (ori); BAC sequences are BAC; and transposon elements are IS256 outer inverted repeat (IR), IS256 inner inverted repeat (IR), and transposase (tnp).

[0046] Figures 4A-4B show the analysis of whole Mycoplasma genome clones containing yeast vector sequences. Figure 4A provides a map of the M. genitalium cll6-2 genome. The location of the yeast vector insertion is marked. Bars indicate position and numbers indicate size of PCR amplicons. Restriction fragments are numbered and their sizes provided in the legend; Eagl digest correspond to restriction fragment 1 and BssHlI digests correspond to restriction fragments 2-6. Figure 4B provides a map of the M. pneumoniae genome. The location of the yeast vector insertion is marked. Bars indicate position and numbers indicate size of PCR amplicons. Restriction fragments are numbered and their sizes provided in the legend; Notl digests correspond to restriction fragments 1-4 and Sbf! correspond to restriction fragments 5 and 6.

[0047] Figure 5 provides a map of the M. mycoides LC ell .1 genome. Arrowheads represent IS 1296 elements. Bars indicate position and numbers indicate size of PCR amplicons.

[0048] Figs. 6A-D illustrate targeted insertion of a yeast vector using homologous recombination as four alternate methods. A yeast vector insertion was attempted with and without a double-stranded break at the insertion point. Figure 6A: Intact genome and linear vector. Figure 6B: Overlapping genome fragments and vector with homology internal to one of the fragments. Figure 6C: Genome cleaved at the integration target and linear vector. Figure 6D: Overlapping genome and vector fragments with homology to two of the fragments.

[0049] Figures 7A-7C demonstrate that crude extracts protected donor plasmid DNA from host restriction-modification system and increased efficiency of transformation, but inhibited genome transplantation. Figure 7 A illustrates treatment of agarose plugs with a methylation step or the results of no treatment. Figure 7B shows native genomic DNA treated in the absence of crude extracts (shown to allow transplant into recipient cells) displayed a punctate pattern (right panel), while endogenous genomic DNA treated in the presence of crude extracts (shown to inhibit transplant) formed large aggregates (left two panels). Figure 7C shows that removal of the crude extracts by proteinase K treatment after incubation with the genomic DNA in agarose plugs restored the punctate pattern originally observed with the untreated genomic DNA.

[0050] Figure 8 shows three alternative whole genome transplantation methods that can be used. The first approach (1), includes digestion of agarose plugs containing the genomic DNA {e.g., with β-agarase (melting step)), followed by transplantation directly into recipient cells. The second approach (2) is identical to the first method, except that recipient cells had been modified to mutate the restriction enzyme genes (ARE). In the third approach (3), genomic DNA samples were methylated in vitro and subjected to a deproteinisation step (treatment with proteinase K), prior to the melting step (β-agarase digestion) and

transplantation into recipient cells.

[0051] Figures 9A-9C illustrate problems with conventional modification methods with respect to unspecific deletions or rearrangements. CEN6 = round circles contained within constructs. Figure 9A illustrates introduction of the wild-type fragment into yeast carrying the M. genitalium with URA3 insertion followed by selection on SD-HIS plates containing FOA, resulting in selection of two different types of recombination events (PI

(recombination between the wild-type fragment and the genome) and P2 (recombination among repeats within the genome) as shown in Figure 9B). These events would produce cells carrying the alternative products illustrated in Figure 9C.

[0052] Figures 10A-10D illustrate alternate seamless modification methods. Figure 10A schematically illustrates generation of a diletto perfetto mutagenesis cassette: the cassette was introduced into the yeast strain containing the M. genitalium genome, using lithium acetate integrative transformation. Individual Ura+ transformants were selected and analyzed by PCR, using diagnostic primers Seq-F and Seq-R (shown as small, single-head arrows flanking the insertion site. A fusion product was generated that contained the URA 3 marker and a 358 bp fragment ("repeat" fragment) homologous to a portion just upstream of the target locus (large arrow labeled as "repeat". To generate the final mutagenesis cassette (Figure 10B), the fusion product was PCR-reamplified: the resulting cassette contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), the URA3 marker, the repeat cassette, and 50 bp of homology to a 3' portion of the target region. The cassette was designed in this orientation so that upon transformation into the yeast host cells, replacement of a 450 base pair target region within the CDS 139 locus of the M. genitalium genome with this cassette (by HR) would result in a region in the genome containing two tandem repeat sequences (large arrows in labeled as "repeat") flanking the URA3 selection marker. Figure IOC: a TREC (Tandem Repeat with Endonuclease Cleavage) mutagenesis construct was generated by fusing the (GALl/l-Scel)- URA3 fusion product with the 358 bp "repeat" fragment located upstream of the target locus. The resulting TREC cassette contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), a CORE cassette

(consisting of the 18 bp l-Scel recognition site, the GALl promoter, a gene encoding l-Scel endonuclease and the URA3 marker), the "repeat" (358 bp portion homologous to sequence of the genome just upstream of the target wt gene locus), and 50 bp of homology to a 3' portion of the target region (downstream of the single-base deletion being corrected). The resulting LoxP-RE-GALl-Cxe-URA3-loxP- E mutagenesis cassette (Figure 10D) contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), a first loxP site (loxP-RE), the GALl promoter, a Cre recombinase gene ORF, the URA3 marker, a second loxP site loxP-LE), and 50 bp of homology to a 3' portion of the target region (downstream of the single-base deletion).

[0053] Figure 11 illustrates generation of a Type III restriction enzyme deletion. To make a M. mycoides LC Type III restriction enzyme gene {typelllres) deletion in yeast, a linear DNA fragment, Knock-Out Cassette (KOC), was constructed by fusing two PCR products, CORE and tandem repeat sequence (TRS). This cassette was then transformed into yeast W303a strain harboring M. mycoides LC genome- YCp to replace the TypeR III ORF via the 50-bp homologous sequences to the target sites (Atypelllres: :URA3). Galactose induction results in the expression of l-Scel endonuclease which cleaves the 18-bp l-Scel site (asterisk) to create a double strand break that promotes the homologous recombination between two tandem repeat sequences (red arrow). Recombination between the TRSs creates a seamless deletion of the typelllres gene (AtypefflR).

[0054] Figures 12 A - 12B illustrate engineering a point mutation at the MG259 locus of a synthetic M. genitalium genome. Figure 12 A illustrates the scheme of mutation correction by two sequential homologous recombinations. Two primers (arrows), Seq-F and Seq-R, are separated by 0.4 kb in MG259 locus, and the insertion of a 1.1 kb URA3 marker results in the production of a 1.3 kb PCR DNA fragment. Figure 12B illustrates possibilities of the URA3 marker loss from an M. genitalium YAC. 5-FOA resistant clones could be derived either from the replacement of the URA3 marker with the wild type DNA fragment (Rl) or from recombination between two repetitive sequences (R2). Size and locations of repeat sequences are schematic.

[0055] Figure 13 illustrates an outline of an exemplary TREC method. The target region is replaced with a mutagenesis cassette that consists of a knock-out CORE (anl8-bp of l-Scel recognition site, I-Scelgene under the control of GAL1 promoter, and the URA3 gene) and a DNA fragment (shown in arrow) identical to the upstream of the target site. The replacement generates tandem repeat sequences encompassing the CORE. Galactose induces the expression of l-Scel that generates a double-strand break (DSB) at l-Scel site. DSB promotes an intramolecular homologous recombination between the repeat sequences leading to an excision of the CORE.

[0056] Figures 14A and 14B illustrate two other methods to engineer the same locus and produce a point mutation or 450 bp deletion by the delitto perfetto method (Figure 14A) or the tandem repeat pop-out method (Figure 14B), respectively.

[0057] Figure 15 illustrates exemplary generation of final mutagenesis cassette constructs.

[0058] Figure 16 illustrates moving a donor genome into host cell, engineering it, and installing it back into a recipient by genome transplantation. In an exemplary method, after cloning a bacterial genome with a yeast vector in yeast, the repertoire of yeast genetic methods is used to create insertions, deletions, rearrangements, or any combination of modifications in the bacterial genome. This engineered genome is then isolated and transplanted into a recipient cell to generate an engineered bacterium. Before transplantation back into the recipient cell it may be necessary to methylate the donor DNA in order to protect it from the recipient cell's restriction system(s). This cycle can be repeated starting from the newly engineered genome (dashed arrow).

[0059] Figure 17 provides the nucleic acid sequence of the seamless deletion region of the YCpMmycl . l-Atypelllres M. mycoides genome transplant verifying that the Type III restriction gene was removed as designed. Italicized sequence text corresponds to the "typelllmod" region of the genetic maps Figure 19; underlined sequence text corresponds to the "typelllres" region; and bold text corresponds to the "IGR" region. A small portion of the typelllres gene remained after the deletion because of the overlap between the typellrniod and typelllres genes. The start and stop codons of the typelllres gene are underlined in enlarged font; the stop codon of the typelllmod gene is illustrated in underlined, italicized, bold enlarged font. Figure 17 discloses SEQ ID NO: 195.

[0060] Figures 18A-18C show the stability of the M. mycoides YCpMmycl .1 genome during propagation in yeast. Figure 18A provides a schematic of the YCpMmycl.1 genome. The position of the integrated YCp is shown. The nine individual primer pairs used in the PCR amplifications are shown at their approximate locations in the genome and are numbered corresponding to the amplicons in Figure 18B. Figure 18B. Stability of the M. mycoides genome during propagation in yeast was tested by two methods. In the first, a yeast culture of a clone containing the genome was plated on solid synthetic media lacking histidine for two days and then individual colonies were patched onto a new plate. In the second, a yeast culture of a clone containing the genome was grown to saturation, diluted to a 1/100 fraction and again grown to saturation. The culture was then plated on solid synthetic media lacking histidine for two days and then individual colonies were patched onto a new plate. In both methods, genomic DNA was isolated and used as template in multiplex PCR amplification using the nine individual primer pairs shown in A. The resulting amplicons were analyzed by gel electrophoresis. The numbers on the right side of the gel correspond to the individual primer pair amplicons as shown in A. Lane G is a positive control and lane N is the no-genome negative control. Molecular weight markers are in lane M. The results shown are representative of the 40 samples analyzed. All 40 clones appear to contain complete genomes, demonstrating that the bacterial genome is stable during routine propagation in yeast. Figuer 18C provides a schematic of the M. mycoides YCpMmycl .1 genome; the position of the integrated YCp is shown. The nine individual primer pairs used in the PCR amplifications are shown at their approximate locations in the genome and are numbered corresponding to the amplicons identified by Fig 18B. . The diagonal line represents the missing amplicons in clone 3. After transformation of an M. mycoides

YCpMmycl.l yeast clone with a cassette containing URA3, genomes of Ura+ clones were evaluated by multiplex PCR and the resulting amplicons were analyzed by gel electrophoresis (data not shown). Amplicons 5 to 8 were missing in Clone 3, suggesting that there is a large deletion in this genome. The other four clones appeared to contain complete genomes. [0061] Figure 19 illustrates the generation of Type III restriction enzyme deletions. To make an M. mycoides Type III restriction enzyme gene (typefflres) deletion in yeast (iii), a linear DNA fragment, knockout cassette, by fusing two PCR products, CORE and tandem repeat sequence (TR) was constructed (i). This cassette was then transformed into a yeast W303a strain harboring the YCpMmycl.l M. mycoides genome (ii). Growth on (-)His (- )Ura medium selected for replacement of the Type III restriction enzyme open reading frame (ORF) by the cassette via the 50-base pair (bp) sequences homologous to the target sites (AtypeIIIres::URA3). Galactose induction results in the expression of 1-SceI endonuclease, which cleaves the 18-bp l-Scel site (asterisk) to create a double-strand break that promotes homologous recombination between two tandem repeat sequences (TR) (unmarked line above constructs). Recombination between the TRs creates a seamless deletion of the typefflres gene (Atypelllres), which was isolated following 5-flouroorotic acid (5-FOA) counterselection against the URA3 gene. IGR, intergenic region. The expected sizes were obtained for each amplicon (data now shown).

[0062] Figure 20 provides a schematic demonstrating the assembly of a synthetic M. mycoides genome in yeast. A 1,077,947 bp synthetic M. mycoides genome was assembled from 1,078 overlapping DNA cassettes in three steps. In the first step, 1,080 bp cassettes (orange arrows), produced from overlapping synthetic oligonucleotides, were recombined in sets of 10 to produce one hundred nine ~10 kb assemblies (blue arrows). These were then recombined in sets of 10 to produce eleven ~100 kb assemblies (green arrows). In the final stage of assembly, these eleven fragments were recombined into the complete genome (red circle). With the exception of 2 constructs that were enzymatically pieced together in vitro (white arrows), assemblies were carried out by in vivo homologous recombination in yeast. Major variations from the natural genome are shown as yellow circles. These include 4 watermarked regions (WM1-WM4), a 4 kb region that was intentionally deleted (94D), and elements for propagation in yeast and genome transplantation. In addition, there are 20 locations with nucleotide polymorphisms (asterisks). Coordinates of the genome are relative to the first nucleotide of the natural M. mycoides sequence. The locations of the Ascl and BssHII restriction sites are shown. Cassettes 1 and 800-810 were unnecessary and removed from the assembly strategy. Cassette 2 overlaps cassette 1104 and cassette 799 overlaps cassette 811. [0063] Figure 21 provides a schematic illustrating error correction using PCR and in vitro recombination. Primers (BH pUC bckbn Fori and Revl) were used to amplify the plasmid backbone for use in the recombination reaction. Complements of backbone primers (BH insert Fori and Revl) were used in conjunction with error correcting primers (Cassette Fix Fori and Revl) to produce amplicons with regions of homology to each other and the BH backbone amplicon. The three PCR products were used in in vitro recombination to generate the corrected cassette.

DETAILED DESCRIPTION

A. Definitions

[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art.

[0065] All patents, published patent applications, other publications, and sequences from GenBank, and other databases referred to herein are incorporated by reference in their entirety with respect to the related technology.

[0066] The practice of the provided embodiments will employ, unless otherwise indicated, conventional techniques of molecular biology and the like, which are within the skill of the art. Such techniques are explained fully in the literature. See e.g., Molecular Cloning: A Laboratory Manual, (J. Sambrook et al, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989); Current Protocols in Molecular Biology (F. Ausubel et al. eds., 1987 and updated); Essential Molecular Biology (Brown ed., IRL Press 1991); Gene Expression Technology (Goeddel ed., Academic Press 1991); Methods for Cloning and Analysis of Eukaryotic Genes (Bothwell et al. eds., Bartlett Publ. 1990); Gene Transfer and Expression (Kriegler, Stockton Press 1990); Recombinant DNA Methodology (R. Wu et al. eds., Academic Press 1989); PCR: A Practical Approach (M. McPherson et al, IRL Press at Oxford University Press 1991); Cell Culture for Biochemists (R. Adams ed., Elsevier Science Publishers 1990); Gene Transfer Vectors for Mammalian Cells (Miller & M. Calos eds., 1987); Mammalian Cell Biotechnology (M. Butler ed., 1991); Animal Cell Culture (Pollard et al. eds., Humana Press 1990); Culture of Animal Cells, 2nd Ed. (Freshney et al. eds., Alan R. Liss 1987).

[0067] As used herein, "a" or "an" mean "one", "at least one" or "one or more." [0068] As used herein, "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "oligonucleotides," and "polynucleotide" are used interchangeably and include both ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) and modified nucleic acid molecules, such as peptide nucleic acids (PNA), locked nucleic acids (LNA), and other modified nucleic acid molecules, including, without limitation, cDNA, genomic DNA and mRNA and synthetic nucleic acid molecules, such as those that are chemically synthesized or recombinantly produced. Nucleic acid molecules can be double-stranded or single-stranded. Where single-stranded, the nucleic acid molecule can be the sense strand or the antisense strand. In addition, nucleic acid molecules can be circular or linear.

[0069] As used herein, a "restriction endonuclease site" refers to a target nucleic acid sequence that is recognized and cleaved by a restriction enzyme. Restriction enzymes are well known in the art.

[0070] As used herein, "genome" includes whole (complete) genomes (e.g., whole cellular, viral, and organelle genomes), and also includes portions of whole genomes having nucleic acid sequences sufficient to effect and/or sustain viability of a cell (minimal cellular genome), viability, within a host cell, of an organism that depends on a host cell for viability (e.g., minimal viral genome), or organelle function within a host cell (minimal organelle genome), under at least one set of environmental conditions. Thus, the term genome refers to whole genomes and portions thereof that are at least minimal genomes. The particular environmental conditions and property that is caused or sustained by the genome can be specified. In the case of an organelle or viral genome, or other genome that depends on a host cell for propagation and viability, the environmental conditions can include the environment of a suitable and functional host cell. Thus, the term genome encompasses minimal genomes and minimal replicative genomes, and genomes containing additional nucleic acid sequences beyond those found in such minimal genomes but not containing all the nucleic acid sequences present in a whole genome. The term "genome" encompasses naturally-occurring genomes and synthetic genomes, and includes genetically engineered genomes, such as genomes not previously existing in nature or in a laboratory, including modified genomes and hybrid genomes that contain nucleic acids and/or portions of genomes from more than one species. The term "genome" encompasses organelle genomes (e.g., mitochondrial and chloroplast genomes), genomes of self-replicating organisms (cellular genomes), including prokaryotic and eukaryotic organisms, fungi, yeast, bacteria (e.g., Mycoplasma), archeabacteria, vertebrates, mammals, and other organisms, and viral genomes and other genomes that depend on a host for propagation. Genomes further include those of organisms not falling into any known Linnean catergory and synthetic organisms. Exemplary genomes can be microorganism genomes, such as genomes of unicellular organisms including bacteria and yeast.

[0071] As used herein, "cellular genome" refers to genomes containing nucleic acid sequences sufficient to cause and/or sustain viability of a cell. Such nucleic acid sequences include those encoding molecules required for replication, transcription, translation, energy production, transport, production of membranes and cytoplasmic components, and cell division. Cellular genomes include minimal cellular genomes, whole cellular genomes, and genomes having nucleic acids additional to minimal cellular genomes but not all the nucleic acids of whole cellular genomes. Cellular genomes differ from "viral genomes" and

"organelle genomes" at least in that a cellular genome contains the nucleic acids sufficient for replication and/or viability of a cell whereas viral and organelle genomes contain the nucleic acids necessary to sustain or replicate the virus or organelle, e.g., within a host cell, but not to sustain the viability or replication of the host cell.

[0072] As used herein, "minimal genome" refers to a genome consisting of or consisting essentially of a minimal set of nucleic acids sufficient to effect and/or sustain viability of a cell (minimal cellular genome), viability, within a host cell, of an organism that depends on a host cell for viability (e.g., minimal viral genome), or organelle function within a host cell (minimal organelle genome), under at least one set of environmental conditions. It is understood that even whole organelle genomes do not necessarily encode all the proteins needed to perpetuate the organelle, and that some of the proteins are encoded by genes within the nucleus of the cell containing the organelle. Thus, minimal organelle genomes need only contain those genes necessary for organelle function within the environment of the cell. Similarly, it is understood that viruses depend on host cells for viability and thus minimal viral genomes need only support viability of the virus within a host cell. "Minimal replicating genomes" are minimal genomes that, in addition to the minimal nucleic acid sequences sufficient for survival, further contain nucleic acid sequences sufficient for self replication of a cell or organism. [0073] As used herein, synthetic nucleic acid sequences, including synthetic genomes, all or part of which have been constructed from genetic components that have been chemically synthesized in vitro or copies of such components. The copies may have been produced by any of a number of methods as are known in the art, including cloning and amplification by in vivo or in vitro methods. A completely synthetic nucleic acid sequence or genome is one in which the entire nucleic acid or genome has been chemically synthesized in vitro or has been produced or assembled from copies of such in vitro chemically synthesized nucleic acids. By contrast, a "semi-synthetic" genome refers to a partially synthetic nucleic acid sequence or genome is a synthetic genome in which some of the genetic components are naturally- occurring, including nucleic acids cloned from naturally-occurring nucleic acids.

[0074] As used herein, a foreign or heterologous genome or nucleic acid sequence is a genome or nucleic acid sequence that is present in a host cell but is derived from a donor organism that is of a different species than the host cell. The donor organism can be of a different genus, order, kingdom, or other genetic classification, or can simply be of a different species in the same genus.

[0075] As used herein, a "target nucleic acid sequence" refers to a nucleic acid sequence that is targeted for modification, for example, by the modification methods described herein and known in the art. One or more modifications of a target nucleic acid sequence includes introduction of one or more mutations, one or more deletions, one or more substitutions and/or one or more insertions into the target nucleic acid sequence. Target regions are particular regions of the target nucleic acid sequences, such as a single gene locus, multiple gene loci, or portions thereof that are the subject of modification. In one example, the target region includes the region of the target nucleic acid sequence that is replaced with another nucleic acid sequence such as, for example, by homologous recombination. After

modification of the target nucleic acid sequence, it is not necessary that the entire target region in the modified nucleic acid sequence be modified compared to the original target region. For example, modification of the target region can encompass a single insertion, deletion or substitution at a target position/residue within the target region, or can encompass modification of a number of positions/residues within one or more target portions of the target region. B. Methods for cloning and manipulating genomes and large nucleic acids

[0076] Provided herein are nucleic acids, methods and systems for introducing donor genomes and other donor nucleic acid sequences into heterologous host cells, for modifying the donor genomes and nucleic acid sequences within host cells, recovering donor genomes and nucleic acid sequences from the host cells, and introducing the recovered donor genomes and nucleic acid sequences into recipient cells. Included within the scope of the provided nucleic acid sequences, methods and systems, are aspects that minimize incompatibility, e.g. and/or toxicity between nucleic acid sequences, cells, and genetic systems of donors, hosts, and recipients. An exemplary embodiment of the provided methods is illustrated in Figure 1, in which the methods are used to transform a bacterial donor genome into a yeast host cell, by joining it with a yeast host vector, modifying the donor genome within the yeast host cell, and transplanting the modified donor genome into a bacterial recipient cell, thereby generating an engineered bacterium. As indicated in Figure 1, the modified genome present in that engineered bacterium can be isolated and serve as a donor genome in a subsequent round of the methods in an iterative fashion. A number of variations of this embodiment are contemplated and within the scope of this application, as described herein. Another exemplary method of the provided methods is illustrated in Figure 16 in which the methods are used to insert a host yeast vector into a bacterial genome, isolate the genome with the integrated yeast vector, transform a yeast host cell with the bacterial genome/yeast vector, modify the bacterial genome, isolate the modified genome, optionally methylate the genome, and transplant the donor genome into a recipient cell.

[0077] Example 5 describes the successful combination of the provided methods to generate a new bacterial organism by transforming a donor bacterial genome into yeast host cells, modifying the donor genome within the yeast cells, and then transplanting the resulting modified donor genomes into recipient cells, whereupon gene expression from the modified donor genomes was induced. The results were verified by negative controls and sequencing of genomes in the recipient cells. This study demonstrated successful generation of a M mycoides LC genome, containing a seamless deletion of the Type III restriction enzyme gene, which could not have been generated within the Mycoplasma using current state of the art method using its available native genetic systems. Transplantation produced a M. mycoides LC strain that had not previously existed in the laboratory or in nature. Thus, the provided methods can be used for successful genetic engineering outside of the cell encoding the genome being engineered.

[0078] Methods and tools, and resulting cells, for manipulating genomes and large nucleic acids are provided, for example, to engineer and alter organisms that can produce useful compounds, such as vaccines, drugs, biologically produced proteins or chemicals, and biofuels. In particular, methods are needed for manipulation of genomes and chromosomes of organisms having poor genetic systems, such as intractable organisms, to generate modified genes, genomes, and organisms that produce new gene products such as those useful in energy production and medicine.

[0079] Prior to the present application, available methods for manipulating genomes and other large nucleic acids were limited. Many organisms, including unicellular organisms such as prokaryotes, with desirable properties/characteristics/phenotypes, such as the ability to produce useful compounds and the capacity to function in extreme environments, have very poor or non-existent genetic systems (systems allowing modification of the organisms' nucleic acids in the laboratory). Accordingly, the present disclosure provides methods and tools needed to transfer these genomes and nucleic acids into other cells (host cells) that have more desirable genetic systems and to modify the genomes and nucleic acids within these other cells using the desirable systems.

[0080] In order to produce new gene products from the modified nucleic acids, the present invention also provides methods to transplant them from the host cells into an environment in which gene products can be expressed, such as an appropriate recipient cell. Although expression may be sufficient in host cells, for example, it may be desirable to transplant the donor genomes from the host cells into recipient cells that have cellular environments that more closely replicate that of the original donor cell or organism from which the natural or synthetic donor genome was derived. Generally, improved transfer, cloning, modification, and transplantation methods, nucleic acids, and systems that can be used to manipulate and engineer genomes and other nucleic acids, particularly large nucleic acids, are provided herein.

[0081] Similarly, prior to the present application, transfer of large nucleic acids, including genomes, into host cells, by available methods was limited. While conventional methods for cloning nucleic acids are well known (bacteria and yeast having good genetic systems have been used as hosts for cloning nucleic acid segments from a number of organisms), limitations associated with these methods can make them undesirable for manipulating and engineering genomes and large nucleic acids. For example, the size of nucleic acid that can be cloned into a host cell using conventional methods is limited. Nucleic acids cloned by conventional methods generally contain no more than a few genes.

[0082] Incompatibility and toxicity issues can also limit available cloning methods. For example, donor nucleic acids can be toxic to host cells {e.g., if toxic proteins are expressed from the donor nucleic acid) and can becomes unstable during events such as host cell replication and/or modification using the host's genetic system. Such events may limit the ability to manipulate the nucleic acids within the host cells. Further, the fact that unwanted modifications to a donor genome, which may occur during the modification process, often have no negative impact on host cell viability can make donor genomes and other nucleic acids unstable in host cells.

[0083] Incompatibility issues also can impair efficient transplant of the donor genomes from the host cells back into a more natural environment for expression of gene products, such as into recipient cells of the same or closely related species as the donor. Among the provided embodiments are modification methods that overcome such issues for successful propagation and modification of donor nucleic acids, including genomes, in genetically distinct host cells, such as yeast host cells for transplantations into recipient cells more distinct from the species of the original donor genome.

[0084] Recovery of donor genomes from a host cell and further introduction of the donor genome into a recipient cell, where the donor, host and recipient cells are less closely related (such as from different branches of life), may pose additional challenges. For example, introduction of donor genomes propagated in eukaryotic hosts into prokaryotic recipients may be limited by incompatibility and toxicity issues. Restriction-modification systems that are present in recipient cells (and perhaps also in donor cells), but not in host cells can cause incompatibility upon transplantation if the donor genome has been propagated within the host cell. Although some host cells, such as yeast, do not contain restriction-modification systems, they can express DNA methyltransferases that can modify the donor nucleic acids being propagated in the host cell, thereby inhibiting activation of the donor nucleic acid (e.g., genome) upon transplantation into a recipient cell. The structure and confirmation of donor genomes isolated after propagation and modification in host cells can also differ from the confirmation and structure of the same genome propagated in a cell more closely related to the donor organism. Such differences can negatively impact transplantation.

[0085] Described herein are methods that overcome such limitations for successful cloning of donor genomes, modification and/or propagation of donor genomes in host cells, recovery of the donor genomes and introduction of donor genomes into recipient cells. In one aspect, donor genomes recovered from host cells are introduced into genetically distinct recipient cells (such as from eukaryotic hosts to prokaryotic recipients).

[0086] Donor nucleic acid sequences, e.g., donor genomes, are selected and synthesized, assembled, and/or isolated (e.g., from donor cells) and cloned in host cells. The methods comprise obtaining a donor genome from a donor cell or synthesizing a donor genome as one or more fragments and introducing the donor genome and a host vector into a heterologous host cell, wherein the donor genome and the host vector are optionally joined prior to introduction into the host cell, thereby generating a host cell comprising the donor genome comprising the host vector, and further whereinthe donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length.

[0087] A first embodiment typically involves introduction of a host vector into a cell containing a donor genome, joining of the donor genome to the host vector, recovering the donor genome comprising the host vector and transforming a host cell such that the donor genome comprising the host vector is maintained v thin the host cell during host cell replication.

[0088] In a second embodiment, a host vector and a linearized donor genome are cotranformed in a host cell where the host vector and donor genome are joined by homologous recombination in the host cell.

[0089] In a third embodiment, overlapping DNA fragments (natural or synthetic) and a host vector are cotranformed in a host cell where the host vector and DNA fragments are joined by homologous recombination in the host cell. [0090] A donor genome to be used in the present methods can be an essentially whole cellular, viral or organelle genome.

[0091] The donor genome and the host vector can be introduced into the host cell simultaneously or sequentially in either order. In one embodiment, the host vector is joined with the donor genome prior to introduction into the host cell by transforming the host vector into a donor cell containing the donor genome.

[0092] A host cell for use in the present embodiments can be a eukaryotic cell or a prokaryotic cell. Host cells include, but are not limited to, a bacterial cell, a fungal cell, an insect cell, a plant cell, or an algal cell. Host cells also include yeast cells.

[0093] A host vector is a vector useful for homologous recombination. A host vector for use in the present embodiments can be a centromeric plasmid. In one embodiment, the host vector is a yeast centromeric plasmid and the host cell is a yeast cell.

[0094] A donor genome contemplated for use in the present embodiments can be, for example, a bacterial genome, a fungal genome, a yeast genome, an archeal genome, a cyanobacterial genome, an algal genome, a bacteriophage genome, a mitochondrial genome, a chloroplast genome, viral genome, an organelle genome, or a synthetic genome.

[0095] In another aspect, the methods further comprise modifying the donor genome within the host cell.

[0096] In another aspect, the methods further comprise recovering the donor genome comprising the host vector from the host cell.

[0097] In another aspect, the methods further comprise introducing the recovered donor genome into a recipient cell.

[0098] In yet another aspect, the methods further comprise degrading or removing the endogenous genome of the recipient cell.

[0099] Optionally, a recovered donor genome can be methylated prior to introduction into the recipient cell. [0100] Optionally, a recipient cell's restriction endonulease function is absent, removed or inactivated.

[0101] A recipient cell contemplated for use in the present embodiments can he, for example, a bacterial cell, a yeast cell, a fungal cell, an insect cell, a plant cell, or an algal cell.

[0102] In yet another aspect, the methods further comprise introducing a second donor genome into the host cell, wherein the second donor genome is different from the first donor genome, thereby producing a host cell containing two different donor genomes. Introducing the second donor genome can comprise mating the host cell containing the first donor genome with a second host cell containing the second donor genome. Introducing the recovered donor genome into the recipient cell can phenotypically transform the recipient cell to a phenotype corresponding to the donor genome incorporating any modifications thereto.

[0103] Provided herein is an isolated, synthetic or recombinant cell produced by any of the methods described herein.

[0104] Provided herein is a process for making a cell which exhibits a phenotype encoded by a donor genome, said process comprising: (a) introducing into a host cell, the donor genome and a host vector suitable for cloning the donor genome in the host cell such that a product comprising the donor genome comprising the host vector is obtained; (b) recovering the product comprising the donor genome comprising the host vector obtained in step (a) from the host cell; (c) introducing the product of (b) into a recipient cell under conditions such that the recipient cell exhibits a phenotype encoded by the product; and (d) recovering the cell resulting from step (c); wherein the donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length and comprises the minimal components of nucleic acid material necessary for the recipient cell to exhibit the phenotype encoded by the donor genome. In one aspect, the method further comprises modifying the donor genome of (a) within the host cell. In another aspect, the method further comprises degrading or removing an endogenous genome of the recipient cell. In yet another aspect, the method further comprises modifying the donor genome of (a) within the host cell and degrading or removing an endogenous genome of the recipient cell. [0105] Provided herein is a cell which exhibits a desired phenotype encoded by a donor genome and not otherwise exhibited by the cell, wherein the cell is produced by the processes described herein.

[0106] Also provided herein is a cell which comprises a donor genome and exhibits a desired phenotype encoded by the donor genome and not otherwise exhibited by the cell, wherein the donor genome comprises greater than 300 kb of foreign genomic nucleic acid material and the minimal components of a genome necessary for the cell to exhibit the desired phenotype.

[0107] The modification methods and tools include aspects that minimize the risk of instability of the donor nucleic acid sequence within the host cell during modification. In a third embodiment, donor nucleic acid sequences are transplanted from host cells into recipient cells, which can be of a different species and/or different branches of life than the donor cells and the host cells, or of the same species as the donor cells. The transplant methods include aspects that minimize the risk of incompatibility and toxicity among the donor genome, host cells, and the recipient cells.

[0108] The transfer, modification, and transplantation methods can be performed separately, and can also be performed sequentially, in combination. Thus, in one

embodiment, the three steps can be combined in a method by which donor genomes are transferred into a host cell, modified within the host cell, and transplanted into a recipient cell to generate a new cell, thereby generating a genome or cell not previously existing in the laboratory or in nature. The recipient cells can be further grown into, or transferred into, a non-human organism not previously existing. Thus, the provided methods, nucleic acids and systems can be used to produce new organisms. Also provided are newly created organisms and nucleic acid sequences thereof.

[0109] The provided methods and compositions are particularly useful for manipulating and engineering genomes from organisms that are genetically intractable. In one example, the methods, nucleic acid sequences, and systems are used to clone whole bacterial genomes from Mycoplasma genitalium, Mycoplasma pneumoniae, and Mycoplasma mycoides LC as circular centromeric plasmids in yeast, to modify the donor genomes within the yeast using the yeast genetic systems with modifications to minimize incompatibility and, further, to transplant the modified bacterial genomes into recipient cells of a different species, thereby generating genomes and organisms not previously existing in the lab or in nature.

[0110] The provided methods, nucleic acid sequences, systems, and organisms can be used to engineer organisms that synthesize biofuels. For example, although bacteria such as Escherichia coli can be genetically modified, many prokaryotes having the potential to produce industrially useful compounds or to function in extreme environments have very poor or non-existent genetic systems. Prochlorococcus marinus is among the most abundant photosynthetic organisms on earth. While it is desirable to manipulate and engineer this and other such organisms to produce biofuels, the ability to manipulate and engineer such organisms is limited by the lack of available methods to genetically alter them. The provided methods can be used to carry out such manipulations. For example, in one embodiment, nucleic acid sequences encoding components of new metabolic pathways can be introduced into the genomes of such organisms by transfer and modification within host cells. Such re- engineered genomes can be transplanted into suitable recipient cells to produce new cells, e.g., new cells that can convert sunlight and carbon dioxide into a biofuel. Such engineered cells and organisms also are provided herein.

[0111] The provided method also can be useful for engineering archea, cloning new organelles into eukaryotes and adding chromosomes to cells and organisms. For example, eukaryotic mitochondria and chloroplasts are remnants of endosymbiotic bacteria that have become trapped in their hosts. The provided methods can be used to engineer such organelle genomes in hosts, e.g., in yeast using plasmids, using homologous recombination, thereby creating new mitochondria and chloroplast genomes having improved energy production efficiency and/or metabolism, such as in yeast or algae.

[0112] In another embodiment, the provided methods can be used to manipulate viruses, such as those with large genomes that are too large for manipulation in simple plasmids, to produce viruses and bacteriophages having therapeutic uses. In one aspect, viral genomes are cloned and manipulated to improve their immunogenicity and other therapeutic advantages.

[0113] In another embodiment, the provided methods can be used to manipulate fungi to produce fungii useful in the production of, for example, wine, bread, beer and medicine. In one aspect, fungal genomes are cloned and manipulated to improve their resistance to temperature, disease-causing organisms, and other advantages. In another embodiment, the provided methods can be used to manipulate yeast to produce yeast useful in ethanol fuel, nutritional suppliements, probiotics, fermentation for production of beverages (alcoholic and non-alcoholic) or for use in baking.

[0114] Although certain embodiments are provided herein, the methods and processes of the present invention are universal tools that can be used to produce any desired phenotype or product of interest.

[0115] Methods and processes of the invention are amenable to automation and to adaptation to high throughput methods, for example, allowing for the joining of multiple nucleic acid molecules and transformation into host or recipient cells simultaneously by computer-mediated and/or robotic methods that do not require human intervention.

[0116] The present invention, thus, is directed to systematic methods and the products thereof that permit efficient and extensive assembly, cloning, modification, and

transformation of nucleic acid molecules comprising genomes in a high-throughput manner, and readily adaptable to robotic implementation. In alternative embodiments, nucleic acid assembly reactions can be performed on a solid surface as opposed to in a reaction tube, for example, on a chip using microfluidics.

C. Selection and isolation of donor genomes and nucleic acids

[0117] In a first step of the provided methods, a donor genome or other nucleic acid sequence is selected for transfer, modification, and/or transplantation. The nucleic acid sequences that are transferred, modified, transplanted, and generated by the methods described herein can be of any natural or synthetic organism. Thus, the donor genome is derived from any desired cell or any nucleic acid-containing subunit thereof, either by isolation or chemical synthesis. For example, the nucleic acid sequences include genomes (such as whole genomes, portions of whole genomes that are at least minimal genomes and/or at least minimal replicating genomes, cellular genomes, organelle genomes, and viral genomes), chromosomes, and other large nucleic acid sequences from known organisms and new organisms. The nucleic acid sequences, including genomes, can be of any source within the organisms, including organelle genomes, such as mitochondrial and chloroplast genomes, chromosomes, portions of genomes or chromosomes of plants and animals, algal sources, and any genomic material that supports cell viability, including the whole and minimal cellular genome of bacteria and other prokaryotes, and eukaryotic organisms.

[0118] It is apparent, from a review of the examples below and discussion provided herein that the applicability of the described methods are not limited to constructing synthetic genomes that mimic those present in nature. The methods can be used, for example, to join portions of genomes of various organisms in the same DNA molecule to generate new genomes and organisms not present in nature or in the laboratory. The donor genomes and other nucleic acids can be cloned, propagated and/or isolated from cells, such as cells or tissues (including genetically engineered organisms), or can be chemically synthesized in vitro. Methods for isolating and preparing the nucleic acids and genomes are described below. i. Donor organisms, genomes and other nucleic acids

[0119] Genomes and other nucleic acid sequences used and generated in the provided methods (e.g., the donor nucleic acids) include those derived from fungi, yeast, bacteria, other prokaryotes, and algae but are not limited to such organisms. They can be of any organism, natural or synthetic, e.g., organisms of the kingdoms Protista, Archaebacteria, Eubacteria, Fungi, Plantae, andAnimalia, and viruses, including bacteriophages.

[0120] Exemplary nucleic acid sequences are those derived from bacteria, archea, cyanobacteria (e.g., Prochlorococcus marinus, Synechocystis PCC6803, etc.), algae, viruses (e.g., Haemophilus influenzae genomes), fungi (e.g., Saccharomyces cerevisiae,

Saccharomyces bay anus, Saccharomyces boulardii, Neurospora crassa, etc.), and bacteriophages. Exemplary Mycoplasma strains include Mycoplasma genitalium (e.g., M. genitalium strain MS5, described in Example 1, M. genitalium G37 (GenBank No. L43967)), Mycoplasma mycoides (e.g., M. mycoides subspecies mycoides Large Colony (LC) strain GM12 (Example 1), Mycoplasma capricolum subsp. capricolum (strain California Kid™) (ATCC 27343), Mycoplasma mycoides subsp. mycoides (strain GM12) (Damassa et al, 1983), Mycoplasma capricolum subsp. capricolum (M.capricolum), such as wtMcapricolum and a Mcapricolum mutant (M. capricolum- ARE) and Mycoplasma pneumonia (e.g., M. pneumoniae strain M129-B170 (ATCC 29343); M. pneumoniae M129, GenBank Accession Number U00089.2 (GI: 26117688)), Mycoplasma gallisepticum (ATCC 15302), Mycoplasma pneumoniae Eaton (ATCC15531), and derivatives thereof. [0121] Exemplary genomes and nucleic acids include full and partial genomes of a number of organisms for which genome sequences are publicly available and can be used with the disclosed methods, such as, but not limited to, Aeropyrum pernix; Agrobacterium tumefaciens; Anabaena; Anopheles gambiae; Apis mellifera; Aquifex aeolicus; Arabidopsis thaliana; Archaeoglobus fulgidus; Ashbya gossypii; Bacillus anthracis; Bacillus cereus; Bacillus halodurans; Bacillus licheniformis; Bacillus subtilis; Bacteroides fragilis;

Bacteroides thetaiotaomicron; Bartonella henselae; Bartonella quintana; Bdellovibrio bacteriovorus; Bifidobacterium longum; Blochmannia floridanus; Bordetella bronchiseptica; Bordetella parapertussis; Bordetella pertussis; Borrelia burgdorferi; Bradyrhizobium japonicum; Brucella melitensis; Brucella suis; Buchnera aphidicola; Burkholderia mallei; Burkholderia pseudomallei; Caenorhabditis briggsae; Caenorhabditis elegans;

Campylobacter jejuni; Candida glabrata; Canis familiaris; Caulobacter crescentus;

Chlamydia muridarum; Chlamydia trachomatis; Chlamydophila caviae; Chlamydophila pneumoniae; Chlorobium tepidum; Chromobacterium violaceum; Ciona intestinalis;

Clostridium acetobutylicum; Clostridium perfringens; Clostridium tetani; Corynebacterium diphtheriae; Corynebacterium efficiens; Coxiella burnetii; Cryptosporidium hominis;

Cryptosporidium parvum; Cyanidioschyzon merolae; Debaryomyces hansenii; Deinococcus radiodurans; Desulfotalea psychrophila; Desulfovibrio vulgaris; Drosophila melanogaster; Encephalitozoon cuniculi; Enterococcus faecalis; Erwinia carotovora; Escherichia coli; Fusobacterium nucleatum; Gallus gallus; Geobacter sulfurreducens; Gloeobacter violaceus; Guillardia theta; Haemophilus ducreyi; Haemophilus influenzae; Halobacterium;

Helicobacter hepaticus; Helicobacter pylori; Homo sapiens; Kluyveromyces waltii;

Lactobacillus johnsonii; Lactobacillus plantarum; Legionella pneumophila; Leifsonia xyli; Lactococcus lactis; Leptospira interrogans; Listeria innocua; Listeria monocytogenes;

Magnaporthe grisea; Mannheimia succiniciproducens; Mesoplasma florum; Mesorhizohium loti; Methanobacterium thermoautotrophicum; Methanococcoides burtonii; Methanococcus jannaschii; Methanococcus maripaludis; Methanogenium frigidum; Methanopyrus kandleri; Methanosarcina acetivorans; Methanosarcina mazei; Methylococcus capsulatus; Mus musculus; Mycobacterium bovis; Mycobacterium leprae; Mycobacterium paratuberculosis; Mycobacterium tuberculosis; Mycoplasma gallisepticum; Mycoplasma genitalium;

Mycoplasma mycoides; Mycoplasma penetrans; Mycoplasma pneumoniae; Mycoplasma pulmonis; Mycoplasma mobile; Nanoarchaeum equitans; Neisseria meningitidis;

Neurospora crassa; Nitrosomonas europaea; Nocardia farcinica; Oceanobacillus iheyensis; Onions yellows phytoplasma; Oryza sativa; Pan troglodytes; Pasteur ella multocida;

Phanerochaete chrysosporium; Photorhabdus luminescens; Picrophilus torridus;

Plasmodium falciparum; Plasmodium yoelii yoelii; Populus trichocarpa; Porphyromonas gingivalis Prochlorococcus marinus; Propionibacterium acnes; Protochlamydia

amoebophila; Pseudomonas aeruginosa; Pseudomonas putida; Pseudomonas syringae; Pyrobaculum aerophilum; Pyrococcus abyssi; Pyrococcus furiosus; Pyrococcus horikoshii; Pyrolobus fumarii; Ralstonia solanacearum; Rattus norvegicus; Rhodopirellula baltica; Rhodopseudomonas palustris; Rickettsia conorii; Rickettsia typhi; Rickettsia prowazekii; Rickettsia sibirica; Saccharomyces cerevisiae; Saccharomyces bayanus; Saccharomyces boulardii; Saccharopolyspora erythraea; Salmonella enterica; Salmonella typhimurium; Schizosaccharomyces pombe; Shewanella oneidensis; Shigella flexneria; Sinorhizobium meliloti; Staphylococcus aureus; Staphylococcus epidermidis; Streptococcus agalactiae; Streptococcus mutans; Streptococcus pneumoniae; Streptococcus pyogenes; Streptococcus thermophilus; Streptomyces avermitilis; Streptomyces coelicolor; Sulfolobus solfataricus; Sulfolobus tokodaii; Synechococcus; Synechocystis; Takifugu rubripes; Tetraodon nigroviridis; Thalassiosira pseudonana; Thermoanaerobacter tengcongensis; Thermoplasma acidophilum; Thermoplasma volcanium; Thermosynechococcus elongatus; Thermotagoa maritima; Thermus thermophilus; Treponema denticola; Treponema pallidum; Tropheryma whipplei; Ureaplasma urealyticum; Vibrio cholerae; Vibrio parahaemolyticus; Vibrio vulnificus; Wigglesworthia glossinidia; Wolbachia pipientis; Wolinella succinogenes;

Xanthomonas axonopodis; Xanthomonas campestris; Xylella fastidiosa; Yarrowia lipolytica; Yersinia pseudotuberculosis; and Yersinia pestis nucleic acids.

[0122] The term "algae" includes cyanobacteria (Cyanophyceae), green algae

(Chlorophyceae), yellow-green algae (Xanthophyceae), golden algae (Chrysophyceae), brown algae (Phaeophyceae), red algae (Rhodophyceae), diatoms (Bacillariophyceae), and "pico-plankton" (Prasinophyceae and Eustigmatophyceae). Also included in the term algae are members of the taxonomic classes Dinophyceae, Cryptophyceae, Euglenophyceae, Glaucophyceae, and Prymnesiophyceae. Microalgae are unicellular or colonial algae that can be seen as single organisms only with the aid of a microscope. Microalgae include both eukaryotic and prokaryotic algae (e.g., cyanobacteria). Photosynthetic bacteria include cyanobacteria, green sulfur bacteria, purple sulfur bacteria, purple nonsulfur bacteria, and green nonsulfur bacteria. [0123] Exemplary genomes and nucleic acids include full and partial genomes of a number of algal organisms for which genome sequences are publicly available and can be used with the disclosed methods, such as, but not limited, Achnanthes, Amphiprora, Amphora, Ankistrodesmus, Aster omonas, Boekelovia, Borodinetta, Botryococcus,

Bracteococcus, Chaetoceros, Carteria, Chlamydomonas, Chlorococcum, Chlorogonium, Chlorella, Chroomonas, Chrysosphaera, Cricosphaera, Crypthecodinium, Cryptomonas, Cyclotella, Dunaliella, Ellipsoidon, Emiliania, Eremosphaera, Ernodesmius, Euglena, Franceia, Fragilaria, Gloeothamnion, Haematococcus, Halocafeteria, Hymenomonas, Isochrysis, Lepocinclis, Micr actinium, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Ochromonas, Oedogonium, Oocystis, Ostreococcus, Pavlova, Parachlorella, Pascheria, Phaeodactylum, Phagus, Platymonas, Pleurochrysis,, Pleurococcus, Prototheca, Pseudochlorella, Pyramimonas, Pyrobotrys, Scenedesmus, Schizochytrium, Skeletonema, Spyrogyra, Stichococcus,

Tetraselmis, Thraustochytrium, Thalassiosira, Viridiella, or Volvox species. In some embodiments, photosynthetic bacteria, including for example, green sulfur bacteria, purple sulfur bacteria, green nonsulfur bacteria, purple nonsulfur bacteria, or cyanobacteria may be used. Cyanobacterial species that can be used include, without limitation, Agmenellum, Anabaena, Anabaenopsis, Anacystis, Aphanizomenon, Arthrospira, Asterocapsa, Borzia, Calothrix, Chamaesiphon, Chlorogloeopsis, Chroococcidiopsis, Chroococcus, Crinalium, Cyanobacterium, Cyanobium, Cyanocystis, Cyanospira, Cyanothece, Cylindrospermopsis, Cylindrospermum, Dactylococcopsis, Dermocarpella, Fischerella, Fremyella, Geitleria, Geitlerinema, Gloeobacter, Gloeocapsa, Gloeothece, Halospirulina, Iyengariella,

Leptolyngbya, Limnothrix, Lyngbya, Microcoleus, Microcystis, Myxosarcina, Nodularia, Nostoc, Nostochopsis, Oscillatoria, Phormidium, Planktothrix, Pleurocapsa,

Prochlorococcus, Prochloron, Prochlorothrix, Pseudanabaena, Rivularia, Schizothrix, Scytonema, Spirulina, Stanieria, Starria, Stigonema, Symploca, Synechococcus,

Synechocystis, Tolypothrix, Trichodesmium, Tychonema, or Xenococcus species.

[0124] The genomes and other nucleic acid sequences include modified and synthetic nucleic acid sequences derived from such genomes. The presently described methods are equally applicable to yet unpublished nucleic acid sequences, as they become available, including those that characterize multicellular organisms such as higher plants, such as corn and rice, mammals such as rodents (mice, rats, rabbits, etc.), pigs, cows, bulls, horses, primates, sheep, and companion animals (e.g., dogs, cats, etc.). In one embodiment, cells isolated from a human can be used to obtain a donor genome. Many of these are available at the present time. The nucleic acid sequences and genomes include those that do not mimic those present in nature.

[0125] In one embodiment, the genomes and other nucleic acid sequences selected for manipulation by the methods are derived from intractable organisms or other organisms with poor genetic systems or genetic systems that are less desirable than those of host organisms, including certain prokaryotes and other non-yeast organisms, such as those in which common genetic techniques are inefficient, such as double crossover homologous recombination and transposon mutagenesis. These techniques are inefficient, for example, in certain bacterial organisms, such as Mycoplasma species. Although integration of plasmid DNA by single crossover events has been carried out for targeted addition and disruption of genes in M. mycoides LC (Janis, C, et al. 2005, Appl Environ Microbiol 71 :2888-93), this organism contains a paucity of selection markers, limiting the number of genetic modifications that can be performed in a single M. mycoides LC cell.

[0126] Of interest are organisms such as prokaryotes, including those with poor genetic systems, with the potential to produce industrially useful compounds and/or to function in extreme environments (e.g., elevated temperatures, elevated pressure, etc.). Exemplary organisms include those that can be used to produce biofuels. Other exemplary organisms include those that undergo photosynthetic processes. Genomes and organisms can be genetically modified using the methods described herein and known in the art to generate novel genomes and organisms for the production of biofuels. For example, genes involved in photosynthesis and other metabolic processes can be modified to generate organisms that produce oils, e.g., biofuels, in place of glucose or another carbon source. Thus, included herein are genomes are those of organisms engineered with the capacity to convert sunlight and carbon dioxide into a biofuel. One such exemplary organism is Prochlorococcus marinus, which is among the most abundant photosynthetic organisms on earth but has an ineffecient genetic system.

[0127] In one embodiment, the methods are carried out to modify and engineer genomes, such as whole (complete) genomes (e.g., whole cellular, viral, and organelle genomes), and portions of whole genomes containing genetic material sufficient to effect and/or sustain viability of a cell (minimal cellular genome), viability, within a host cell, of an organism that depends on a host cell for viability (e.g., minimal viral genome), or organelle function within a host cell (minimal organelle genome), under at least one set of environmental conditions. In one aspect, the genome is a minimal genome or a minimal replicative genome. In another aspect, the genome contains additional nucleic acid sequences beyond those found in a minimal genome or in a whole genome.

[0128] The genome can be naturally-occurring or synthetic, such as genetically engineered genomes including modified genomes and hybrid genomes that contain nucleic acid sequences and/or portions of genomes from more than one species.

[0129] In one aspect, the genomes are cellular genomes, containing nucleic acid sequences sufficient to cause and/or sustain viability of a cell, e.g., those encoding molecules required for replication, transcription, translation, energy production, transport, production of membranes and cytoplasmic components, and cell division.

[0130] In another aspect, the genome is a viral or organelle genome.

[0131] In one embodiment, the nucleic acid sequences are organelle nucleic acid sequences, e.g., organelle genomes, such as plastid, e.g., chloroplast, and mitochondrial genomes. Eukaryotic organelles, such as mitochondria and chloroplasts, are cytoplasmic DNA-containing, membrane-bound compartments thought to be remnants of endosymbiotic bacteria that became trapped in their hosts. Generally, mitochondria are found naturally in all eukaryotic cells and chloroplasts and other plastids are found naturally in plants and algae. Plastid genomes vary in size from 35 to 217 kb, with the majority being between 115 and 165 kb. Mitochondrial genomes vary greatly in size among different species, and can be from below 20 kb to over 350 kb. The methods of the present application allow for engineering of organelle genomes in host cells using nucleic acids and genetic systems within the host cells. For example, organelles can be modified in yeast hosts using yeast plasmids and homologous recombination. The provided methods can be used to generate novel mitochondria or chloroplast genomes, for example, to increase energy production or metabolism in eukaryotic cells, such as yeast and algae.

[0132] In another embodiment, the nucleic acids are viral and bacteriophage nucleic acids, such as viral and bacteriophage genomes. For example, viral and bacterial nucleic acids and genomes can be modified and engineered by the provided methods to generate viruses with therapeutic uses. As another example, viral genomes can be cloned and manipulated using the methods described herein. Viruses have been used for gene therapy, vaccines, and as Trojan horses in medical applications; however, viral genomes are too large for manipulation in simple plasmids. Similarly, bacteriophages have been used as antibiotics for decades; yet genomes of the T-phage are too large to be worked with easily.

[0133] In another embodiment, the nucleic acid sequences modified, engineered and generated by the provided methods are not genomes. For example, the nucleic acids include chromosomes and other nucleic acid sequences.

[0134] Typically, the nucleic acid sequences and genomes are large nucleic acid sequences. In one aspect, the genome or other nucleic acid sequence is at least at or about 100 kb, 150 kb, 200 kb, 250 kb, 300 kb, 350 kb, 400 kb, 450 kb, 500 kb, 550 kb, 600 kb, 650 kb, 700 kb, 750 kb, 800 kb, 850 kb, 900 kb, 950 kb, 1 megabase (MB), 1.1 MB, 1.2 MB, 1.3 MB,

1.4 MB, 1.5 MB, 1.6 MB, 1.7 MB, 1.8 MB, 1.9 MB, 2 MB, 2.1 MB, 2.2 MB, 2.3 MB, 2.4 MB, 2.5 MB, 2.6 MB, 2.7 MB, 2.8 MB, 2.9 MB, 3 MB, 3.1 MB, 3.2 MB, 3.3 MB, 3.4 MB,

3.5 MB, 3.6 MB, 3.7 MB, 3.8 MB, 3.9 MB, 4 MB, 4.5 MB, 5 MB, 6 MB, 7 MB, 8 MB, 9 - MB, 10 MB, 15 MB or 20 MB in length, or any specific number or range therein. The provided methods are also useful in manipulating and cloning smaller nucleic acid sequences such as, for example, those smaller than about 100 kb. ii. Propagation, isolation, and synthesis of donor genomes and other nucleic acids

[0135] Prior to transfer, the nucleic acid sequences can be propagated in and/or isolated from cells or tissues. The donor nucleic acid sequences can be isolated from donor cells or tissues (e.g.. cells and tissues from a donor organism) or can be transformed into and propagated within other cells, using well-known cloning, cell, and plasmid techniques and systems. The nucleic acid sequences in the cells can be natural or synthetic, including partially synthetic. In some cases, the nucleic acid sequences are amplified, such as by PCR, after isolation from cells or tissues.

[0136] Donor nucleic acids can also be chemically synthesized in vitro using chemical synthesis and assembly methods and, thus, are not isolated from any particular tissue or cell prior to use in the described methods. Methods for chemical synthesis of DNA and RNA and assembly of nucleic acids are known, and include oligonucleotide synthesis, assembly, and polymerase chain reaction (PCR) and other amplification methods (such as, for example, rolling circle amplification, whole genome amplification), such as those described herein and in U.S. Application No. 12/247,126, to Gibson et al, filed October 7, 2008. Synthesis of DNA, for example, can be from DNA (e.g., by PCR) or from RNA, e.g., by reverse transcription. Among the nucleic acids are synthetic genomes. Synthetic genomes can be produced, for example, as described herein and in U.S. Application No. 12/247,126, by Gibson et al, filed October 7, 2008). iii. Nucleic acid sequences, vector-host systems, and culture conditions

[0137] The nucleic acid sequences can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed generated recombinantly. Recombinant polypeptides generated from these nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including bacterial, mammalian, fungal, yeast, insect or plant cell expression systems.

[0138] Alternatively, the nucleic acid sequences can be synthesized in vitro, such as by well-known chemical synthesis techniques, and/or obtained from commercial sources, and optionally assembled, such as for large nucleic acids and genomes, for example, as described in U.S. Application No. 12/247,126, to Gibson et al, filed October 7, 2008.

[0139] Techniques for the manipulation of nucleic acid sequences, such as, e.g. , subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature.

[0140] Another useful means of obtaining and manipulating nucleic acid sequences used to practice the provided methods is to clone from genomic samples, and, if desired, screen and re-clone inserts isolated or amplified from, e.g., genomic clones or cDNA clones.

Sources of nucleic acid sequences used in the described systems and methods include genomic or cDNA libraries contained in, e.g., mammalian artificial chromosomes (MACs), see, e.g., U.S. Patent Nos. 5,721,118; 6,025,155; human artificial chromosomes, see, e.g., Rosenfeld (1997) Nat. Genet. 15:333-335; yeast artificial chromosomes (YAC); bacterial artificial chromosomes (BAC); PI artificial chromosomes (see, e.g., Woon (1998) Genomics 50:306-316); Pl-derived vectors (PACs; see, e.g., Kern (1997) Biotechniques 23:120-124); cosmids, recombinant viruses, phages or plasmids.

[0141] Methods for isolation of nucleic acid sequences, such as genomic DNA, are well- known. As will be apparent to the skilled artisan, the method of isolation depends upon the type and size of sequence(s) being isolated, the type of organism, and the type of tissue or cell from which the sequence(s) is being isolated. Methods for isolation of genetic material from a variety of organisms are well known and can be used in the present embodiments to isolate donor nucleic acid sequences (genomes). For example, conventional methods for DNA isolation are well known and can be used with the provided methods, depending upon the size, and can be performed with a number of commercially available kits for isolation of nucleic acid sequences; for example, commercially available kits can be used for isolation of genomic DNA from cells.

[0142] Natural and synthetic nucleic acid sequences can be reproduced, e.g., copied, by amplification. Amplification can also be used to clone or modify the provided nucleic acid sequences. Thus, provided are amplification primer sequence pairs for amplifying the provided nucleic acid sequences. One of skill in the art can design amplification primer sequence pairs for any part of or the full length of these sequences. Amplification can also quantify the amount of nucleic acid sequence in a sample, such as the amount of donor genome in a host cell.

[0143] One can select and design suitable amplification primers. Amplification methods are also well known in the art, and include, e.g., polymerase chain reaction, PCR, ligase chain reaction (LCR), transcription amplification (see, e.g., Kwoh (1989) Proc. Natl. Acad. Sci. USA 86:1173); and, self-sustained sequence replication (see, e.g., Guatelli (1990) Proc. Natl. Acad. Sci. USA 87:1874); Q Beta replicase amplification (see, e.g., Smith (1997) J. Clin. Microbiol. 35:1477-1491), automated Q-beta replicase amplification assay (see, e.g., Burg (1996) Mol. Cell. Probes 10:257-271) and other RNA polymerase mediated techniques (e.g., NASBA, Cangene, Mississauga, Ontario); see also Berger (1987) Methods Enzymol.

152:307-316; Sambrook; Ausubel; U.S. Patent Nos. 4,683,195 and 4,683,202; and

Sooknanan (1995) Biotechnology 13:563-564. [0144] In one embodiment, nucleic acid sequences are cloned and propagated in bacterial cells, such as Escherichia coli, for example, E. coli DH10B [F'-mcrA A(mrr-hsdRMS- mcrBC) <|>80d/acZAM15 AlacXIA deoR recAX endAl araDl39 A(ara, le )1691 gaKJ galKX rpsL nupG] (Invitrogen) using plasmids. Methods and plasmids for cloning and propagation of nucleic acids in E. coli and other laboratory strains are well known and can be used in connection with the provided methods. In one example, E. coli cells are grown in medium, e.g., Luria-Bertani (LB) broth medium or in LB agar, at 37°C.

[0145] Nucleic acid sequences can be propagated, for example in Mycoplasma cells. The Mycoplasma cells can be either the donor Mycoplasma cells that naturally contain donor nucleic acids or Mycoplasma cells into which donor nucleic acids, e.g., synthetic genomes, have been transformed. Exemplary Mycoplasma species include, for example, Mycoplasma capricolum subsp. capricolum (strain California Kid™) (ATCC 27343) and Mycoplasma mycoides subsp. mycoides (strain GM12) (Damassa et al, 1983), Mycoplasma capricolum subsp. capricolum (M. capricolum), such as wt M. capricolum and a M. capricolum mutant ( . capricolum-ARE), obtained by inactivation of the CCATC-restriction enzyme gene in wt M. Capricolum as described below in the Examples. Methods for growth of these and other Mycoplasma cells and other cells are known. In one example, Mycoplasma donors are grown at 37°C in liquid or solid SP4 medium (Tully et al. 1977), containing 17% of fetal bovine serum (Invitrogen).

[0146] Cell culture and plasmid systems can be engineered in order to facilitate selection of cells containing the desired nucleic acid cloned and propagated using known methods. In one example, growth of bacterial cells such as E. coli is carried out in medium supplemented with antibiotic or other selection agent, e.g., 50 μg/ml of ampicillin, 5 μg/ml of tetracycline or 125 μg/ml of puromycin, depending on resistance genes located within nucleic acids, e.g., plasmids used for cloning and propagation. Similarly, Mycoplasma cells that have been transformed with plasmid, donor genomes, or other nucleic acids can be grown in medium, e.g., SP4 medium, supplemented with 5 μg/ml of tetracycline or 8 μg/ml of puromycin.

[0147] Expression of desired gene products within cells can be detected using well-known methods. For example, β-galactosidase activity can be detected by plating Mycoplasma or other cell types on solid medium containing 150μg/ml of 5-bromo-4-chloro-3-indolyl-P-D- galactopyranoside (X-gal, Promega). One would understand that other conditions and methods can for expression of gene products are contemplated herein using conventional techniques. a. Isolation of nucleic acid sequences in agarose plugs

[0148] Nucleic acid sequences can be isolated in agarose plugs to minimize damage. Large nucleic acid sequences, such as DNA ranging from a few kilobase pairs to 10 MB and larger (e.g., genomes), can be sheared by mechanical force (e.g., pipetting) during

conventional isolation procedures, resulting in damage. Isolation of such nucleic acid seqeunces in agarose can minimize damage. In this embodiment, cells containing the donor DNA are embedded in agarose and lysed. Methods for isolating genomic nucleic acid seqeunces in agarose, e.g., low-melting point agarose, are also well known, and can be performed using commercially available kits, such as the CHEF Mammalian Genomic DNA Plug Kit (cat. No. 170-3591), the CHEF Bacterial Genomic DNA Plug Kit (cat. No. 170- 3592), and the CHEF Yeast Genomic DNA Plug Kit (cat. No. 170-3593), all from Bio-Rad Laboratories, Hercules, CA. Preparation of DNA using such kits can be carried out using conditions and protocols recommended by the supplier.

[0149] Donor nucleic acid sequences (e.g., bacterial, Mycoplasma, yeast, or algal genomes) can also be isolated in agarose plugs using low melting point agarose and the Bio- Rad CHEF Mammalian Genomic DNA Plug Kit, following the protocol suggested by the manufacturer. In one example, cells are suspended in medium without serum or PBS and a number of cells (e.g., 5 x 107 or 5 x 108 per mL agarose to be made) are centrifuged and resuspended in one-half the final volume of agarose to be made. Meanwhile, low-melting point agarose (e.g., Bio-Rad 2 % CleanCut™ agarose) is prepared in sterile water and melted and equilibrated to 50 °C. The cell suspension is equilibrated to the same temperature and mixed gently with the agarose. The mixture is transferred to a plug mold and allowed to solidify. In one example, for lysis, a mixture containing proteinase K is added (e.g., in 5 ML Proteinase K Reaction Buffer, containing 100 mM EDTA, pH 8, 0.2 % sodium deoxycholate, 1 % sodium lauryl sarcosine, and 1 mg/mL proteinase K, per mL plug) and incubated at 50°C overnight. In another example, for lysis, cells in agarose are incubated for a period between overnight and two days at 50°C in 0.4 M EDTA, 0.4 % N-lauroyl sarcosine, 2 mg/mL proteinase K, followed by a buffer change and a second treatment under the same conditions for the same time. [0150] Following lysis, agarose plugs containing donor nucleic acids can be dialyzed against 10 mM Tris pH 8.0 (optionally containing EDTA at 1 mM or 50 mM), e.g., for 1 hour. In one example, this dialysis is followed by dialysis for two times, two hours each, in 10 mM Tris, 50 mM ETDA, 0.1 mM PMSF, and re-dialysisin 10 mM Tris, 50 mM EDTA for storage. In another example, samples are then dialyzed against 10 mM (6%) PEG6000 (United States Biochemical), 0.6 M NaCl for several hours, as described by Katsura et ah, Electrophoresis 21, 171 (Jan, 2000) prior to transfer. In one example, plugs further are melted at 65°C for 5 min, followed by addition of two volumes of 65°C TE and gentle stirring, followed by incubation at 65 °C for 5 minutes.

[0151] In some aspects, the plugs are melted and digested prior to transformation into host cells using, for example, β-agarase. In one example, plugs are electrophoresed twice by CHEF (Bio-Rad) {e.g., first on a 1 % pulse-field agarose gel, with 0.5 x TBE and 50-90 second switch time over 20 hours, and second on a 1 % low melting point gel, with 1 x TAE and 60-120 second switch time, over 24 hours), to remove broken DNA but leave genomes intact, followed by dialysis against sterile 1 x TAE and melting at 73°C, equilibration to 42°C, and digestion with β-agarase (New England Biolabs), for example for 1.5 hours. b. Isolation of organelle genomes

[0152] Donor nucleic acid sequences can be an organelle genome, for example, an organelle genome isolated from a donor cell. Methods for isolating organelle genomes are known in the art. Kits for isolating organelles from cells are available from a variety of manufacturers, including Pierce (Rockford, 111.), Sigma-Aldrich (St. Louis, Mo.) and others.

[0153] Organelle genomes and other nucleic acid can be isolated from various cell types, such as eukaryotic and prokaryotic cells, including yeast cells, plant cells, algae, and mammalian cells. It is understood, as is known in the art, that the isolation procedure may vary depending upon the organism of the cell from which the organelle nucleic acid is isolated and the type of organelle isolated. The organelle nucleic acid isolation procedure can include separation of organelle DNA from nuclear DNA in a total genomic DNA sample, for example, based on molecular weight by fractionation or gel separation. In certain

embodiments, organelles can be purified from total cellular fractions prior to extracting DNA. [0154] Methods are known for isolation of chloroplasts (and other plastid) genomes from plants. Isolation is typically carried out by (1) separating plastids from other organelles, (2) lysing chloroplasts, and (3) purifying nucleic acid. In one example, sucrose or Percoll step gradients are used to obtain chloroplasts from cell lysates, which then are lysed and used to recover DNA. In a particular example, plants are placed in the dark to reduce chloroplast starch levels, green leaves washed in tap water, and placed (10-100 g) into isolation buffer for homogenization in a prechilled blender, followed by filtration through cheesecloth and centrifugation. Pellets are loaded onto a one-step gradient with 18 mL 52 % sucrose, overlayed with 7 mL 30 % sucrose, and optionally more sucrose gradients to enhance yield, such as at least six sucrose gradients with 200 g starting material. The step gradients are centrifuged, e.g., at 25,000 rpm for 30-60 minutes at 4°C, and the chloroplast band removed from the 30-52% interface using a wide-bore pipette. Chloroplasts then are lysed as described and centrifuged to remove debris. DNA then is purified, e.g., as described using a CsCl gradient. DNAsel treatment can be used to modify the sucrose gradient method and to destroy nuclear DNA. Alternatively, a high salt (e.g., NaCl 1.25 M) method can be used for isolation without step-gradient centrifugation as is known in the art. Chloroplasts can be sorted from mitochondria and nuclei using fluorescence activated cell sorter (FACS) separation.

[0155] Methods for isolation of mitochondrial DNA (mtDNA), including highly purified mtDNA, are known and can be used in conjunction with the provided methods to isolate a mitochondrial genome. Highly purified mtDNA can be prepared from vertebrate or invertebrate tissues using sucrose pad gradients and cesium chloride gradients. Generally, tissue (e.g., brain, testes, ovary, liver, kidney, heart, skeletal muscle of vertebrates and invertebrate embryos) is prepared from the organism, if necessary, by homogenizing the tissue, followed by repeated centrifugation at low speed to remove cellular debris and nuclei, followed by centrifugation at high speeds and lysis of the pellet. A sucrose step gradient can be performed on the pellet by ultracentrifugation at 25,000 rpm for 1 hour at 4°C, in which the gradient contains a pad of 10 mL of 1.5 M sucrose in TE buffer and a 10 mL layer of 1 M sucrose. For this process, the pellet is resuspended in TE buffer and layered on the gradient, followed by centrifugation for 1-2 hours at 27,000 rpm at 4°C. Highly purified mitochondria, which appear as a milky white band at the interface of the 1 and 1.5 M sucrose pads, is collected with a Pasteur pipette and placed in a tube for further concentration by high-speed centrifugation (e.g., 13,000 rpm at 4°C).

[0156] The pelleted mitochondria are then lysed, for example, by resuspending in TE buffer and adding sodium dodecyl sulfate (SDS) (e.g., 0.3 mL 10 % SDS per mL TE). After the solution appears clear, saturated CsCl is added and the mixture incubated on ice for 20 minutes, followed by centrifugation at 12,000 rpm for 10 minutes, saving the supernatant. DNA is purified with a CsCl-propidium iodide (PI) (or ethidium bromide) gradient (e.g., 8 g CsCl and 0.6 mL 2 mg/ml PI per 8 mL supernatant, mixing and adjusting density to 1.56 g/mL). After centrifugation at 36,000 rpm, the upper band contains nuclear DNA and the lower band contains mtDNA, which can be collected and, optionally, followed by further CsCl gradients. Kits are commercially available for isolation of mtDNA. In one example, mitochondrial DNA is prepared from mammalian tissue, such as muscle or liver tissue, using the mtDNA Extractor CT Kit (Wako, Osaka Japan, Catalog No.: 291-55301). Protocols for isolation of fungal (e.g., yeast) mitochondrial DNA, which cannot typically be released efficiently into cell homogenates as supercoiled circular DNAs, are also known. In one example, CsCl density gradient centrifugation on crude DNA preparations is carried out in the presence of a dye that binds preferentially to AT rich DNA (e.g., DAPI or 6zs-benzimide). In another example, mtDNA is extracted from isolated mitochondria, which are isolated by pelleting nuclei and cellular debris by centrifugation of lysates at 2000g for 20 minutes, followed by separation of supernatants on sucrose gradients (e.g., 2 mL 60 % sucrose, overlayed with 4 mL 50 % sucrose, overlayed with 4 mL 44 % sucrose, followed by centrifugation at 120,000g for 90 minutes in a swing-out rotor and collection of the mitochondria from the 44/55% interface).

D. Introducing donor genomes and nucleic acid sequences into host cells

[0157] Among the provided embodiments are methods and nucleic acids for introducing the donor nucleic acids, including the donor genomes, into host cells, for example, for modification within the host cells using host cell machinery. The host cell is a heterologous host cell that provides desired capabilities typically not present in the cell from which the donor genome is derived, e.g., recombination machinery. As described above, the donor nucleic acid can be isolated from a cell or tissue prior to transfer, chemically synthesized and/or assembled in vitro, and/or copied from such an isolated or synthesized nucleic acid by in vitro or in vivo methods.

[0158] Typically, transfer of the donor nucleic acid (e.g., donor genome) into the host cell is carried out by first joining the donor nucleic acid (which may be circular, linearized, or fragmented) to a host nucleic acid which, typically, is a host vector, in order to generate a nucleic acid containing the donor nucleic acid and the host vector, which can be propagated and modified within the host cell. Joining of the donor nucleic acid to the host vector can be carried out in vitro or in vivo in the donor cell or in the host cell. In one example, the host vector is transformed into the donor cell, where it is recombined with the donor genome, followed by isolation of the genome with the vector insertion (see, e.g., Figure 2A). In another example, the donor genome and a host vector are separately cotransformed into the host cell and the donor and host nucleic acids recombine within the host cell. The donor genome may be linearized (see, e.g., Figure 2B), or fragmented (see, e.g., Figure 2C) prior to cotransformation with the vector into the host cell. i. Host cells

[0159] The host cells can be any host cells, and typically are heterologous cells having genetic systems that are desirable for modification of nucleic acids in the laboratory, for example, improved genetic systems compared to the donor organisms or cells. Exemplary aspects of desirable genetic systems are the ability to support homologous recombination, including double crossover homologous recombination, and transposon mutagenesis, a defined and well -characterized set of selection and other markers, and the capacity for cloning large nucleic acids. It is also desirable that the host cell has properties that make it compatible with the donor nucleic acid during cloning, propagation, and modification of the nucleic acid within the host cell.

[0160] For example, particular host cells can be selected to minimize gene toxicity.

Host/donor combinations can be selected such that gene expression from donor nucleic acids does not occur in the host cell or is reduced in the host cell compared to in the donor cell. In one such aspect, the host and donor contain different translation and/or transcription signals and/or machinery, such as yeast and bacterial organisms. In another aspect, one or more codon is translated as an amino acid by the donor but is treated as a stop codon by the cell machinery. In one example, the donor translates the codon (e.g., UAG) as an amino acid (e.g., tryptophan) while the host cell reads the same codon as a stop codon (e.g., Mycoplasma versus eukaryotic organisms). In these aspects, donor genomes and other nucleic acids can be maintained, replicated, and modified within host cells having desirable genetic systems without (or with minimal) expression of gene products encoded by the donor genome.

[0161] The host cell can include any cell compatible with the cloned donor genome or nucleic acid. Thus, for example, genomes from algae may be cloned into yeast and manipulated to provide more favorable characteristics when re-introduced into the same or different algal recipient cell. To the extent the systems are compatible, these algal genes can also be manipulated and provided to plant cell cultures. Similar manipulations are feasible for vertebrate and invertebrate cells.

[0162] In one preferred embodiment, the host cell is a yeast cell. Yeast hosts include the "workhorse species," Saccharomyces cerevisiae, and other yeast species such as

Saccharomyces pombe, which can be used to clone even larger genomes. Yeast hosts are particularly suitable for manipulation of donor genomic material because of their unique set of genetic manipulation tools. The natural capacities of yeast cells, and decades of research have created a rich set of tools for manipulating DNA in yeast. These advantages are well known in the art. For example, yeast, with their rich genetic systems, can assemble and reassemble nucleotide sequences by homologous recombination, a capability not shared by many readily available organisms. Yeast cells can be used to clone larger pieces of DNA, for example, entire cellular, organelle, and viral genomes that are not able to be cloned in other organisms. Thus, one embodiment of the described methods utilizes the enormous capacity of yeast genetics to advance synthetic biology and synthetic genomics by using yeast as host cells for manipulation of genomes of intractable and other organisms and synthetic genomes.

[0163] Exemplary of the yeast host cells are yeast strain VL6-48N, developed for high transformation efficiency parent strain: VL6-48 (ATCC Number MYA-3666TM)), the W303a strain, and recombination-deficient yeast strains, such as the RAD54 gene-deficient strain, VL6-48-A54G (MATa his3-A200 trpl-ΔΙ ura3-52 lys2 ade2- 101 met 14 rad54-Al:: kanMX), which can decrease the occurrence of a variety of recombination events in yeast artificial chromosomes (YACs). [0164] There is a large set of verified, substantiated, and reliable selectable markers for selection and counter-selection of yeast mutants, making it possible to carry out multiple, e.g., infiriite iterative rounds of seamless nucleic acid alterations within yeast host cells. Thus, yeast can be used to introduce a number of different genetic modifications, including single nucleotide changes (e.g., insertions, deletions, mutations), modification of target nucleic acid portions and regions, and construction of entirely new chromosomes. Serial modifications to a cloned copy of an otherwise intractable genome or other large nucleic acid can be performed in yeast in rapid succession. The mating capacity of yeast is favorable for modifying genomes and other large nucleic acids. Yeast recombination machinery, when activated during yeast mating, can be used to generate libraries, e.g., combinatorial libraries containing variants of cloned genomes or nucleic acids.

[0165] For example, Yeast Artificial Chromosome (YAC) libraries have been constructed for several different bacteria (Azevedo et al, PNAS USA 90, 6047 (1993); Heuer et al, Electrophoresis 19, 486 (1998); Kuspa et al, PNAS USA 86, 8917 (1989). Large prokaryotic DNA segments can be cloned in yeast using the universal genetic code. Toxic gene expression typically is not a barrier to cloning donor nucleic acids in yeast. Studies with bacterial and archeal genomes, for example, indicate that because eukaryotes use different protein expression machinery than these bacteria, there is little risk of harm to yeast hosts by proteins expressed from the cloned genomes. The transcription (Kozak, Gene 234, 187 (1999)) and translation (Kornberg, Trends Cell Biol 9, M46 (1999) signals in yeast are different from those in bacteria. In fact, most prokaryotic genes likely are not expressed in yeast. There is no restriction barrier in yeast (Belfort and Roberts, Nucleic Acids Res 25, 3379 (1997). If there is a barrier, it may be a replication barrier, rather than a gene expression barrier (Stinchcomb et al., PNAS USA 77, 4559 (1980)). Gene toxicity is minimized because regulation of gene expression in a eukaryote such as yeast is different from that in

prokaryotes. Also, Mycoplasmas use the codon UGA for tryptophan rather than as a translation stop signal. Thus, most Mycoplasma genes, if expressed, would produce truncated proteins in yeast. This largely avoids the possibility of toxic gene products.

[0166] Donor may be obtained in their native form from donor organisms and modified with yeast vectors prior to transformation into yeast, or may be assembled from natural or synthetic fragments together with yeast vectors prior to transformation into yeast cells or simultaneously co-transformed into yeast cells. New organisms are created by transferring these genomes, which have been optionally manipulated as desired, into compatible recipient cells. Thus, one embodiment provides, for the first time, suitable techniques for transferring genomes to yeast host cells, modifying the genomes within host cells while maintaining their stability and integrity, and transplanting the cloned and manipulated genomes from yeast host cells back into recipient cells that more closely resemble the original donors, thus creating organisms which previously did not exist and/or could not have been created through genetic manipulation of their original cells with available genetic engineering and cloning tools. ii. Host vectors

[0167] Typically, donor nucleic acids are transformed into and propagated within host cells using host vectors. Thus, the host cell generally contains, or will support introduction of, a host vector for transfer, maintenance, and modification, of the donor nucleic acid within the host cell. In one embodiment, the host vector contains nucleic acid sequences to facilitate transfer of the donor nucleic acid to and from a donor cell, a host cell, and a recipient cell, and other cells, such as bacterial cells used for cloning and propagation (e.g., E. coli), such as the tri-shuttle vectors described in the examples herein (see, e.g., Figure 3).

[0168] In one aspect, the vector contains any nucleic acids (e.g., origin of replication) needed to promote replication of the vector within one or more desired cell type and selection and/or resistance markers for use with the different cell type(s).

[0169] Resistance markers are well known. The skilled artisan will be able to determine appropriate resistance markers for different host/donor combinations. In some cases, it can be desirable to use markers that are not clinically relevant. In other cases, the choice of resistance marker depends on properties of the donor, host, and/or recipient cells. For example, antibiotics that target the cell wall may not be useful in Mycoplasma and other organisms lacking cell walls. Among the resistance markers are genes encoding antibiotic resistance, such as ampicillin, kanamycin, and tetracycline resistance, such as the tetracycline resistance protein (TetM), and chloramphenicol acyltransferase (CAT), aminoglycoside resistance protein (aacA/aphD), and combinations thereof. For example, tet-resistance markers are useful in bacteria, such as Mycoplasma, in which tetracyclines have a potent effect and which exhibit low levels of spontaneous resistance. Genes conferring Puromycin resistance also can be used, for example, for cloning and modifying Mycoplasma nucleic acids and using Mycoplasma cells.

[0170] Puromycin is an antibiotic that mimics the 3 '-terminal end of aminoacylated tRNA and attaches to the carboxyl-terminus of growing protein chains to stop protein synthesis. Because puromycin conscripts rRNA recognition elements used by all of the various tRNAs in a cell, it is unlikely that spontaneous antibiotic resistance can be acquired via a simple point mutation, which can happen with other markers in some cases. Puromycin is readily available, relatively inexpensive, is not used in the clinic and it is a potent inhibitor of translation in both prokaryotes and eukaryotes. No known rRNA based resistance exists.

[0171] A codon-optimized cassette has been developed to confer puromycin resistance in five different Mycoplasma species and can function in E. coli, making it functional in shuttle vectors. To make this cassette, the 597 bp puromycin N-acetlytransferase 85 gene (PAC) is synthesized using overlapping oligonucleotides as described by Smith et al. , PNAS USA

100: 15440-5 (2003). Briefly, 5' phosphorylated oligonucleotides encoding both strands of a codon optimized version (for expression in M. genitalium) are ordered from IDT (Coralville, IA). The oligos are 48 bases 88 long with an overlap of 24 bases. The top-strand and bottom- strand oligos are mixed, heated to 95°C, and slow cooled to allow annealing of the overlaps. The reactions are ligated for 12 hours and used as a template for PCR. The PCR amplicon is cloned into pGEM-3Zf(+) (Promega, Madison, Wisconsin) and sequenced to identify correct PAC clones. The optimized PAC gene is then cloned under the control of the Spiroplasma citri spiralin promoter (Ps) and used to replace the tetM gene in a derivative of Mini- Tn4001tet, as well as the tet gene in pMycol (Lartigue et al. (2003), Nucleic Acids Res 31 : 6610-8). The new plasmid (Mini-Tn4001PsPuro) can be used to transform M. genitalium, M. gallisepticum and M. pneumoniae, while the pMycol derivative (pMycoPuro) can be used to transform M. mycoides LC and M. capricolum.

[0172] The vectors further include nucleic acids that allow joining of the vectors with the donor nucleic acids. In one example, the host vector contains regions of homology to portions of the donor genome or nucleic acid, such as regions of homology at the 3' and 5' termini of a linear vector that are homologous to adjacent regions within the donor nucleic acid, to facilitate joining by homologous recombination. In another example, the host vector contains nucleic acid encoding a transposase and/or inverted repeats, to facilitate joining, e.g., insertion, into the donor nucleic acid, such as within a donor cell. The host vectors can additionally contain restriction enzyme recognition sites and nucleic acids to support replication and segregation within host cells and other cells.

[0173] In one aspect, a yeast host vector contains an origin of replication (e.g., high copy origin from pUC19); one or more resistance markers and/or selection markers (e.g., antibiotic resistance genes and selectable host cell (e.g., yeast) markers), such as markers for selection in the host cell, in donor cells and in recipient cells. Exemplary of resistance/selection markers are antibiotic resistance genes (e.g., ampicillin-resistance genes, kanamycin resistance genes and other well-known antibiotic resistance genes), and other antibiotic resistance genes; selectable yeast or other host cell markers, e.g., HIS3) and/or selection markers; nucleic acids to facilitate insertion into donor nucleic acid, e.g., transposase and inverted repeats, such as for transposition into a Mycoplasma genome; nucleic acids to support replication and segregation in the host cell, such as an autonomously replicated sequence (ARS), centromere sequence (CEN). In one embodiment, the vector contains a telomere sequence.

[0174] Exemplary vectors include yeast vectors, including yeast centromeric plasmids, e.g., Yeast Artificial Chromosome (YAC) vectors, such as pmycYACTn, described in Example lA(i)(a), below, and illustrated in Figure 3A; and the miniTn-Puro- JC VI- 1.7 vector constructed shown in Figure 3B. Features of the pmycYACTn vector include: (i) a high copy origin from pUC19 and an ampicillin resistance marker for propagation in E. coli, (ii) the IS256 (iii) tetM and lacZ markers, both expressed from spiralin promoters (16, 17), for selection and screening in E. coli and Mycoplasmas, and (iv) an ARS and a CEN for replication and segregation in yeast, and HIS3 as a selectable yeast marker. The miniTn-Puro- JCVI-1.7 vector differs from pmycYACTn as follows: (i) it does not contain lacZ and substitutes a puromycin resistance marker for tetM and (ii) it contains a bacterial artificial chromosome (BAC) vector, for possible cloning in E. coli. iii. Cloning strategies: joining of host and donor nucleic acids and transfer of donor genomes and nucleic acids into host cells

[0175] In the provided transfer methods, the donor genome or other nucleic acid is joined to a host nucleic acid, typically a host vector, to generate a nucleic acid containing the donor nucleic acid and host nucleic acid that can be propagated and manipulated in the host cell. Joining the host and donor nucleic acids can be carried out using a number of approaches, drawing on well-known cloning methods. Three general approaches are described in more detail below.

[0176] As noted above, yeast cells are exemplary host cells. Large DNA molecules have been stably cloned in yeast by the addition of a yeast centromere (CEN), which allows the molecules to be segregated along with the yeast chromosomes. Such molecules have been cloned both in the linear form by the addition of telomeres to the ends, and also as circles. Because bacterial genomes are generally circular, and circles can be readily separated from linear yeast chromosomes, it can be advantageous to clone bacterial genomes as circular.

[0177] In a first approach for joining donor genomes and nucleic acids with host vectors, the donor genome is joined to the host vector within a donor cell, or other cell type that is similar to the donor, followed by isolation of the nucleic acid containing the donor genome and host vector and subsequent transfer into the host cell. An example is illustrated in Figure 1. This approach can be used, for example, to transfer genomes and other large nucleic acids into host cells. In one example, the host vector contains inverted repeats and/or nucleic acids encoding a transposase, to facilitate insertion into the donor genome or other nucleic acid within the cell.

[0178] Joining the donor and host nucleic acids within a donor cell or a cell that is similar to the donor (e.g., a different species of the same genus) provides advantages. For example, it allows selection of vector insertions (e.g., sites of vector insertion along the length of the donor nucleic acid) that do not or are unlikely to impair or otherwise affect donor cell viability. This approach does, however, require that the donor or similar cell is amenable to introduction of foreign nucleic acid (e.g., transformation), so that the vector can be integrated into the donor nucleic acid, e.g., genome. Various approaches for introduction of nucleic acids into a variety of cell types are well known. In one example, as described in Example 1A, below, yeast host vectors are transformed into bacterial cells in the presence of PEG. Donor cells containing the host vector integrated into the donor nucleic acid are selected, for example, based on a resistance or other selective marker in the host vector. Nucleic acids can be isolated from the donor cells, such as in agarose plugs as described above, for

confirmation of host vector insertion, for example by PCR or Southern blot as described herein. In one aspect, before transfer into the host cell, the nucleic acid containing the donor genome and host vector is transplanted into a recipient cell to confirm that the nucleic acid can be transplanted and is compatible with a particular recipient cell. For example, transplantation of genomic DNA from one bacterial species to another can be carried out as described in Lartigue et al, Science 317, 632 (2007) and as described in Example 1 A(ii)(b), below.

[0179] In the example illustrated in Figure 2A, a linear yeast host vector is joined to a circular bacterial genome within the bacterial cell. The resulting circular nucleic acid is isolated, for example, in agarose plugs as described above, and transformed into yeast host cells. An example of this process is described in Example 1 A, below.

[0180] In a second approach, an example of which is illustrated in Figure 2B, the donor genome and the host vector are co-transformed, together or separately, into the host cell, whereupon they join, e.g., by homologous recombination, within the host cell. This approach is advantageous in its simplicity, with minimal sample handling and number of steps.

Typically, as shown in Figure 2B, the vector is inserted into the donor genome or nucleic acid by homologous recombination.

[0181] In the example illustrated in Figure 2B, a linear yeast host vector is co-transformed into a yeast host cell along with a circular bacterial genome, for example, a synthetic genome or one that has been isolated from a donor cell, e.g., in agarose plugs as described above. Typically, the host vector contains region(s) of homology to the donor genome or nucleic acid. In the example shown in Figure 2B, the linear yeast vector contains, at each terminus, a region of homology to a portion of the bacterial genome. In one example, as shown in Figure 2B, the bacterial genome is cut with a restriction enzyme that cuts near the region of homology to the host vector, prior to transformation into the host cell. This process generates a double-strand break near the insertion site of the vector, greatly improving efficiency of the joining of the host vector and donor genome (by insertion of the vector into the genome) within the host cell. Typically, a restriction enzyme recognition site is chosen within the donor genome or other nucleic acid that is compatible with maintaining genome or nucleic acid integrity after insertion of the vector at that site. An example of this process is described in Example IB, below. [0182] An example of a third approach, which a modification of the second approach, is illustrated in Figure 2C. This approach is carried out by co-transforming into the host cell, along with the host vector, a plurality of overlapping nucleic acid fragments, which are fragments of the donor genome or nucleic acid. In other words, each of the fragments contains homology to a region of the donor genome or nucleic acid and the regions of homology overlap along the length of the donor genome or nucleic acid. The fragments and vector recombine upon transformation into the host cell, for example by homologous recombination through regions of homology.

[0183] In the example illustrated in Figure 2C, overlapping fragments of a circular bacterial donor genome are co-transformed into a yeast host cell along with a linear yeast vector. Again, the yeast vector contains regions of homology at its termini to portions of the bacterial genome. Upon introduction of the donor genome fragments and yeast host vector into the host cell, the fragments and vector recombine, thereby joining the donor genome and host vector. An example is described in Example 1C, below.

[0184] In some embodiments, either after (e.g., first approach) or before (e.g., second and third approaches) joining with the host vector, the donor nucleic acids are isolated from the donor cells or similar cells, as described above. For example, large donor nucleic acids including genomes can be isolated from donor and other cells in agarose plugs, as described above. After isolation or synthesis and assembly, donor nucleic acids are transformed into host cells. When the host vector is not previously joined to the donor nucleic acid, it can be transformed into the host cell simultaneously or sequentially in any order, using the same transformation methods.

[0185] Transformation methods are well known in the art and will vary depending upon the host cell. In one example, when the host cell is a yeast host cell, yeast spheroplasts are prepared from the yeast host cells, for example, as described below, and the nucleic acids are transformed by mixing with the spheroplasts. In some cases, the transformation is performed in the presence of PEG. For example, donor nucleic acids and/or host vectors can be incubated with the spheroplasts for 10 minutes at room temperature, followed by addition of 800 PEG 8000 and gentle mixing by inversion and another 10 minute incubation at room temperature. [0186] In one example, spheroplast preparation and transformation is carried out as described by Kouprina and Larionov, Nat Protoc 3, 371 (2008). The OD to which cells are grown can be modified. With these methods, prior to transformation, yeast medium is inoculated with single-cell colonies of yeast hosts, and grown overnight at 30 °C with vigorous shaking to ensure good aeration until an appropriate OD660 is reached. Samples can be centrifuged and resuspended in sorbitol by vortexing, centrifuged and resuspended, e.g., in SPE solution (1 M sorbitol, 0.01 M sodium phosphate, 0.01 M Na2EDTA, pH 7.5). Yeast cell walls are removed, for example using Zymolase™. The level of spheroplasting can be evaluated by comparison of optical densities of the cell suspension in sorbitol solution versus 2 % SDS solution (in which spheroplasts are lysed). Spheroplasts can be centrifuged and resuspended in 1 M sorbitol by very gentle rocking, and washed and resuspended in STC solution (1 M sorbitol, 0.01 M Tris-HCl, 0.01 M CaCl2, pH 7.5). Transformation is carried out by mixing the nucleic acids with the spheroplasts, as described above, optionally in the presence of PEG.

[0187] After transformation, a selection procedure typically is performed to select cells into which donor nucleic acids and host vectors have been successfully transformed. For example, in the above process, after transformation, the spheroplasts can be centrifuged and resuspended in SOS solution and incubated for 40 minutes at 30°C without shaking. The spheroplasts can be placed in selection medium, such as melted SORB-TOP-His selection medium as described herein, and equilibrated at 50°C, and plated on plates containing selection medium and grown, e.g., at 30 °C until transformants are visible. iv. Isolation and analysis of donor nucleic acids from host cells

[0188] With the provided methods, donor nucleic acids transformed into host cells can be isolated and analyzed, both before and after modification within the host cells by the provided modification methods. As with isolation from donor and other cells, isolation methods will vary depending on the cell type. In some examples, native host nucleic acids are removed or reduced from isolated nucleic acid samples, e.g., to isolate or enrich for donor nucleic acids. This process can be carried out by pre-electrophoresis to remove chromosomal host DNA, or by digestion with restriction enzymes that digest host, but not donor, nucleic acids. [0189] In one example, the donor nucleic acids are isolated in agarose plugs, for example, using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF- DR III manual, and as described in the Examples herein. In some examples, agarose plugs containing DNA from the host cells are pre-electrophoresed at constant voltage for several hours to remove yeast host chromosomal DNA. In one aspect, the removal of host DNA can be carried out by first digesting DNA in the plugs with AsiSl, Fsel, and Rsrll, or other enzymes that cleave yeast chromosomes but do not have recognition sites in donor nucleic acids, such as M. genitalium or M. mycoides LC.

[0190] Analysis of donor nucleic acids can be carried out by any of a number of well- known methods for analyzing DNA. Typically, it is desired to carry out methods to confirm the size and/or sequence of the nucleic acids, and the correct insertion and orientation of the vector and other nucleic acids, including the confirmation of any modifications. In one example, isolated DNA is subject to linearization by heating and/or restriction digestion, followed by separation by gel electrophoresis, such as field-inversion (Bio-Rad FIGE

Mapper) or pulsed-field (Bio-Rad CHEF-DR II or III system) electrophoresis.

[0191] Analysis can be, for example, by PCR, such as multiplex PCR, with primers designed to bind various regions along the length of the desired donor nucleic acid or modified donor nucleic acid. Typically, primers also are designed to recognize the host vector. In other examples, the analysis is carried out by visualization of the size of the isolated nucleic acid on a gel, or by restriction digestion and performing a Southern blot or other hybridization method, for example, as described in Gibson et al, Science 319, 1215 (2008). Specific examples of MPCR and Southern blot analysis of isolated donor genomes are described in the Examples. Modifications of the analysis methods will be apparent to the skilled artisan. Sequencing methods are well known and also can be used to analyze the donor nucleic acids transferred into and propagated within host cells. v. Generation of host cells containing a plurality of donor genomes

[0192] In one embodiment, a plurality of donor nucleic acids, such as a plurality of genomes from different donors, are introduced into a single host cell. In one aspect, a host cells containing one donor genome or other donor nucleic acid is crossed to another such host cell containing transferred nucleic acid from a different donor, generating a host cell containing both nucleic acids. For example, a diploid yeast strain containing two donor genomes from different donors, such as two Mycoplasma genomes from different species, can be generated by crossing two different haploid strains, each carrying one of the donor genomes. Crossing haploid yeast strains can be carried out using well-known methods.

Multiple distinct selection markers can be used in the respective haploid strains, to allow for selection of cells containing both genomes after the cross. For example, a HIS3 and TRP marker can be introduced into two different haploid cells, respectively, carrying different donor genomes, followed by selection of diploid cells on medium lacking histidine and tryptophan, as described in the Examples herein.

E. Modification of donor genomes in host cells

[0193] Also among the provided embodiments are methods and nucleic acids for modifying the donor genomes and other nucleic acids within the host cells. In one embodiment, the methods are carried out by introducing one or more targeting construct into the donor nucleic acid. The constructs contain portions of homology to the donor nucleic acid, resistance genes, selectable markers, nucleic acids encoding enzymes, such as restriction enzymes, restriction sites, and/or other nucleic acids used in cloning and homologous recombination. Typically, the constructs are introduced into host cells containing the donor nucleic acids.

[0194] To design the constructs, a target region of the donor nucleic acid {e.g., the donor genome) is selected for modification. It is not necessary that the methods modify each residue of the target region. For example, one or more target portions or target positions within the target regions can be modified. The modifications include insertions, deletions, mutations, substitutions, and/or other modifications of one or more nucleotides within the target region. In one aspect, the donor nucleic acid is seamlessly modified.

[0195] Typically, the target region or a portion thereof first is replaced with a nucleic acid construct containing a marker, such as a counter-selectable marker. The marker is then removed from the nucleic acid, by deleting the marker or replacing it with another nucleotide sequence. In one aspect, the marker and surrounding portions are replaced by introducing a second nucleic acid construct having homology to portion(s) of the target region near or adjacent to the marker. This second construct need not be less than 100 % homologous to the portion(s) of the target region. For example, the constructs can contain one or more mutation, deletion, or insertion, compared to the portion of the target region, whereby the target region is modified upon replacement with the construct. The methods typically include one or more homologous recombination step.

[0196] In one aspect, removal of the marker is facilitated by introducing a break (e.g., double-strand break) in the nucleic acid sequence of the donor nucleic acid containing the construct with the marker. The break is introduced near, e.g., adjacent to, or within the target region. Typically, the break is generated by inducibly expressing an enzyme, such as an endonuclease, that recognizes and cleaves the desired nucleic acid sequence. Typically, the enzyme is encoded by a nucleic acid within the target region or the construct inserted into the target region.

[0197] In one aspect, removal of the marker is facilitated by introducing a nucleic acid sequence into the donor nucleic acid, whereby insertion of the nucleic acid sequence generates tandem repeat regions flank the target region or portion thereof. Typically, the nucleic acid sequence is included as part of the targeting construct.

[0198] In one embodiment, the methods include both introduction of a break and introduction of a sequence generating tandem repeat regions. In one aspect, the method is a Tandem Repeat with Endonuclease Cleavage (TREC) method, in which double-strand breaks, generated by an inducibly expressed enzyme, and tandem repeats are used to facilitate recombination events and avoid damage and unwanted mutation.

[0199] The provided methods provide advantages compared to conventional and other available methods, particularly for modification of donor nucleic acids in hosts of different species, genera, and orders. In one aspect, the donor nucleic acids, which may come from a donor organism having a poor genetic system, are modified within a host having a rich genetic system, such as a yeast host cell, for example, by homologous recombination methods. For example, nucleic acid fragments several hundred kb in length can be cloned and manipulated in yeast (Saccharomyces cerevisiae) host cells using well-known methods and standard genetic tools, including linear and circular forms of yeast artificial chromosomes (YAC). Transplantation of modified donor nucleic acid to recipient cells, including original cells and cells of different species, can be used, for example, for functional studies of genes and gene regulation, and for production of modified gene products. The provided methods can be used to successfully modify donor genomes within host cells, to engineer and modify genomes from organisms that are genetically intractable.

[0200] As discussed below, the modification methods can be used to produce genomes, organisms, and gene products produced by the organisms that are commercially useful, such as for production of vaccines, drugs, biological proteins and chemicals, biofuels, and protein therapeutics such as enzymes and antibodies. In one example, donor genomes are modified to produce new immunological compositions to elicit an immune response, such as live viruses and other immunogens. In another example, donor genomes are modified for the production of biofuels, for example, by introducing DNA encoding for enzymes involved in the oil synthesis pathways, for example, by replacing metabolism pathway genes with those for biofuel production. In one example, the donor genome (e.g., of a photosynthetic bacteria) is modified such that, upon transplant into a recipient cell, the recipient cell produces biofuels in place of normal photosynthesis products, such as glucose. Other uses are discussed hereinbelow. Thus, the provided methods can be used to directly engineer or redesign a synthetic bacterial genome in vivo, for example, in yeast host cells.

[0201] The provided modification methods include aspects for overcoming

incompatibility issues between donor and host organisms of different species, which could otherwise cause instability and unwanted mutation of donor nucleic acids that are

manipulated in host cells of different species. For example, when a donor nucleic acid, such as a donor genome, is introduced into a host cell, the donor nucleic acid does not typically contribute to the viability of the host cell, or does not contribute to the viability of the host apart from individual selection marker(s) present in the cloning vector. This is particularly true when the donor and host are different types of organisms, such as of different orders or kingdoms, for example, when the donor is a prokaryote and the host is a eukaryote, such as a yeast. For example, as discussed in the study described in Example 4, below, the M.

genitalium genome, propagated as a circular YAC (with a histidine marker) in yeast does not have functional complementation with its host, except histidine prototrophy. Any deletion and rearrangement in the bacterial genome is likely neutral for the yeast host.

[0202] With available methods, because the host cell does not depend on the integrity of donor nucleic acids for viability, there is a high risk of unwanted mutations and damage to the donor nucleic acid while it is being manipulated in the host cell. The provided methods overcome these problems and can be used to propagate and modify donor genomes within host cells, while minimizing the risk of unwanted mutations within the donor genome. The provided methods can accurately modify a donor genome, such as a bacterial genome, cloned in yeast host cells, with high efficiency

[0203] The provided methods further can be used in seamless modification of the donor nucleic acids within the host cells, including mutation, deletion, and/or insertion of nucleotides within a target region of the donor nucleic acid, where no unwanted additional nucleic acid sequence is added or removed. i. Counter-selectable markers

[0204] Typically, a first step of the methods includes introduction of counter-selectable markers into the donor nucleic acid. The markers typically are inserted by homologous recombination, whereby a portion of the target region is replaced with the counter-selectable marker. Counter-selectable markers are advantageous in that both the presence and the absence of the marker can be selected for. The presence of the marker is selected for with one set of growth conditions, while the absence is selected for with a different set of growth conditions. An exemplary, well-known counter-selectable marker is the URA3 yeast gene. The presence of the URA3 gene in a yeast host allows its growth on medium lacking uracil. Thus, successful replacement of the donor nucleic acid target region with this marker can be selected for by growth on uracil- medium. By contrast, the absence of the URA3 gene, such as following replacement by another homologous recombination event, can be selected by counter-selection on medium with 5-fluoroorotic acid (5-FOA).

[0205] For example, the genetic marker URA3 can be integrated, e.g. , through

homologous recombination, into a target region within the donor nucleic acid cloned in a host cell. Integration of the marker is selected for by growth on medium lacking uracil. Removal of the marker, e.g., by deletion or replacement with another nucleotide sequence, for example in a second round of homologous recombination, is selected for by counter-selection, e.g., on 5-FOA.

[0206] Methods employing counter-selectable markers are desirable in that they can be used for seamless modification. Further, replacement or removal of the counter-selectable marker restores auxotrophy (e.g., dependence on uracil), such that the host cells can be modified using the same method in further rounds of modification.

[0207] Methods are available for introducing and replacing counter-selectable markers in yeast host cells. For example, methods are known for introduction of a URA3 marker by a first round of homologous recombination and replacement of the marker with a second round of homologous recombination. An example of such a method is described in Example 4A, below, in which a site-specific mutagenesis was performed to correct a single base cytidine deletion (309,388) found in the CDS139 locus of a donor synthetic M. genitalium genome maintained in yeast using this conventional method involving two sequential homologous recombination events. As described in that example, yeast hosts containing the mutant bacterial donor genome were transformed with a cassette containing the URA3 marker and 50 bp terminal portions homologous to portions of the target region, replacing a target region containing the single-base deletion CDS 139 locus. The second round of transformation introduced a construct containing the non-mutant DNA sequence back to the same locus, replacing the marker.

[0208] Conventional methods employing counter-selectable markers are limited in their ability to efficiently modify certain donor nucleic acids in certain host cells. For example, these methods can be insufficient for modifying donor genomes within host cells that do not depend on integrity of the donor genome for viability. When the host cell does not depend on the integrity of the donor genome, a high number of spontaneous deletions can occur during modification. These deletions typically result in loss of the counter-selectable marker and thus are selected. The provided methods overcome this problem and provide increased efficiency compared to conventional methods. ii. Inducible enzyme expression and introduction of breaks

[0209] In one embodiment, after the selectable marker is introduced, a break, such as a double-strand break (DSB), is introduced near (e.g., adjacent to) or within the target region. This process typically is carried out by inducibly expressing an enzyme, such as an endonuclease, e.g., l-Scel, that recognizes and cleaves a nucleotide sequence located in proximity to or within the target region. Typically, the enzyme is an endonuclease or other enzyme that generates double-strand breaks. The introduction of a double-strand breaks near a site of homologous recombination reportedly increases the efficiency of homologous recombination by about twenty-fold (Leem et al, Nucleic Acids Res 31, e29 (2003)). Thus, introduction of a double-strand break near the target region is carried out to increase the efficiency of the modification methods and reduce unwanted background mutations.

[0210] In a typical example, the targeting construct containing the selectable marker further contains a gene encoding the enzyme, under the control of an inducible promoter. Typically, the construct further includes a recognition sequence of the enzyme. This construct is introduced into the donor nucleic acid within the host cell. Expression of the enzyme is induced by growth of the host cells under particular conditions that induce expression from the inducible promoter. In one example, the promoter is the GAL1 promoter, expression from which can be induced by growth on medium containing galactose as the only carbon source.

[0211] Available methods include inducible introduction of double-strand breaks for the purpose of improving efficiency of recombination-based modification in yeast. One such method, Delitto perfetto, is described in Storici et al, Nat Biotechnol, 19, 773-776 (2001). An example of this method is described in Example 4B(i), below. The method is based on the showing that introduction of a double-strand break (DSB) in a target nucleic acid stimulates recombination by several orders of magnitude (Storici et.al, PNAS USA, 100, 14994-99 (2003)). In Example 4B(i), Dilletto perfetto was used in attempt to correct the same single- base deletion in the CDS 139 locus of the M. genitalium donor genome. The process is illustrated in Figure 10A.

[0212] It is demonstrated herein that inducible introduction of DSB, in combination with conventional recombination methods in yeast, is limited for modification of certain donor nucleic acids. See Example 4B(i), below. This limitation is due to a high background of spontaneous loss of the negative (counter-) selection marker. The provided methods improve efficiency and reduce unwanted background mutations {e.g., spontaneous deletions). iii. Tandem repeats

[0213] In one embodiment, removal of the selectable marker by homologous

recombination is facilitated by the presence of tandem repeat regions, flanking a region containing the marker. In one aspect, the targeting construct for introducing the marker further contains a nucleic acid sequence, the introduction of which results in tandem repeat regions flanking the target region or portion thereof containing the inserted marker. The construct initially is inserted, either upstream or downstream of the target region or portion thereof, and contains a nucleic acid portion having homology to a portion downstream or upstream of the target region or portion, respectively. Insertion of this portion near the homologous portion in the target nucleic acid generates the tandem repeats.

[0214] In one example, insertion of the construct generates a portion within the target nucleic acid, 5' of the marker, having homology to a portion 3' of the target region. In another example, insertion of the construct generates a portion within the target nucleic acid, 3' of the marker, having homology to a portion 5' of the target region. Thus, upon introduction, the modified donor nucleic acid (e.g., modified donor genome) contains tandem repeat sequences flanking a nucleic acid containing a selectable marker.

[0215] The presence of tandem repeat sequences facilitates homologous recombination between the two sequences, for example, for removal of a portion of the construct containing the counter-selectable markers. Such methods are well known and based on a precise excision of a nucleic acid segment by homologous recombination (HR) between two tandem repeat sequences. An example, known as the "Tandem repeat pop-out" method is described in Akada, R. et al, Yeast, 23, 399-405 (2006). An example of such an approach is described in Example 4B(ii), below, used to delete a region of the CDS139 locus in the M. genitalium donor genome. The process is illustrated in Figure 10B. This technique can be adapted for use in gene replacement.

[0216] Unlike more conventional homologous recombination methods using selectable markers, methods using tandem-repeat induced HR can introduce and subsequently remove a cassette containing a counter-selectable marker via a single transformation event. For example, a cassette carrying the counter-selectable marker and the sequence that generates the tandem repeat can be introduced into a donor genome in a yeast host by transformation, followed by selection for spontaneous homologous recombination between homologous regions in the cassette and the genome.

[0217] Selection for the initial introduction of the marker can be carried out as described above, e.g., by growth in the absence of histidine in the case of URA3. Subsequent transfer of cells into counter-selection medium (e.g., 5-FOA) selects for spontaneous "pop-out" of the marker by homologous recombination between the tandem repeat sequences. Such methods can be adapted for deletion, point mutation, and gene replacement, by varying the portions of the cassette sharing homology with the target nucleic acid.

[0218] It is demonstrated herein that introduction of tandem repeats, for "pop-out" in combination with conventional recombination methods, is limited for modification of certain donor nucleic acids in yeast. See Example 4B(ii), below. The limitations are due to a high background of spontaneous loss of the negative (counter-) selection marker. The provided methods improve efficiency and reduce unwanted background mutations (e.g., spontaneous deletions) and can be used to modify bacterial genomes in yeast host cells. iv. Tandem Repeat - Endonuclease Cleavage (TREC)

[0219] Both tandem repeats and enzymatic cleavage near the target region can be used to facilitate removal of the selectable marker. One such embodiment, deemed the "Tandem Repeat Endonuclease Cleavage" (TREC) method, combines conventional homologous recombination replacement using a counter-selectable marker, inducible introduction of double-strand break near or at the target region by expression of an endonuclease, and introduction of tandem-repeat sequences flanking a nucleic acid sequence containing the marker. The methods can be used to accurately modify bacterial donor genomes and large nucleic acids cloned in yeast host cells with high efficiency.

[0220] With the TREC method, the combination of flanking tandem repeat sequences and proximal or adjacent double-strand break greatly enhances the efficiency of target-specific recombination and allows genetic engineering of bacterial genome in yeast hosts. An example in which this method was used to successfully seamlessly delete the CD 139 locus in the M. genitalium genome grown in yeast is described in Example 4C, below. The method is illustrated in Figure IOC.

[0221] The methods described herein can be used to introduce any modification, such as point mutations (e.g., nucleic acid and codon substitution, including conservative and non- conservative substitutions), deletions, insertions, and other modifications to target regions of donor nucleic acids within host cells, such as bacterial genomes within yeast host cells. v. Targeting cassettes and Generation of the cassettes

[0222] Provided are methods for designing and generating nucleic acids (e.g., targeting cassettes) for use in the modification methods. Also provided are the constructs and other nucleic acids for use in the methods. Typically, the target cassette for introducing the selectable marker contains a portion of homology to a portion of the donor target region (which optionally contains one or more mutations, deletions, insertions, substitutions, or other modifications compared to the homologous portion) and a selectable marker, typically a counter-selectable marker, such as URA3. Typically, the cassette contains a portion homologous to a 5' portion of the target region and a portion homologous to a 3' portion of the target region.

[0223] In some embodiments, a second targeting construct is generated, to replace the selectable marker with nucleic acid having homology to the target nucleic acid. This second targeting construct contains homology to the target region or portion thereof, and optionally contains one or more mutations, deletions, insertions, substitutions, or other modifications compared to the homologous portion within the target region.

[0224] In some embodiments, for introduction of a double-strand break near, within, or adjacent to the target region, the targeting cassette further includes a gene encoding an enzyme, such as an endonuclease, which cleaves nucleic acid such as dsDNA at a particular sequence, and further contains a nucleotide sequence recognized by the enzyme, typically at or near a terminus of the cassette. Typically, the gene encoding the endonuclease is under the control of an inducible promoter, such as the GAL1 promoter, such that expression of the gene can be induced by growth of the host cells under particular environmental conditions, such as in the presence of galactose as the only carbon source.

[0225] In some embodiments, for generation of tandem-repeat sequences, the targeting cassette includes a further portion of homology to the target nucleic acid, which is upstream or downstream of the target region, along the length of the target nucleic acid, such that upon integration of the cassette through homologous recombination, a tandem-repeat sequence will be present in the target nucleic acid.

[0226] When cleavage and tandem repeat sequences are used, the cassette contains a first portion of homology to a portion of the target nucleic acid that is upstream or downstream of the target region along the length of the target nucleic acid (to generate tandem repeats), a second and third portion of homology to 3' and 5' portions of the target region, respectively (for insertion of the cassette by homologous recombination), a nucleic acid encoding an enzyme (e.g., endonuclease) under the control of an inducible promoter, a nucleotide sequence recognized by the endonuclease, and the selectable marker, typically a counter- selectable marker. Typically, the second and third portions of homology (to 3' and 5' portions of the target region) flank a sequence containing the first portion of homology (which generates the tandem repeat). In one aspect, the second and third portions of homology further flank a sequence containing the nucleic acid encoding the enzyme (e.g.,

endonuclease). They typically also flank a sequence containing the selectable marker.

[0227] In one aspect, the nucleotide sequence recognized by the enzyme is located adjacent to the second or third homologous portion and is on the opposite terminus of the construct relative to the first portion of homology (which generates the tandem repeat region).

[0228] In one aspect, one or both of the second or third portions of homology (for integration of the cassette) contains one or more nucleotide mutations, insertions, or deletions, compared to the homologous portion in the target nucleic acid.

[0229] An exemplary targeting cassette, used in TREC in the Examples below, is illustrated in Figure IOC. This exemplary construct contains an l-Scel recognition site, a nucleic acid encoding a l-Scel endonuclease under the control of a GAL-1 promoter, a URA3 counter-selectable marker, and a portion (labeled "Repeat") that is homologous to a portion of the target nucleic acid sequence upstream of the target region (labeled "Repeat" in the target nucleic acid, also pictured). The cassette further contains a 50 bp portion of homology to the target region that is 5 Of the l-Scel site and a 50 bp portion of homology to the target region that is 3 Of the "Repeat" portion of homology. The portion of the targeting cassette containing the recognition site, the endonuclease-encoding gene and inducible promoter, and the selectable marker is termed the "CORE" cassette. This cassette was used, as described in Example 4C, below, to modify a M. genitalium donor genome, which had been transferred into a yeast host using the provided methods, within the host cell, by deleting a 450 base-pair portion of a target region of the genome. A similar construct, was used to delete the Type II Restriction Enzyme gene in a M. mycoides LC genome within a yeast host cell using the provided methods.

[0230] Variations of these targeting cassettes, such as those described in Figs. 10A-D and described elsewhere herein, also can be used with the provided methods. For example, variations of the cassettes can be used to introduce mutations, substitutions, insertions, and other modifications such as modified nucleotides, into the target nucleic acid. Such modifications of the provided cassettes and methods will be apparent to the skilled artisan.

[0231] The cassettes can be generated using any of a number of well-known nucleic acid synthesis, amplification, joining, and assembly methods, such as those described herein and commercially available methods. In one embodiment the cassettes are by amplification and/or assembly of nucleic acid fragments making up portions of the cassettes. The fragments can be generated using well-known methods, such as chemical synthesis or amplification (e.g., PCR) from a plasmid, genomic DNA or other nucleic acid containing the desired nucleotide sequence.

[0232] In one aspect, the fragments are assembled to form the cassette using fusion PCR, using a recombinant PCR technique, as described in Shevchuk, N.A. et al. , Nucleic Acids Res, 32, el 9 (2004).

[0233] With this method, chimeric fusion primers are used to amplify two different fragments to be joined, which then are joined in a primer-less polymerase reaction (e.g., primer-less PCR). The chimeric primers each contain a portion of homology to the first fragment to be joined, and a portion of homology to the second fragment to be joined. Thus, amplifying both fragments using the primers generates regions of overlapping homology among the products of the amplification, such as 40 bp homology at the termini of the products.

[0234] These products then are used in a number (e.g., 10, 11, 12, 13, or more) cycles of PCR in the absence of primers, with a low annealing temperature, such as at or about 56 °C, to join the products by overlap extension. Multiple products joined in this manner then can be joined in subsequent fusion PCR steps. Typically, the fusion products are re-amplified in an additional PCR reaction, such as with primers containing additional sequence to be added at the termini of the desired cassette.

[0235] Other assembly methods are known and can be used to generate cassettes. For example, the cassettes can be prepared using conventional synthetic methods as described, or can be purchased from commercial suppliers. Other assembly methods can be used, such as a one-step isothermal DNA assembly method is described in Gibson et al. , Nature Methods 6, 343 - 345 (2009), and in U.S. Patent Application No. 12/371,543, filed February 19, 2009, by the concerted action of a 5' exonuclease, a DNA polymerase, and a DNA ligase. With this method, DNA fragments are first recessed by the 5' exonuclease, yielding single-stranded overhangs, which then specifically anneal, followed by gap-filling and covalent joining using the polymerase and the ligase. Other assembly methods are described in U.S. Patent

Applications, Publication Nos: US2007/0037197A1 and US2007/0037196Al. vi. Transformation and analysis of modification

[0236] For modification, the cassettes are transformed into host cells containing the donor genomes, such as those produced according to the provided methods. Transformation methods are well known. In one example, the cassettes are introduced into yeast host cells containing the donor genome using lithium acetate integrative transformation, according to a published method (Gietz, D. et al, Nucleic Acids Res, 20, 1425 (1992)), with 2-3 μg PCR product and 25 μg carrier DNA (Salmon testis DNA, Sigma, St. Louis, MO).

[0237] For selection of cells in which the cassette has been integrated into the target nucleic acid, cells are grown in medium lacking uracil and individual URA+ transformants are selected and optionally analyzed by PCR, using diagnostic primers that specifically bind to portions of the target donor nucleic acid flanking the region at which the cassette is inserted. Whether the cassette is correctly inserted is determined by evaluating the presence and size of amplicon using such primers, which produce different sized amplicons depending on whether the cassette is inserted. An example is described in Example 4C(ii) below. Cells containing the correct insertion are used in subsequent rounds of homologous recombination.

[0238] When inducible expression of an enzyme to generate ds breaks is carried out, cells containing the counter-selectable marker then are grown under conditions that induce expression of the enzyme from the inducible promoter, such as growth in galactose- containing medium. In one example, cells are grown on SG (synthetic galactose)-His medium, containing galactose as the only carbon source, for example, for 4 hours or 24 hours, to induce expression of the enzyme that introduces the ds break. Growth on glucose- containing medium can be carried out as a control.

[0239] In some embodiments, a second nucleic acid, containing a sequence homologous to the target nucleic acid that will replace the selectable marker is transformed into the cells. In some cases, this second nucleic acid contains one or more mutations, deletions, insertions, or substitutions compared to the target nucleic acid. See Examples 4 A and 4B. In other cases, the second homologous recombination event occurs spontaneously, through the tandem repeats generated in the target nucleic acid after insertion of the vector. With the TREC method, a combination of these methods is used for removal of the selectable marker.

[0240] Loss of the counter-selectable marker is selected for by growth under conditions that favor the loss. In some aspects, when URA3 is used as the marker, before such a selection (e.g., after a second round of transformation), cells are grown in the presence of uracil, overnight at 30 °C, to deplete residual orotidine-5 '-phosphate decarboxylase (encoded by URA3 gene) in yeast cells having lost URA3 gene. Cells having lost the counter-selectable marker are then selected in an environment that favors the loss, such as in the presence of 5- FOA, such as on HIS plates containing 5-FOA, to select loss of the URA3 gene. PCR analysis using the same or different diagnosis primers, flanking the site of insertion, can be carried out to verify deletion of the cassette.

[0241] Multiplex PCR can be carried out to analyze the integrity of donor nucleic acids, such as genomes, modified using the provided modification methods. For example, Multiplex PCR (MPCR) can be performed as described in D. G. Gibson et al, PNAS USA, 105:20404-9 (2008).

[0242] Isolation of total DNA from the host cells for PCR and MPCR analysis can be performed using the isolation methods described herein, depending on the type of host cell. In one example, isolation of genomic DNA from yeast host cells is carried out as described in Example 3. MPCR primer sets can be designed with homology at various portions along the length of the donor genome, such as around the circular bacterial genome in yeast, with varying sizes, such that presence of each amplicon can be verified. See, e.g., D. G. Gibson et al, PNAS USA, 105:20404-9 (2008)). Multiplex PCR can be carried out using well-known methods, including commercially available kits, usch as Qiagen Multiplex PCR Kit. An exemplary reaction is described in Example 4A, below. The presence of each amplicon indicates that the modified genome is complete and is typically carried out to assure that spontaneous unwanted recombination events have not occurred, generating unwanted modifications. [0243] Other modification methods can be used in connection with the provided methods, depending upon donor, host, and recipient cell types. For example, the well-known CTQ-LOXP system can be used. The Cre-/oxP system is a known efficient site-specific recombination method that has been successfully used to remove selection markers and large genomic DNA segment in a large number of different organisms. A Cre-loxP mutagenesis construct with mutant loxP genes can be produced, e.g., by two rounds of PCR reactions, as described for other methods. Mutations of loxP prevent reverse recombination events, as described in Araki, K. et al, Nucleic Acids Res, 25, 868-872 (1997). An example is described in Example 4D, below. In one example, the modification method is as efficient, substantially as efficient, or more efficient than modification by the Cre-LoxP system.

F. Transplantation of modified donor genomes and nucleic acids into recipient cells

[0244] Provided herein are methods for transplantation of donor nucleic acids, including donor chromosomes and/or donor genomes into host cells or recipient cells. The donor nucleic acids can be transplanted from host cells to recipient cells. Donor nucleic acids include those modified within host cells. In another embodiment, the donor genomes are transplanted directly from donor cells into recipient cells, for example by transplantation of native genomes into recipient cells. Transplantation methods are useful for efficiently transplanting donor genomes, which have been propagated and modified within host cells, back into an environment in which gene products can be expressed from the genomes. The recipient cells can be cells of the same species or a closely related species compared to donor cell or organism.

[0245] Methods for cloning small nucleic acid fragments, such as gene segments, into host cells and transplanting them back into the original or closely related cells are known, but have generally been restricted to manipulation of small nucleic acids, for example, modification of a single nucleic acid fragment, which then is isolated and inserted back into the genome of the original donor cell. As described by Lartigue et al, Science 317, 632 (2007), whole Mycoplasma genomes have successfully been transplanted directly from a donor Mycoplasma cell to a closely related recipient Mycoplasma cell of a different species, with successful gene product expression upon transplant.

[0246] Available transplantation methods are limited, however, in their ability to transplant large nucleic acids {e.g., genomes and chromosomes), from host cells to recipient cells that are less closely related, such as cells of a different branch of life compared to the host cell in which the genome has been propagated. For example, available methods are limited for transplantation from eukaryotic hosts to prokaryotic recipients.

[0247] For example, transplantation of prokaryotic donor genomes, propagated in eukaryotic hosts, into prokaryotic recipients can be limited by nucleic acid recovery, methylation, incompatibility and toxicity issues. Methods are needed in which a sufficient amount of purified, intact, donor nucleic acid is recovered from the host cells to generate a sufficient number of recipient cells containing transplanted donor nucleic acids, such as a detectable number.

[0248] Restriction-modification systems that are present in recipient cells (and perhaps also in donor cells), but not present in host cells, can cause incompatibility upon

transplantation of donor nucleic acids that have been propagated within the host cells. For example, because Saccharomyces cerevisiae yeast host cells do not contain the restriction- modification systems present in some bacterial cells, bacterial genomes isolated after growth in yeast hosts can be susceptible to restriction-modification system(s) of bacterial recipient cells (Holt et al. , Bioessays 29, 580 (2007). Thus, transplanting bacterial genomes that have been modified and propagated in yeast cells into cells in which donor gene products can be expressed (such as donor cells and other bacterial recipient cells) carries the risk that the transplanted genomes will be incompatible with the recipient cells.

[0249] Further, such yeast hosts which do not contain restriction-modification systems can nonetheless express DNA methyltransferases that can modify donor nucleic acids (such as bacterial genomes) inhibiting their activation (e.g., gene product expression) upon transplantation into a recipient cell such as a bacterium.

[0250] Further, the structure and confirmation of donor genomes isolated after propagation and modification in host cells can differ from the confirmation and structure of the same genome propagated in a cell more closely related to the donor organism. Such differences can negatively impact transplantation of the donor nucleic acids back into recipient cells. The transplantation methods described herein include aspects to overcome such limitations for successful transplantation of donor genomes, modified and/or propagated in host cells, into genetically distinct recipient cells, such as from eukaryotic hosts to prokaryotic recipients. Among these aspects are in vitro methylation, treatment with enzymes to degrade host cell protein, and transplantation into recipient cells lacking restriction- modification systems, such as by mutation of these systems in recipient cells. Exemplary studies, demonstrating success of the provided transplantation methods, are described in detail in Example 3 and Example 5, below.

[0251] Figure 8 schematically illustrates three aspects of the provided transplantation methods. In the first approach (denoted with "1" labeling the arrows), donor DNA is isolated in agarose plugs which are melted, such as with β-agarase treatment, and transplanted directly into recipient cells. This first approach is typically used when nucleic acids are transplanted between similar cells and incompatibility issues are not a concern. In the second approach (denoted "2"), recipient cells are modified to mutate restriction enzymes prior to

transplantation of the donor nucleic acids, as in the first method. In the third approach (denoted "3"), donor nucleic acid in agarose plugs is subjected to methylation and deproteinisation reactions, prior to melting and transplantation, in order to protect the donor nucleic acid from recipient R-M systems and conformational changes. In another aspect, methylation is performed without deproteinisation.

[0252] Figure 16 schematically illustrates additional aspects of the provided

transplantation methods. A bacterial genome can be moved into yeast, engineered, and installed back into a bacterium by genome transplantation. A yeast vector can be inserted into a bacterial genome by transformation; that bacterial genome is cloned into yeast. After cloning, the repertoire of yeast genetic methods is used to create one or more insertions, deletions, rearrangements, or any combination thereof in the bacterial genome. This engineered genome can then be isolated and transplanted into a recipient cell to generate an engineered bacterium. Before transplantation, in some cases, it may be necessary to methylate the donor bacterial DNA in order to protect it from a recipient cell's restriction system(s). This cycle can be repeated in an iterative fashion starting from the newly engineered genome (dashed arrow). i. Isolation of donor nucleic acids from host cells or donor cells

[0253] In a first step, donor nucleic acids {e.g., donor genomes) are isolated from a host cell or donor cell. Methods for isolation of nucleic acids from cells are well known, including methods for isolation of genomic DNA, including whole genomes, and methods for isolating organelle genomes. Any such method, including those described herein, can be used to isolate the donor nucleic acids. One will understand that the choice of method depends on the type of nucleic acid to be isolated and the type of cell from which it is isolated.

[0254] Typically, isolation of large nucleic acids, such as genomes, is carried out in agarose plugs, as described below in the Examples.

[0255] Several aspects of the described transplantation methods provide efficiency and high yield of high quality transplanted nucleic acid. In one aspect, cells containing the donor nucleic acids are grown in the presence of Chloramphenicol or similar substance prior to isolation of the donor nucleic acids. Chloramphenicol is used to obtain compact and fully replicated donor genomes and chromosomes in the isolated nucleic acid samples (such as agarose plugs). It is known to synchronize ongoing rounds of replication, inhibit further rounds of replication (Drakulic and Errera, Biochim Biophys Acta 31, 459 (1959); Skarstad et al, EMBO J5, 1711 (1986); Bemander et al, JBacteriol 177, 1670 (1995); Skarstad et al, in Flow cytometry applications in cell culture A. N. E. Mohamed Al-Rubeai, Ed. (CRC Press, New York, 1996) pp. 241-255) and compact nucleoids (Murphy and Zimmerman, J Struct Biol 133, 75 (2001); Seto and Miyata, JBacteriol 181, 6073 (1999)). Presence of

chloramphenicol in Mycoplasma cultures might help to get compact and fully replicated genomes in the agarose plugs. a. Isolation from host cells

[0256] Where donor nucleic acids are isolated from host cells, the donor nucleic acids can be isolated in agarose plugs using a protocol compatible with the host cells. In one aspect, when the host cells are yeast, agarose plugs can be prepared, for example, with the CHEF mammalian Genomic DNA Plug Kit (Bio-Rad), following the instructions recommended by the manufacturer for yeast DNA extraction, with optional modifications. In one non-limiting example, cultures of yeast host cells containing bacterial donor nucleic acids are grown at 30° C in selective medium until the OD60o reaches approximately 1.5. In one example, 6x109 yeast cells are used per mL of plugs (instead of 6x108 cells recommended by the

manufacturer) to increase the amount of donor nucleic acid available per plug. Cell walls of the yeast hosts embedded in the agarose plugs are digested. Cell wall digestion can be carried out using lyticase (Biorad), as recommended by the CHEF kit manufacturer, or using 100T (β-l, 3-glucan laminaripentaohydrolase; USB, Cleveland, OH). In one example, Zymolase™ enzyme is added inside and outside of the plugs at a concentration of 5 mg/mL. The mixture is allowed to stand for 2 hours at 37°C.

[0257] In one example, after a washing IX TE buffer (20 mM Tris-HCl, pH 8; 50 mM EDTA), embedded yeast cells are lysed and proteins digested by two incubations of 24h at 50 °C with 5ml of Proteinase K Reaction Buffer [100 mM EDTA; 0.2% Sodium Deoxycholate; 1% Sodium Lauryl Sarcosine; pH 8.0] supplemented with 200 μΐ of Proteinase K, per ml of plug. The agarose plugs are washed at room temperature four times, for one hour each, with 40 ml of IX TE buffer, with agitation. Samples then are stored in the same buffer at 4°C. In some cases, it is desired to digest the isolated nucleic acids in subsequent steps, such as for removal of host DNA or linearization of donor genomes. In such cases, 1 mM of

phenylmethanesulfonylfluoride (PMSF) is added during the second wash.

[0258] When the donor nucleic acid is an organelle genome, the isolation protocol is modified in order to isolate organelle genomes, as in the organelle genome isolation methods discussed herein. b. Removal of host nucleic acids

[0259] For isolation of donor nucleic acids from host cells, it may be desirable to remove host nucleic acids. In one example, for isolation of bacterial donor genomes from yeast host cells, yeast genomic DNA is also isolated along with the bacterial nucleic acid that is extracted from the host cell. In one aspect, isolation includes a "clean-up" step, in which contaminant host nucleic acids are removed, such as with restriction enzymes that recognize host nucleic acids but not donor nucleic acids. In one example, to remove contaminant yeast genomic DNA, plugs are treated with a cocktail of restriction enzymes that specifically digests yeast genomic DNA.

[0260] In one example, removal of endogenous host DNA plugs is carried out by incubation of the plugs overnight at 37°C with restriction enzymes (e.g., 50 units of AsiSl, Rsrll, and Fsel enzymes (New England Biolabs, Ipswich, MA) in a 500 ΐ, reaction volume) that specifically cut host genomic DNA but leave donor DNA intact. Plugs then are washed at room temperature for 1 hour with 1 ml of IX TE buffer and loaded on 1% TAE agarose gel (120 minutes, 120 volts), to remove digested host DNA fragments from the plugs. [0261] In another example, where the host genomic DNA is linear and the donor genomes are circular, host genomic DNA is removed by Pulse Field agarose gel electrophoresis, whereby host genomic DNA is retained in the wells and donor genomic DNA is

electrophoresed out of the wells. (Lartigue et al, Science 317, 632 (2007)). In one such example, yeast plugs are subjected to electrophoresis in a 1 % LMP gel in 1 X TAE buffer, with a contour-clamped homogenous electric field (Chu et al, Science 234, 1582 (1986)), using the CHEF DR IIII, from Bio-Rad. Typically, pulse times are ramped from 60 to 120 seconds for 24 hours at 3.5 V/cm. After electrophoresis, plugs are removed from the wells and stored in 1 X TE buffer at 4°C.

[0262] Following separation of host DNA by either method, agarose plugs can be removed from wells for further processing. In one example, the removed plugs are washed two times for one hour in 1 mL 0.1X TE buffer and equilibrated for one hour in 1 mL of IX NEB buffer 2 (New England Biolabs, Ipswich, MA) supplemented with BSA (100 μg/mL). To linearize the donor genomic DNA to run it on an agarose gel, plugs can be incubated with a restriction enzyme. In one example, plugs are incubated overnight at 37°C with 50 units of PspXl restriction enzyme. Following the incubation, plugs are washed for 1 hour at room temperature with 1 mL of IX TE buffer and loaded onto a pulse-field gel.

[0263] In another example, host DNA is not removed prior to transformation. c. Isolation from donor cells

[0264] In another embodiment, where the donor nucleic acids (e.g., donor genomes) are transplanted directly from donor cells into recipient cells, isolation methods are used that are compatible with the donor cells. In one example, for isolation of donor bacterial genomes from donor cells, agarose plugs containing genomic DNA are prepared using the CHEF mammalian Genomic DNA Plug Kit (Bio-Rad), with modifications.

[0265] In one example, cells (e.g., M. mycoides LC cells containing donor genomes or yeast cells containing the donor genomes) are grown in the appropriate medium until a desired OD and then incubated with 100 μg/μl chloramphenicol for 90 minutes before harvesting.

[0266] An exemplary protocol for isolation of whole intact genomic DNA from

Mycoplasma donor cells is performed as described by Lartigue et al , Science 317, 632 (2007) with optional modifications, such as modifications to cell culture prior to isolation. One such example is described in Example 2B(ii). d. Quantification of isolated donor nucleic acid

[0267] The amount of isolated donor nucleic acid can be quantified or estimated prior to transplantation. In one embodiment, donor nucleic acids isolated from host cells are run on agarose gel and compared to donor nucleic acids isolated from known quantities of donor cells. An example is described in Example 2B. In another embodiment, the amount of isolated donor nucleic acid is quantified, such as by UV spectrophotometry. One such example is described in Example 2B(iv). ii. Treatment of the isolated donor genomes and/or recipient cells

[0268] The provided methods include steps for overcoming incompatibility barriers between host, donor, and recipient cells/nucleic acids. Such barriers are described herein, and can limit the transplantation of large nucleic acids such as donor genomes from host cells into recipient cells in which donor gene products can be expressed. This is particularly the case when the host cells are not closely related (e.g., from a different branch of life) to the donor and recipient organisms. Such barriers are relevant for transplantation of prokaryotic genomes, propagated in eukaryotic hosts, into prokaryotic recipients.

[0269] The barriers can be caused by a number of factors including incompatibility and toxicity. For example, restriction-modification (R-M) systems present in recipient cells (and perhaps also in donor cells), but not present in host cells, can cause incompatibility upon transplantation of donor nucleic acids that have been propagated within the host cells.

Restriction-modification systems are well known and are used, typically by bacterial organisms, to protect the organism from foreign DNA. Restriction modification systems generally include proteins for recognizing and cleaving particular nucleic acid sequences in foreign DNA, and enzymes for modifying (e.g., methylating), and thereby protecting, those sequences in the organism's own nucleic acids. Restriction-modification systems include Type I, Type II, and Type III systems. Type I systems generally contain a complex of three proteins that individually recognize (specificity), cleave (restriction) and modify

(modification) nucleic acid sequences. Thus, the same complex methylates and cuts DNA. Type II systems generally contain two separate modification and restriction enzymes, which methylate and cut DNA sequences, respectively. Type III systems contain restriction and modification enzymes that form heterodimer complexes for modification and cleavage. The modification enzymes also can methylate their own DNA.

[0270] Further, expression of DNA methyltransferases by host cells (including those that do not contain restriction-modification systems) can modify donor nucleic acids and inhibit their activation (e.g., gene product expression) after transplantation into recipient cells.

Structural and conformational changes in donor nucleic acids following propagation and modification in host cells can negatively impact transplantation of the donor nucleic acids back into recipient cells.

[0271] The provided transplantation methods include steps for overcoming such limitations in order to successfully transplant donor genomes, modified and/or propagated in host cells, into genetically distinct recipient cells, such as from eukaryotic hosts to prokaryotic recipients. The steps include (1) treatment of the isolated donor nucleic acids and (2) modifications to the recipient cells. a. In vitro assays to assess restriction-modification system incompatibility

[0272] In vitro assays can be utilized to determine whether incompatibility issues exist between host cells, donor nucleic acids, and recipient cells, for example, due to inconsistency in restriction-modification systems among the various organisms. Restriction-modification systems expressed by the donor genome or by the recipient cell may have the potential to impair successful transplantation and activation of the donor genome in the host cell.

[0273] To examine the issue of a possible restriction-modification problem for donor genomes propagated in host cells of a different type of organism, such as bacterial genomes propagated in yeast, the donor, host, and/or recipient cells are assessed with respect to restriction-modification systems. The presence of restriction-modification systems in donors and/or recipients (and recognition site specificities of the systems) can be identified from donor genome sequences, using known methods. See also REBASE, The Restriction Enzyme Database, available at the World Wide Web address: rebase.neb.com/rebase/rebase.html.

[0274] To further confirm the presence of a R-M system, the presence of a modifying enzyme can be tested in vitro. For this process, the methylation status of predicted recognition sites can be probed using commercially available restriction enzymes that recognize the predicted sites. For example, commercially available restriction enzyme isoschizomers corresponding to the predicted restriction enzyme systems can be used in digestion reactions to determine whether donor and recipient genomes are methylated at appropriate restriction sites. Genomic DNA that is methylated at the predicted sites can be protected from cleavage by the commercially available enzymes that recognize the sites. If recipient genomic DNA is protected from cleavage, the presence of the modifying enzyme of the R-M system is confirmed. This process also can be carried out on genomic DNA isolated from donor cells in order to assess whether the donor genome is likely to be protected from the system. An example is described in Example 2D, below.

[0275] Additionally, cell-free extracts prepared from the recipient and donor cells can be used to determine whether predicted restriction enzymes are present and active in the cells. Methods for making cell-free extracts are well known and any can be used with the provided methods, depending upon the cell type. In one non-limiting example, Mycoplasma cell-free extracts are prepared as described in Example 2D(ii)(b), below. DNA containing the predicted restriction sites is incubated with the cell-free extract in a restriction digest to determine the presence in the extracts of enzymes that recognize and cut DNA at the sequence. Digested samples are run on an agarose gel to determine cleavage. If desired, DNA that is or is not methylated at particular sites can be compared in the assay. Cell-free extracts also can be used as a source of methyltransferase activity, by the addition of EDTA, such as 10 mM EDTA, to inhibit nucleases. Alternatively, recombinant methyltransferases, such as E. coli dam methyltransferase (New England Biolabs, Ipswich, MA) can be used to methylate DNA prior to digest assays. Methyltransferases can also be purified An example of such a digest assay is described in Example 2D(ii)(b), below. b. Methylation of donor nucleic acids

[0276] Donor nucleic acids can be methylated in vitro following isolation from the donor cells and prior to transplantation into recipient cells. Methylation of the donor genomes, such as those that have been propagated in host cells, can protect them from restriction

modification systems of the host cell and/or those encoded by the donor genome. In one aspect, provided is a method of protecting the donor nucleic acid, which has been propagated in host cells, from R-M systems of the recipient and also those encoded by the donor. In other aspects, provided are methods of protecting the donor genome from R-M systems of one of these organisms. For example, in many cases it possible to methylate the donor genome with enzymes that will protect it from the recipient R-M systems. This is the case when donor nucleic acids become methylated by donor methyltransferases before a lethal concentration of corresponding donor restriction enzyme is reached.

[0277] As described in Example 2 below, it was unnecessary to protect M. mycoides LC donor genomic DNA from its own restriction systems upon transplantation into M.

capricolum recipient cells, implying that the donor genome becomes methylated before a lethal level of restriction enzyme activities is reached. This is not surprising because most endonuclease and methyltransferase gene pairs can be cloned simultaneously in E. coli. See Holt et al, Bioessays 29, 580 (2007). One would understand that donor cells, host cells and recipient cells can be assessed with respect to their restriction-modification systems to assess whether a donor genome is to be protected prior to transplantation.

[0278] When transplanting other bacterial genomes from yeast it may be necessary to methylate the donor genome in vitro to protect it from its own restriction enzymes, such as by in vitro methylation using cell-free extracts or purified methyltransferases from the donor or by inactivation of restriction endonuclease genes in the donor genome as described below. In vitro methylation and restriction digests, as described below, can be used to determine which methylation reactions may be needed in particular transplantation studies.

[0279] Typically, methylation is performed using methyltransferases that are the same as, or similar to, those of the R-M system from which protection is desired. Methylation can be carried out using methylases isolated from cell extracts (e.g., recipient cell extracts) or recombinantly produced and purified methylases.

[0280] In one aspect, methylases of the R-M systems of the recipient and/or donor cells are exogenously expressed and purified using recombinant methods. The coding sequences for all methyltransferases identified by R-M prediction can be codon optimized for expression in a desired system, such as yeast or bacterial cells. Fragments containing the coding sequences can be constructed using any of a number of well-known synthesis and/or assembly methods, such as those described herein. One non-limiting example is described in Example 2E(i)(a) in which methyltransferase-encoding nucleic acids were generated using a one-step isothermal DNA assembly method. After construction, the fragments are cloned into expression vectors, for expression in a cell of choice.

[0281] Vectors can be used to transform cells for expression of gene products. Exemplary expression systems include the BL21 (DE3) codon plus cells (Stratagene, La Jolla, CA). Expression of the methyltransferases can be induced in the cells, such as by incubation with IPTG. Methyltransferases can be purified from the cells, using well-known methods. In one example, cell lysates are clarified, column-purified, and fractions containing the

methyltransferases dialyzed against an enzyme buffer for use in subsequent methylation reaction, such as 50 mM HEPES-NaOH pH 7.2, 50 mM NaCl, 0.1 mM EDTA, 10 % glycerol). The samples can then be concentrated if needed. Exemplary expression and purification protocols are described in detail in Example 2E(i)(b), below.

[0282] In another aspect, crude extracts from cells having the R-M systems (such as the recipient cells or donor cells) are used to methylate the donor nucleic acids isolated from the host cells. This aspect can be advantageous if it is not certain that all the R-M systems of the recipient or host cell have been determined. For example, if the R-M systems of a recipient cell are unknown, methylation using a crude extract from the recipient cell will ensure that all the relevant methyltransferases are present in the methylation reaction. Any well-known method for preparing the appropriate cell extract can be used. An example is described in Example 2E(ii), below, for preparation of crude cell extracts containing methyltransferases from Mycoplasma recipient cells. Nucleases in the cell extracts can be inhibited, such as by the addition of 10 mM EDTA, to allow their use in methylation reactions.

[0283] Purified methyltransferases or crude cell extracts containing methyltransferases can be used to methylate donor nucleic acids isolated from host cells. In one example, agarose plugs containing the donor nucleic acid can be washed and equilibrated in

methylation buffer {e.g., 100 mM Tris-HCL pH 7.5; 10 mM EDTA; 3 μΜ DTT, 200 μΜ S- adenosylmethionine (SAM)). Plugs then can be incubated in methylation reactions, including methylation buffer and either crude cell extracts or purified methyltransferases. Parallel reactions without SAM can be used as controls. In one aspect, methylation reactions can be carried out in the presence of dam methyltransferase (New England Biolabs, Ipswich, MA). Following methylation, each yeast plug can be inclubated for 4 hours at 50 °C in 1 ml of Proteinase K Reaction Buffer supplemented with 40 μΐ of Proteinase K. The plugs can then be washed 4 times for 45 minutes each with 1 ml of IX TE buffer and 2 times for 30 minutes each on 0. IX TE buffer with gentle agitation at room temperature. After removing the final wash buffer, the plugs can be melted. An example is described in Example 3 A(iii). The effectiveness of methylation reactions on protecting donor nucleic acids from recipient R-M systems can be tested in vitro prior to the transplantation studies. Adjustments can be made depending upon the results of the R-M system assessments. This process can be carried out by performing methylation reactions on donor genomic DNA or plasmids containing donor nucleic acids. The methylation reaction can be followed by a restriction digest reaction, using restriction enzymes of the recipient cell, to ensure protection of the donor nucleic acids by methylation. An example is described in Example 2E. c. Deproteinisation

[0284] Incubation with crude extract can change the confirmation of donor DNA which, in turn, can cause incompatibility upon transplantation. Such conformational changes can be assessed by visualizing donor genomic DNA incubated in the presence or absence of cell extracts, such as described in Example 2B(iv). Thus, in some embodiments, donor nucleic acids can be subjected to a deproteination step after methylation and prior to transplantation to remove the proteins in the crude extract. In one aspect, the proteins can be removed using a proteinase, such as proteinase K. In an exemplary treatment, agarose plugs that have been subject to methylation reactions can be further incubated for 4 hours at 50 °C in proteinase K reaction buffer and proteinase . The plugs can be washed before proceeding with melting of the plugs and transplantation. See Examples 2B(iv) and 3 A(iii). d. Genetic modification of recipient cell R-M systems

[0285] In some cases, the restriction-modification system of a recipient cell may need to be incactivated prior to transplantation of a donor nucleic acid or genome; modification of a R-M system can occur in vitro or in vivo. Instead of in vitro methylation, restriction modification systems can be removed or inactivated from at least the recipient cell, and possibly the donor genome or nucleic acid.

[0286] One or more restriction enzyme(s) of the recipient cell R-M system can be inactivated by mutation of the gene encoding the enzyme. This process typically can be used as an alternative to in vitro methylation of the donor nucleic acids prior to transplantation. [0287] Restriction modification system inactivation of donor genomes, however, may not be practical in some cases. For example, expression of restriction endonucleases encoded by the donor genome immediately following transplantation can help drive transplantation by degrading the resident genome of the recipient cell. Thus, removal of the donor restriction modification systems is undesirable in such cases and methylation should be used. One would understand that each of the donor, host and receipient cells can be assessed in this regard prior to transplantation to identify the best system for inactivation of a R-M system.

[0288] Any mutation process can be used to inactivate a R-M system. One example is described in Example 2F, below, in which the gene encoding the single restriction enzyme in a Mycoplasma recipient cell was inactivated prior to transplantation of donor nucleic acids. In that example, the gene was mutated by interruption with a puromycin resistance marker, allowing selection of cells containing the mutated gene. Other methods of inactivationare contemplated herein and include a variety of resistance markers that can also be used for selection of cells containing a mutated gene; such markers are described herein and are also known in the art. Cell extracts prepared from such mutant recipient cells can be used as controls in methylation reactions as described herein.

[0289] Alternatively, a donor genome can be methylated in vivo, for example, while still in the host cell. In vivo methylation inside a host cell can be carried out by expression of donor or recipient methylases that are cloned into the host vector. This aspect may be less desirable as it may lead to unwanted changes in the donor genome. For example, expression of bacterial methylases in yeast has been shown to increase yeast homologous recombination, which could lead to alteration of a donor bacterial genome housed in either a yeast artificial chromosome (YAC) or yeast centromeric plasmid (YCp). This result can occur because the yeast host cell is under no selective pressure to maintain the integrity of the bacterial genome except for the inserted yeast vector sequence region of said bacterial genome. It would be understood that one can assess whether in vitro methylation, in vivo methylation, or inactivation of the R-M system by insertion of, for example, a resistance marke,r is to be used to inactivate a R-M system of a recipient cell. iii. Transplantation into recipient cells

[0290] Following isolation and treatment, the donor nucleic acids can be further transplanted into recipient cells using methods described herein or known in the art. One exemplary transplantation protocol is described in Example 3, below. One method used to transplant Mycoplasma genomes from donors to Mycoplasma recipients is described by Lartigue et al, Science 317, 632 (2007). Such methods can be used to modify genomes or nucleic acids from intractable cells or organisms in a separate host to confer a specific property upon the donor genome. The modified genome can then be transplanted back into the same donor cell or into a donor cell, thereby conferring the phenotype of the modified genome upon the recipient cell.

[0291] Recipient cells typically are chosen based on their ability to support gene expression from the donor nucleic acids, such as the donor genomes. The transfer of a bacterial genome into a eukaryotic host is provided herein as an exemplary method and is not intended to be limiting. For example, after a bacterial genome has been transferred into, and modified within, a eukaryotic host cell having a preferred genetic manipulation system {e.g., yeast), it may be necessary to transplant the genome back into a bacterial recipient cell in order to express gene products from the modified genome. As discussed herein, differences in translation and transcription and different codon usage, among other factors, can prevent expression of the donor gene products within the host cell. The recipient cell, therefore, may be of the same species or a similar species as a donor cell or organism. It is often of the same order or kingdom as the donor. One will be able to determine an appropriate recipient cell based on the donor genome or other nucleic acid from which expression is desired.

[0292] Following isolation of donor nucleic acids in agarose plugs, host DNA can optionally be removed (e.g., by digest and/or electrophoresis), and optionally treated with methyltransferases and/or proteinase.

[0293] Agarose plugs can be melted, for example, by incubation with β-Agarase I (New England Biolabs) as described in Example 3 A(ii)(b) below.

[0294] Transplantation can be performed in the presence of polyethylene glycol (PEG), such as PEG-6000 or PEG-8000 or other PEG to facilitate transformation. The source, amount, and size of the PEG can be varied to determine the optimal PEG. In one example, the PEG is PEG-2000, PEG-4000, PEG-6000, PEG-8000, PEG- 10000, PEG-20000, or other. The concentration of PEG can be varied depending upon the conditions of the transplantation; concentrations include those, for example, at or about 5 % or at or about 10 %. An example is described in Example 3 A(ii)(c), below. Melted plugs can be added to the recipient cells in the presence of PEG with gentle rocking to mix. Cells are allowed to recover, centrifuged, and grown in medium containing appropriate selection medium to select for recipient cells containing the transplanted donor nucleic acid. In one aspect, cells are plated on the medium and grown under appropriate conditions for the recipient cell type until colonies appear.

Colonies can be picked and further grown in selection medium to produce a desired quantity of recipient cells containing the transplanted genome or other donor nucleic acid.

[0295] A particular ratio of recipient cells to donor nucleic acid can be maintained as needed. In one example, a ratio of between at or about 10 and at or about 10 recipient cells per 2 μg genomic DNA can be maintained. The provided transplantation methods can be used to achieve approximately 30 transformants for 200 ng of endogenous genomic DNA, or between 500 and 1500 transplants per reaction, or other appropriate amount that is obtained from the host or donor cell. In one non-limiting example, transplantation is carried out with ~ 10 recipient cells, 20 μΐ of melted of agarose plug containing donor genome at 100 ng/μΐ. One would understand that the ratio of recipient cells to donor nucleic acid may vary depending upon the cell types and that empirical assessment can be used to optimize the ratio.

[0296] An exemplary transplantation method is illustrated in Figure 8 ("3"): in this method, genomic DNA containing appropriate markers and elements for propagation in host and recipient cells is isolated from host cells in agarose plugs, methylated with crude extract or purified methyltransferases and deproteinized with Proteinase K. The agarose plugs are melted, DNA incubated with recipient cells, which then are plated on selection medium. By way of example, whole intact M. mycoides LC donor genomic DNA containing a YCp element, a tetracycline marker and a β-galactosidase gene can be isolated from yeast hosts in agarose plugs, methylated with a M. mycoides LC crude extract, and then deproteinized with Proteinase K. The agarose plugs containing the methylated genomic DNA were melted and incubated with M. capricolum recipient cells and then plated onto SP4 medium containing tetracycline to select for transformants.

G. Iterative methods

[0297] The methods described herein can be used for multiple rounds of genome or other nucleic acid modification out in an iterative fashion. [0298] In one embodiment, an engineered cell produced by the methods (such as a recipient cell containing a transplanted, modified, genome that has been modified by the provided methods, e.g., in a host cell) can be used as a source of donor nucleic acid in subsequent rounds of transformation, modification, and transplantation, thereby generating a further modified genome and organism.

[0299] In one non-limiting example, as illustrated in Figure 1 , an engineered bacterial cell produced by the methods (such as a recipient cell containing a transplanted, modified, bacterial genome that has been modified by the provided methods, e.g., in yeast) can be used as a source of donor nucleic acid in subsequent rounds of transformation, modification, and transplantation, thereby generating a further modified genome and organism.

[0300] In an alternative iterative embodiment of moving a donor genome into a host cell, engineering it, and installing it back into a donor by genome transplantation, a host vector is inserted into a donor genome by transformation. That genome is cloned into a host cell; after cloning, the repertoire of host genetic methods is used to create insertions, deletions, rearrangements, or any combination of modifications in the donor genome. This engineered genome is then isolated and transplanted into a recipient cell to generate an engineered recipient cell with an altered phenotype. Before transplantation it may be necessary to methylate the donor DNA in order to protect it from the recipient cell's restriction system(s). This cycle can be repeated starting from the newly engineered genome.

[0301] Provided in Figure 16 is a non-limiting example of moving a bacterial genome into yeast, engineering it, and installing it back into a bacterium by genome transplantation, a yeast vector is inserted into a bacterial genome by transformation. That genome is cloned into yeast; after cloning, the repertoire of yeast genetic methods is used to create insertions, deletions, rearrangements, or any combination of modifications in the bacterial genome. This engineered genome is then isolated and transplanted into a recipient cell to generate an engineered bacterium. Before transplantation it may be necessary to methylate the donor DNA in order to protect it from the recipient cell's restriction system(s). This cycle can be repeated starting from the newly engineered genome (dashed arrow).

[0302] The large number of available, verified, substantiated, and reliable selectable markers for selection and counter-selection of yeast mutants enables use of the provided methods to carry out multiple, e.g., infinite iterative rounds of seamless nucleic acid alterations within yeast host cells. Serial modifications to a cloned copy of an otherwise intractable genome or other large nucleic acid can be performed in yeast in rapid succession. The mating capacity of yeast is favorable for modifying genomes and other large nucleic acids. Yeast recombination machinery, when activated during yeast mating, can be used to generate libraries, e.g., combinatorial libraries containing variants of cloned genomes or nucleic acids. Although the embodiments described herein utilize yeast cells as host cells, it would be understood that the provided methods encompass other host cells which are already understood with respect to, for example, selectable markers for selection and counter- selection of host cell mutants, or which are assessed in this regard. A number of variations of this embodiment are contemplated and within the scope of the application.

H. Uses of the provided methods and compositions

[0303] The provided methods and compositions can be used to solve problems related to the environment, energy production and medicine. The provided methods and compositions are useful in producing, engineering and modifying genomes and organisms and other products for commercial use, such as immunogens, biological proteins and chemicals, vaccines, biofuels, and useful proteins such as enzymes. For example, the provided methods can be used to manipulate and engineer nucleic acids from any organisms, particularly those having poor genetic systems, such as those whose genomes are not easily manipulated by conventional methods. The provided methods are useful in building synthetic genomes and transplanting the genomes into recipient cells to generate synthetic cells. Thus, the methods can be used to produce medically useful proteins, including enzymes, protein and nucleic acid therapeutics, antibodies, immunogens, vaccines, and other cellular products.

[0304] A vaccine generally refers to an immunogenic preparation that improves immunity to a particular microorganism (bacterial or viral) associated with a disease. A vaccine typically contains a small amount of an agent that resembles a microorganism. The agent stimulates the body's immune system to recognize the agent as foreign, destroy it, and remember it, so that the immune system can more easily recognize and destroy any of these microorganisms that it later encounters. Vaccines can be prophylactic (e.g., to prevent or ameliorate the effects of a future infection by any natural or "wild" pathogen), or therapeutic (e.g., cancer vaccines). Vaccines may be monovalent (also called univalent) or multivalent (also called polyvalent). A monovalent vaccine can be designed to immunize against a single antigen or single microorganism. A multivalent or polyvalent vaccine can be designed to immunize against two or more strains of the same microorganism, or against two or more microorganisms. In certain cases, a monovalent vaccine may be used for rapidly developing a strong immune response. Vaccines are used to try to reduce risk of illness, while retaining the ability to induce a beneficial immune response. Vaccines can contain dead or inactivated organisms or purified products derived from them. Immunogenic compositions are useful for treating human and non-human populations (e.g., primates, veterinary animals, etc.).

[0305] The provided technology is useful for production of immunological compositions to elicit an immune response from an organism, such as immunogenic compositions, such as those including live cells and viruses, including, but not limited to, modified Adenoviridae (e.g., adenovirus), Picornaviridae (e.g., coxsackievirus, hepatitis A virus, poliovirus), Herpesviridae (e.g., various types of Herpes simplex virus, Epstein-barr virus, Human cytomegalovirus), Hepadnaviridae (e.g., Hepatitis B virus), Flaviviridae (Hepatitis C virus, yellow fever virus, dengue virus, West Nile virus, etc.), Retroviridae (e.g., Human immunodeficiency virus (HIV)), Orthomyxoviridae (e.g., influenza virus), Paramyxoviridae (e.g., Measles virus, Mumps virus, Parainifluenza virus, Respiratory syncytial virus, Human metapneumovirus, etc.), Papillomaviridae (e.g., Papillomavirus), Rhabdoviridae (e.g., Rabies virus), Togaviridae (e.g., Rubella virus), and Parvoviridae (e.g., Human bocavirus,

Parvovirus B19), influenza (e.g., H1N1 influenza, Haemophilus influenzae type B, etc.), polio, vaccinia, varicella zoster, reovirus, retroviruses, poxviruses, Parvoviruses,

Picornaviruses, paramyxoviruses, and BCG.

[0306] The provided technology is useful for production of immunological compositions to elicit an immune response from an organism, such as immunogenic compositions, such as those including live cells and bacteria, including, but not limited to, modified Bordetella (e.g., Bordetella pertussis), Borrelia (e.g., Borrelia burgdorferi), Brucella (e.g., Brucella abortus, Brucella canis, Brucella melitensis, and Brucella suis), Campylobacter (e.g., Campylobacter jejuni), Chlamydia (e.g., Chlamydia pneumonia, Chlamydia psittaci, and Chlamydia trachomatis), Clostridium (e.g., Clostridium botulinum, Clostridium difficile, Clostridium perfringens, and Clostridium tetani), Corynebacterium (e.g., Corynebacterium diphtheria), Enterococcus (Enterococcus faecalis and Enterococcus faecum), Escherichia (e.g., Escherichia coli), Francisella (e.g., Francisella tularensis), Haemophilus (e.g.,

Haemophilus influenza), Helicobacter (e.g., Helicobacter pylori), Legionella (e.g., Legionella pneumophila), Leptospira (e.g., Leptospira interrogans), Listeria (e.g., Listeria

monocytogenes), Mycobacterium (e.g., Mycobacterium leprae and Mycobacterium

tuberculosis), Mycoplasma (e.g., Mycoplasma pneumonia), Neisseria (e.g., Neisseria gonorrhoeae and Neisseria meningitides), Pseudomonas (e.g., Pseudomonas aeruginosa), Rickettsia (e.g., Rickettsia rickettsii), Salmonella (e.g., Salmonella typhi and Salmonella typhimurium), Shigella (e.g., Shigella sonne), Staphylococcus (e.g., Staphylococcus aureus, Streptococcus pneumonia, Staphylococcus epidermidis and Staphylococcus saprophyticus), Streptococcus (e.g., Streptococcus agalactiae, Streptococcus pneumoniae and Streptococcus pyogenes), Treponema (e.g., Treponema pallidum), Vibrio (e.g., Vibrio cholera), and

Yersinia (e.g., Yersinia pestis)h.ave immunogenic features that make them attractive vaccine candidates.

[0307] Available vaccine preparation methods have been unable to effectively rid many organisms of their pathogenicity while retaining their immunogenicity. The provided methods and compositions, which can be used to engineer and manipulate large nucleic acids and genes, e.g., combinatorially, can be used to engineer such vaccines.

[0308] The methods described herein can be used to produce compositions effective to treat, prevent, or substantially reduce the biological impact of: chicken pox, shinges, influenza, polio, measles, mumps, rubella, toxic shock, cholera, bubonic plague, Hepatitis A, Hepatitis B, Hepatitis C, yellow fever, malaria, tuburculosis, tetanus, encephalitis, Acquired Immune Deficiency Syndrome (AIDS), leprocy, canine distemper, canine parvovirus, infectious canine hepatitis, adenovirus-2, leptospirosis, bordatella, canine parainfluenza virus, Dengue fever, Lyme disease and another other disease for which a vaccine is useful in treating and/or managing one or more symptoms.

[0309] Additional viruses types, families and associated diseases contemplated for the methods decribed herein are provided in the following table.

Virus Type Family Associated Disease(s)

Acute febrile pharyngitis, pharingoconjunctival adenovirus adenoviridae fever, epidemic keratoconjunctivitis, and infantile gastroenteritis W 201

87

virus [0310] Additional bacterial species and associated diseases contemplated for use in the methods decribed herein are provided in the following table.

Species Diseases

Cutaneous anthrax, pulmonary anthrax, and gastrointestinal

Bacillus anthracis

anthrax

Whooping cough and complications such as secondary bacterial

Bordetella pertussis

pneumonia

Borrelia burgdorferi Lyme disease

Brucella abortus, Brucella

canis, Brucella melitensis Brucellosis

and Brucella suis

Campylobacter jejuni Acute enteritis

Chlamydia pneumoniae Community-acquired respiratory infection

Chlamydia psittaci Psittacosis

Nongonococcal urethritis (NGU), Trachoma, Inclusion

Chlamydia trachomatis conjunctivitis of the newborn (ICN), and Lymphogranuloma venereum (LGV)

Clostridium botulinum Botulism

Clostridium difficile Pseudomembranous colitis

Clostridium perfringens Gas gangrene, acute food poisoning and anaerobic cellulitis

Clostridium tetani Tetanus

Corynebacterium

Diphtheria

diphtheriae

Enterococcus faecalis and

Nosocomial infections

Enterococcus faecum

Escherichia coli

Urinary tract infections (UTI), Diarrhea and Meningitis in infants (generally)

Enterotoxigenic

Traveller's diarrhea

Escherichia coli (ETEC)

Enteropathogenic E. coli Diarrhea in infants

E. coli 0157:H7 Hemorrhagic colitis and Hemolytic-uremic syndrome

Francisella tularensis Tularemia

Bacterial meningitis, Upper respiratory tract infections, and

Haemophilus influenzae

Pneumonia, bronchitis

Helicobacter pylori Peptic ulcer and Risk factor for gastric carcinoma and gastric B- cell lymphoma Species Diseases

Legionella pneumophila Legionnaire's Disease and Pontiac fever

Leptospira interrogans Leptospirosis

Listeria monocytogenes Listeriosis

Mycobacterium leprae Leprosy (Hansen's disease)

Mycobacterium

Tuberculosis

tuberculosis

Mycoplasma pneumoniae Mycoplasma pneumonia

Neisseria gonorrhoeae Gonorrhea, Ophthalmia neonatorum and Septic arthritis

Meningococcal disease including meningitis and Waterhouse-

Neisseria meningitidis

Friderichsen syndrome

Pseudomonas aeruginosa Localized or systemic Pseudomonas infections.

Rickettsia rickettsii Rocky mountain spotted fever

Salmonella typhi Typhoid fever type salmonellosis (dysentery, colitis)

Salmonella typhimurium Salmonellosis with gastroenteritis and enterocolitis

Shigella sonnei Bacillary dysentery/Shigellosis

Localized skin infections, Diffuse skin infection (Impetigo), Deep, localized infections, Acute infective endocarditis,

Staphylococcus aureus

Septicemia, Necrotizing pneumonia and Toxinoses (e.g., Toxic shock syndrome and Staphylococcal food poisoning)

Staphylococcus

Infections of implanted prostheses, e.g. heart valves and catheters epidermidis

Staphylococcus

Cystitis in women

saprophyticus

Meningitis and septicemia in neonates, Endometritis in

Streptococcus agalactiae postpartum women and opportunistic infections with septicemia and pneumonia

Acute bacterial pneumonia & meningitis in adults and Otitis

Streptococcus pneumoniae

media and sinusitis in children

Streptococcal pharyngitis, Scarlet fever, Rheumatic fever,

Streptococcus pyogenes

Impetigo and erysipelas, Puerperal fever and Necrotizing fasciitis

Treponema pallidum Syphyllis and Congenital syphilis

Vibrio cholerae Cholera

Yersinia pestis Plague such as Bubonic plague and Pneumonic plague

[0311] The methods described herein can also be used to produce compositions effectiveo treat or prevent the disease contagious bovine pleuro pneumonia (CBPP), which is caused by the bacterium Mycoplasma mycoides Small Colony. This disease, also known as lung plague, is a major pathogen of cattle, yaks, buffalo, and zebu. The disease is widespread in Africa, the Middle East, Southern Europe, as well as parts of Asia. There is a real need for an improved vaccine. The disease organism is a close phylogenetic relative of the bacterium used here to demonstrate aspects of the provided methods, M. mycoides Large Colony strain GM12. Antigen genes and/or the genome of M. mycoides Small Colony bacterium can be cloned and manipulated using the provided technology, to generate cells, e.g., mutants, to function as live vaccines.

[0312] The provided methods can be used, for example, with M. mycoides LC and closely related species as model systems for exploring the pathogenicity and biology of

Mycoplasmas. The mycoides group of Mycoplasmas causes major diseases of ruminants and there is an urgent need for vaccines. The provided methods can accelerate the construction of live vaccine strains. The methods also can be used to determine the minimal gene

complement required for life, particularly in small genomes such as the M. mycoides genome.

[0313] Methods of administering vaccines are known in the art and include injection and aerosol delivery of an immunogenic vaccine composition to a subject. Compositions can be formulated and administered with any pharmaceutically acceptable carrier or excipient. Also provided here are compositions comprising an immunogenic vaccine formulated in a medicament for the treatment of a disease or condition identified herein. Effect of an immunogenic vaccine composition following administration to a subject can be measured with respect to one or more aspects of an immune response. Immune responses include, for example, induction of antibody responses (increased antibody titers), cytokine responses, induction of T helper (THI and TH2) cell differentiation and proliferation, etc. Each of such responses can be quantified. Immune responses also include reduction of overall bacterial or viral load in a patient.

[0314] The presently disclosed methods are also useful for developing biofuels.

[0315] Biocrudes are biologically produced compounds or a mix of different biologically produced compounds that are used as a feedstock for refineries in replacement of, or in complement to, crude oil or other forms of petroleum. In general, but not necessarily, these feedstocks have been pre-processed through biological, chemical, mechanical or thermal processes in order to be in a liquid state that is adequate for introduction in a petroleum refinery.

[0316] Microorganisms can be modified using the methods described herein to produce a biocrude, which can be further processed to a biofuel composition. The biofuel can then perform as a finished fuel or a fuel additive.

[0317] "Finished fuel" refers to as a chemical compound or a mix of chemical compounds (produced through chemical, thermochemical or biological routes) that is in an adequate chemical and physical state to be used directly as a neat fuel or fuel additive in an engine. In many cases, but not always, the suitability of a finished fuel for use in an engine application is determined by a specification which describes the necessary physical and chemical properties that need to be met. Some examples of engines are: internal combustion engine, gas turbine, steam turbine, external combustion engine, and steam boiler. Some examples of finished fuels include: diesel fuel to be used in a compression-ignited (diesel) internal combustion engine, jet fuel to be used in an aviation turbine, fuel oil to be used in a boiler to generate steam or in an external combustion engine, ethanol to be used in a flex-fuel engine. Examples of fuel specifications are ASTM standards, mainly used ion the US, and the EN standards, mainly used in Europe.

[0318] "Fuel additive" refers to a compound or composition that is used in combination with another fuel for a variety of reasons, which include but are not limited to complying with mandates on the use of biofuels, reducing the consumption of fossil fuel-derived products or enhancing the performance of a fuel or engine. For example, fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity, viscosity, oxidative stability, ignition quality, octane level, and flash point. Additives can further function as antioxidants, demulsifiers, oxygenates, thermal stability improvers, cetane improvers, stabilizers, cold flow improvers, combustion improvers, anti-foams, anti-haze additives, icing inhibitors, injector cleanliness additives, smoke suppressants, drag reducing additives, metal deactivators, dispersants, detergents, demulsifiers, dyes, markers, static dissipaters, biocides, and/or corrosion inhibitors.

[0319] Some eukaryotic algae synthesize as much as 70% of their dry weight as oils. These oils, which are the product of photosynthesis, are ideal biofuel candidates. Organisms that produce these oils can be grown in ponds in deserts so no arable croplands will be lost to biofuel production. Use of such algae is typically limited by their slow growth. However, the provided methods can be used to manipulate the genomes of organisms, for example, to engineer new organisms, e.g., prokaryotic organisms, that express enzymes involved in the oil synthesis pathways, for example, by manipulating transcriptional promoters, translation signals, and codon optimization. The methods can be used to modify genomes of

photosynthetic bacteria to engineer new bacteria having chimeric genomes that produce biofuels, such as the oils produced by algae, instead of the normal products of photosynthesis (glucose).

[0320] Recombinant microorganisms made using the disclosed methods can contain an engineered biosynthetic pathway capable of converting glucose and other sugars derived from lignocellulosic biomass to geraniol.

[0321] Recombinant microorganisms (e.g., strains of photosynthetic microorganisms) made using the disclosed methods can be used to biologically produce branched-chain alcohols, including, for example, 2-methyl-l-butanol, 3 -methyl- 1-butanol, and isobutanol. One aspect involves the production of recombinant photosynthetic microorganisms via introduction of heterologous genes that encode enzymes that enhance the production and decarboxylation of 2-keto branched-chain acids, leading to the production of the

corresponding branched-chain aldehydes. Additional gene introductions can then be carried out for efficient reduction of the branched-chain aldehydes to the corresponding branched- chain alcohols. In addition, the microorganisms can be engineered such that branched chain alcohols are enzymatically dehydrated in vivo to produce various branched-chain alpha- olefins.

[0322] Recombinant microorganisms made using the disclosed methods to encode plant acyl-ACP thioesterases. Such nucleic acid molecules can be used to transform organisms, such as photosynthetic organisms and prokaryotic organisms, for synthesizing fatty acids and fatty acid products such as fatty aldehydes, fatty alcohols, fatty esters, including wax esters, and hydrocarbons. Also included are organisms transformed using the methods provided herein. [0323] Recombinant microorganisms (e.g., recombinant photosynthetic microorganisms) made using the disclosed methods to contain a nucleic acid molecule comprising at least one recombinant expression system that produces at least one exogenous acyl- ACP thioesterase, wherein said acyl- ACP thioesterase liberates a fatty acid chain that contains 6-20

carbons, and the microorganism secretes the fatty acid liberated by the acyl-ACP thioesterase into the medium. A thioesterase can be used to liberate a fatty acid chain that contains 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 carbons. The fatty acids thus recovered can be further modified synthetically or used directly as components of biofuels or chemicals.

[0324] In such constructions, it may be desirable to remove the portion of the gene that encodes the plastid transit peptide region, as this region is inappropriate in prokaryotes.

Alternatively, if expression is to take place in eukaryotic cells, the appropriate plastid transit peptide encoding region to the host organism may be substituted. Preferred codons may also be employed, depending on the host.

[0325] Genomes of microbes can be further modified to include an expression system for a heterologous gene that encodes a β-ketoacyl synthase (KAS) that preferentially produces acyl-ACPs having medium chain lengths. Such KAS enzymes would serve to increase the availability of acyl-ACP molecules of the proper length for recognition and cleavage by the heterologous medium-chain acyl-ACP TE. Another example is that a photosynthetic host cell containing a heterologous acyl-ACP TE gene may be further modified to include an expression system for a heterologous gene that encodes a multifunctional acetyl-CoA carboxylase or a set of heterologous genes that encode the various subunits of a multi-subunit type of acetyl-CoA carboxylase. Other heterologous genes that encode additional enzymes or components of the fatty acid biosynthesis pathway could also be introduced and expressed in acyl-ACP TE-containing host cells.

[0326] The photosynthetic microorganism may also be modified such that one or more genes that encode beta-oxidation pathway enzymes have been inactivated or downregulated, or the enzymes themselves may be inhibited to prevent the degradation of fatty acids released from acyl-ACPs, thus enhancing the yield of secreted fatty acids. In cases where the desired products are medium-chain fatty acids, the inactivation or downregulation of genes that encode acyl-CoA synthetase and/or acyl-CoA oxidase enzymes that preferentially use these chain lengths as substrates would be beneficial. Mutations in the genes encoding medium- chain-specific acyl-CoA synthetase and/or medium-chain-specific acyl-CoA oxidase enzymes such that the activity of the enzymes is diminished would also be effective in increasing the yield of secreted fatty acids. An additional modification inactivates or down- regulates the acyl-ACP synthetase gene or inactivates the gene or protein.

[0327] Photosynthetic microorganisms may also be modified such that one or more genes that encode storage carbohydrate or polyhydroxyalkanoate (PHA) biosynthesis pathway enzymes have been inactivated or down-regulated, or the enzymes themselves may be inhibited. Examples include enzymes involved in glycogen, starch, or chrysolaminarin synthesis, including glucan synthases and branching enzymes. Other examples include enzymes involved in PHA biosynthesis such as acetoacetyl-CoA synthase and PHA synthase.

[0328] The disclosed methods are also useful for production of industrial enzymes and industrial organisms. The disclosed methods can be used to generate new organisms with chimeric genomes, e.g., a genome that is a chimera of Clostridium acetobutylicum and Clostridium cellulolyticum that has the genes from the former species that encode the enzymes needed to synthesize ethanol from glucose and genes from the latter species that encode cellulases that can efficiently degrade cellulose. Thus, the provided methods and compositions can be used to produce cells and organisms that efficiently degrade cellulose to produce the ethanol.

[0329] Other uses are described below and are contemplated herein. The methods are also useful generally in cloning of whole and partial genomes, which facilitates the study of genomes from organisms that are difficult to culture and aids in the construction and propagation of synthetic genomes. Although certain preferred industrial applications have been described herein, the methods and processes of the present invention are broadly applicable tools for the production of any phenotype or product of interest from an engineered genome.

I. EXAMPLES

[0330] The following examples are offered to illustrate provided embodiments and are not intended to limit the scope of the application. EXAMPLE 1

Transfer of Bacterial Donor Genomes into Yeast Host Cells

[0331] This example describes the successful cloning of bacterial genomes in yeast host cells, using three different cloning approaches provided herein (Figure 2). As described below, each approach yielded a host cell having a nucleic acid containing the donor bacterial genome joined to a yeast host vector. Transfer of donor genomes to host cells by these approaches can be used with the provided methods for propagation and modification of donor genomes in host cells, and transplantation of donor genomes from host cells into recipient cells (Figure 1).

[0332] The first cloning approach, shown in Figure 2A, was carried out by inserting the yeast host vector into the donor bacterial genome prior to transformation of yeast, thereby producing the joined molecule that then was transformed into yeast. The second and third approaches, shown in Figs. 2B and 2C, respectively, were carried out by joining the donor bacterial genome and yeast vector using homologous recombination, within the host cell. With the second approach, the bacterial genome and yeast (host) vector were co-transformed into the yeast host cell (Figure 2B). The host vector was a linear yeast vector containing terminal regions of homology to a site in the bacterial donor genome and was thereby inserted by homologous recombination. With the third approach (Figure 2C), multiple overlapping fragments of the bacterial genome were transformed into the yeast host cell along with the yeast vector. Homologous recombination within the yeast cell effected homologous recombination, joining the fragments and yeast vector to produce a molecule containing the donor bacterial genome joined to the yeast vector (Figure 2C). A study employing each approach is described in detail below.

[0333] With each approach, the M. genitalium genome was cloned into yeast host cells. Additionally, the Mycoplasma mycoides LC and Mycoplasma pneumoniae genomes were transferred into yeast using the first approach, as shown in Figure 2A. The M. genitalium and M. mycoides LC genomes further were transferred as separate molecules (each joined with a yeast host vector) into a single yeast cell, using the first approach (Figure 2A). Example 1A

Transfer of whole Mycoplasma donor genomes into yeast host cells using integrated yeast vectors

[0334] This example describes successful cloning (transfer and propagation) of three different Mycoplasma donor genomes (M. genitalium strain MS5; M. mycoides subspecies mycoides, Large Colony strain GM12; and M. pneumoniae strain M129-B170 (ATCC 29343)) in host yeast cells, using the first approach for introduction of a donor genome into a host cell. The M. genitalium strain MS5 was a derivative of M. genitalium G37 (GenBank No. L43967). It was created by interruption of a gene in the G37 strain, as described in Dhandayuthapani et al., J Bacteriol 183, 5645 (2001). The M. mycoides subspecies mycoides, Large Colony strain GM12 (genome sequence having Genbank Accession no.

NZ_AAZK01000004.1 (GI: 149364882)) is described in DaMassa et al, Am J Vet Res 44, 322 (1983) and Lartigue et al., Science 317, 632 (2007). The M. pneumoniae strain M129- B170 (ATCC 29343) was a derivative of M. pneumoniae Ml 29, GenBank Accession Number U00089.2 (GI: 26117688).

[0335] Transfer of each Mycoplasma donor genome was carried out by inserting a yeast vector into the donor genome to generate a nucleic acid molecule containing the genome and the host vector, and then introducing that molecule into the host cell via transformation. i. Construction of tri-shuttle host vectors for cloning of Mycoplasma genomes in yeast

[0336] Two tri-shuttle yeast host vectors were designed for cloning of Mycoplasma genomes into yeast host cells using the method shown in Figure 2A. These vectors, pmycYACTn and miniTn-Puro-JCVI-1.7, are illustrated schematically in Figure 3. a. Construction of pmycYACTn vector

[0337] The vector pmycYACTn (Figure 3 A) was 10 kb in length and contained: (i) a high copy origin (ori) from pUC19 and an ampicillin resistance marker for propagation in E. coli; (ii) the IS256 transposase gene and inverted repeats for transposition into a Mycoplasma genome; (iii) tetMwA lacZ markers, both expressed from spiralin promoters, as described in Lartigue et al, J Bacteriol 164, 1094 (1985), for selection and screening in E. coli and Mycoplasmas; and (iv) an autonomously replicated sequence (ARS) and a centromere sequence (CEN), for replication and segregation in yeast; and (v) HIS3, a selectable yeast marker.

[0338] The vector was constructed from overlapping fragments, illustrated in Figure 3E (labeled as fragments 1, 2, and 4-7), using a published in vitro assembly method (Gibson et al, Science 319, 1215 (2008), U.S patent application serial number 12/247,126, and

WO09/048885, all herein incorporated by reference). Fragment 1 (1846 base pairs (bp)) contained the E. coli Ampicillin resistance (bla), pUC19 origin, which was included to facilitate high yield plasmid isolation. Fragment 2 (1256 bp) contained the Mycoplasma IS256 transposase and promoter and an IS256 inverted repeat (labeled as "3" in Figure 3E), which was included to facilitate vector insertion by transposition. Fragments 4 (2294 bp) and 5 (3335 bp) each contained the Mycoplasma Spirulin promoter, and contained Mycoplasma tetracycline resistance (tetM) and LacZ genes, respectively, which were included to facilitate selection for vector insertion into the donor genome. Fragment 5 additionally contained an IS256 inverted repeat, to facilitate insertion by transposition. Fragment 6 (847 bp) contained the S. cerevisiae HIS3 gene and promoter, which was included to facilitate selection of transformation into host cells. Fragment 7 (505 bp) contained the S. cerevisiae ARSH4 and CEN6 genes, which was included to facilitate replication and segregation. See Figure 3E.

[0339] These overlapping fragments were constructed by PCR, using the primers listed in Table 1 (Integrated DNA Technologies, Coralville, IA). In Table 1, regions of overlap with other fragments are underlined; IS256 inverted repeats (labeled as "3" in Figure 3E) are in bold type. The following plasmids were used as templates in the PCRs of individual fragments. For fragments 1, 4, and 5, the template was the pBS+ (Stratagene, San Diego, CA) portion of the pMYCOlPSlacZ plasmid, which was modified from the pMYCOl plasmid, described in Lartigue and Blanchard, et al. (2003), Nucleic Acids Res 31 (22): 6610-8. For fragment 2, the template was a 3.7 kb Pcil-Sall fragment of the pISM31.1 vector, described in Pour-El et al, Plasmid 47(2): 129-37 (2002). For fragments 6 and 7, the template was the pARS-V plasmid, described in Noskov et al., BMC Genomics 4(1): 16 (2003). Table 1: Primers for PCR of fragments used in construction of

E. coli -Mycoplasma-Ye&st shuttle vector pmycYACTn.

[0340] To produce each fragment (amplicon), PCR was carried out in a 100 μΐ. reaction volume, using 10 ng of the plasmid template. Primers indicated in Table 1, Phusion DNA polymerase, HF buffer (New England Biolabs, Ipswich, MA) were included in amounts according to the manufacturer's protocol, with extra MgCl2 added for a final concentration of 2.0 or 3.0 mM. Cycling conditions were as follows: 98°C for 30 seconds, followed by 30 cycles of incubation at 98°C for 10 sec, annealing for 30 seconds, and incubation at 72°C for 90 seconds, followed by 72°C for 5 minutes. Annealing temperatures varied among the cycles and among PCRs for different fragments, as follows. Annealing temperature was between 46°C and 59°C for cycles 1-5, and increased by 5°C (to between 51°C and 64°C) for cycles 6-30. Specifically, cycle 1-5 annealing temperatures were 56°C and 59°C for fragment 1; 46°C and 48°C for fragment 5; 46°C and 50°C for fragment 4; 46°C for fragment 2; and 48°C and 52°C for fragments 6 and 7. For cycles 6-30, each temperatures was 5°C higher than the temperature for cycles 1-5. For each fragment, PCR products were pooled and amplicons gel-purified using β-agarase (New England Biolabs, Ipswich, MA).

[0341] For fragment, 2, which contained the transposase gene, amplified from the template pISM31.1, one of the PCR primers contained the standard 20 base pairs of homology to the template at the desired location, but further contained 26 base pairs of homology to 2 additional copies of the IS256 inverted repeat, which were also present in other parts of the plasmid. In order to facilitate specific amplification of the correct fragment, these IS256 copies were separated from the desired template portion of pISM31.1 with a double restriction enzyme digest with Pcil and Sail, followed by agarose gel-purification of the correct resulting 3.7 kb fragment, which then was used as the template in the PCR amplification of fragment 2.

[0342] The purified fragments were assembled to generate the pmycYACTn vector, using the published in vitro assembly method, described in D. G. Gibson et al, Science 319, 1215- 1220 (2008), U.S Patent Application serial number 12/247,126 and WO 09/048885, all incorporated by reference herein. The entire "chew back assembly" (CBA) reaction was repaired as described (Gibson et al, Science 319, 1215-1220 (2008); U.S patent application serial number 12/247,126; and WO 09/048885) by incubating the assembly with Taq DNA ligase and Taq DNA polymerase at 45°C for 15 min in the presence of 5% PEG-8000, 50 mM Tris-Cl, pH 7.5, 10 mM MgC12, 10 mM DTT, 25 ug ml BSA, 200 uM each dNTP, and 1 mM NAD. The reaction was then was phenol extracted, isopropanol precipitated, resuspended, and electroporated into EPI300 cells (Epicentre Biotechnologies, Madison, WI).

Transformants were selected with carbenicillin. DNA from selected clones was screened for the correct sized plasmid using three separate restriction digests. The presence of the various elements of the plasmid was tested phenotypically, as follows. Propagation in E. coli ensured functionality of the pUC19 origin; selection in E. coli with carbenicillin and tetracycline and screening with X-gal verified that intact copies of the bla, tetM, and lacZ markers were present; and successful transformation of yeast with the isolated vector demonstrated that the HIS3, ARSH4, and CEN6 markers were viable. Presence of a functional transposon was confirmed by transformation into Mycoplasma, as described below. b. Construction of miniTn-Puro-JCVI-1.7 vector

[0343] The miniTn-Puro-JCVI-1.7 vector (Figure 3B) was 14 kb in length, and was identical to the pmycYACTn, with the following exceptions: (i) it did not contain lacZ; (ii) instead of a tetM marker, it contained a puromycin resistance marker; and (iii) it contained a bacterial artificial chromosome (BAC) vector. ii. Insertion of host vectors into donor genomes

a. M. genitalium MS5

[0344] In preparation for transfer of the M. genitalium strain MS5 donor genome into yeast host cells, the vector pmycYACTn vector was inserted into the donor genome by electroporation into the M. genitalium donor cells, as described in J. I. Glass et ah, PNAS USA 103, 425 (2006). Transformants were selected by growth in the presence of tetracycline and a single clone chosen for further analysis. Direct genomic sequencing (as described in J. I. Glass et ah, PNAS USA 103, 425 (2006)), using primers internal to the vector, was performed to determine the site of vector insertion. The chosen clone contained the sequence between and including the two IS256 inverted repeats of pmycYACTn, indicating that transposition had occurred, as designed (Figure 3C). The transposase, pUC19 origin, and ampicillin resistance gene were lost during transposition. The host vector inserted into the donor genome within the nonessential MG411 gene (J. I. Glass et ah, PNAS USA 103, 425 (2006); C. A. Hutchison et ah, Science 286, 2165 (1999)). b. M. mycoides subspecies mycoides, Large Colony strain GM12

[0345] In preparation for transfer of the M. mycoides subspecies mycoides, Large Colony strain GM12 genome into yeast hosts, the Mycoplasma donor cells were transformed with pmycYACTn using PEG, as described in K. W. King and K. Dybvig, Plasmid 26, 108 (1991). Transformants were selected by growth on plates supplemented with tetracycline.

[0346] Four selected clones were analyzed by direct genomic sequencing to locate the site of insertion of the host vector into the donor genome. The results revealed that in each of the four clones, instead of integration of a portion of the pmycYACTn construct by transposition, the entire host plasmid had integrated into the donor genome. In three of the four clones, the vector (pmycYACTn) had been inserted by a crossover event within or very close to the pUC origin. In the fourth clone, the crossover had occurred within the yeast HIS3 gene, and thus was not used for subsequent transformation of the genome into yeast. In all cases, insertion of the host vector had occurred at a location adjacent to an IS 1296 element.

[0347] Clone 1.1, which is illustrated schematically in Figure 3D, grew robustly. To confirm that the genome of this clone could be efficiently transplanted, the calcium chloride transformation procedure described in C. Lartigue et al, Science 317, 632 (2007) was carried out to transplant it from the M. genitalium donor cells into M. capricolum recipient cells. The genome of clone 1.1 was efficiently transplanted into M. capricolum host cells. Thus, this clone was chosen for genome transfer from donor Mycoplasma into yeast host cells. c. M. pneumoniae strain M129-B170 (ATCC 29343)

[0348] In preparation for transfer of the M. pneumoniae strain M129-B170 donor genome into yeast host cells, the Mycoplasma were transformed with MiniTn-Puro-JCVI-1.7 by electroporation as described in J. I. Glass et al, PNAS USA 103, 425 (2006). A pool of puromycin resistant transformants was selected in liquid culture. iii. Isolation of donor genomes containing inserted yeast vectors

[0349] In order to minimize breakage, the donor genomes containing yeast vector insertions were isolated in agarose plugs using low melting point agarose and the Bio-Rad CHEF Mammalian Genomic DNA Plug Kit (Bio-Rad Laboratories, Hercules, CA), following the protocol suggested by the manufacturer. Agarose plugs containing the Mycoplasma genomes with insertions were dialyzed against 10 mM Tris pH 8.0 (in some cases with 1 mM EDTA) for 1 hour. Plugs were then dialyzed against 10 mM (6%) PEG 6000 (United States Biochemical), 0.6 M NaCl for several hours, as described in S. Katsura et al, Electrophoresis 21, 171 (2000). This PEG/NaCl treatment was not carried out for isolation of M. mycoides LC genomes containing vector for transfer into W303a cells (see below), or for isolation of M. pneumoniae genomes containing vector for transfer into VL6-48N cells (see below).

[0350] Plugs then were melted at 65°C for 5 min, after which 2 volumes of 65°C TE was added and the mixture was stirred gently and incubated at 65 °C a further 5 min. Twenty microliters were used for transformation. iv. Transfer of donor genome with yeast vector into yeast host cells

[0351] For introduction of the donor genomes into host cells, yeast spheroplasts were transformed with DNA from the plugs, using the published method described by N. Kouprina and V. Larionov, Nat Protoc 3, 371 (2008), except that cultures were sometimes grown to less than the recommended OD.

[0352] Using this method, all three genomes containing yeast vector inserts were transformed into the yeast strain VL6-48N, developed for high transformation efficiency (V. Larionov et al., PNAS USA 94, 7384 (1997)). The M. genitalium cll6-2 and M. mycoides LC ell .1 genomes with inserts also were transformed into the commonly used W303a strain (MATa his3 leu2 ura3 trpl ade2). The M. mycoides LC cll.l genome with insert also was transferred into a recombination-deficient yeast strain, VL6-48-A54G, which is defective in the RAD54 gene (MATa his3-A200 trpl-ΔΙ ura3-52 lys2 ade2- 101 metl4 rad54-Al::

kanMX). Transformation into the VL6-48-A54G strain was done to address the possibility that the genome would be unstable in other yeast, due to recombination among the multiple nearly-identical 1.5 kb IS 1296 copies. Yeast strains defective in the RAD 54 gene can decrease the occurrence of a variety of recombination events in yeast artificial chromosomes (YACs) (Y. Le and M. J. Dobson, Nucleic Acids Res 25, 1248 (1997)). The rad54 mutant strain, which was nearly isogenic with VL6-48N, was a gift from Vladimir Larionov

(Laboratory of Molecular Pharmacology, National Cancer Institute, National Institutes of Health). v. Analysis and confirmation of whole genome transfer

[0353] DNA from each of the transformed yeast host cells was analyzed to confirm transfer of complete host vector-containing donor genomes into the host cells. Mycoplasma genomes cloned in yeast were screened by multiplex PCR (MPCR) to confirm completeness. MPCRs were carried out using 1 or 2 sets of 10 amplicons each, using primers from IDT with the Multiplex PCR Kit from Qiagen (Valencia, CA). Individual reactions are described in more detail below.

[0354] To confirm the size of genomes containing inserts, total DNA from individual yeast clones containing Mycoplasma genomes was isolated and analyzed by gel

electrophoresis as described below. In general, DNA was isolated in agarose plugs using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF-DR III manual. Where indicated, plugs were pre-electrophoresed at constant voltage for several hours to remove yeast chromosomal DNA. Where indicated, to increase the efficiency of this step, plugs were first digested with AsiSI, Fsel, and RsrII, which cleave yeast chromosomes but do not have recognition sites in M. genitalium or M. mycoides LC. Isolated DNA was subject to restriction digestion (with indicated enzyme(s)), followed by field-inversion (Bio- Rad FIGE Mapper) or pulsed-field (Bio-Rad CHEF-DR II or III system) electrophoresis, as indicated, or linearization by heating at 55 °C for 1 hr. Where indicated, Southern blots were performed on the gels. Southern blotting was carried out as described in D. G. Gibson et al, Science 319, 1215 (2008), except in some cases where probe labeling and detection used the Amersham AlkPhos Direct Labeling and Detection System with CDP-Star (GE Healthcare, Piscataway, NJ). a. Isolation and analysis of M. genitalium genomes from yeast host PCR

[0355] Genomic DNA from 24 individual clones recovered after transfer of M. genitalium cll6-2 genomes containing yeast vectors to strain VL6-48N and 8 individual clones recovered after transfer of M. genitalium into the W303a strain was isolated in agarose plugs and analyzed by PCR to confirm completeness. An M. genitalium synthetic genome (sMgTARB AC37, generated as described in (D. G. Gibson et al, Science 319, 1215 (2008)) and a native M. genitalium genome were used as positive controls.

[0356] The PCR primers listed in Table 2, below, were used in MPCR reactions to generate amplicons evenly spaced around the M. genitalium genome containing the yeast vector insert. The locations of the amplicons along the length of the genome are shown in Figure 4A, in which amplicons are indicated with black bars and numbers representing sizes of the amplicons. The results of the PCR for DNA recovered from clones in VL6-48N and W303a (data not shown) are summarized in Table 5. Twenty-two (22) of the 24 clones isolated from the 24 VL6-48N strain and 5 of the 8 clones isolated from the W303a strain appeared complete (correctly sized product for each amplicon) by PCR analysis (data now shown).

Table 2: genitalium Multiplex PCR Primer Sequences (Set 1)

Amplicon

Forward Primer Reverse Primer size (bp)

TTTTTGTTTGGTGCTAAT CAATTTTCTATAAGCGTTGC

400

(SEQ ID NO: 19) (SEQ ID NO:20)

TGGGGATACTGAAAATATTAC CTGAAATGATCCCTTTAA

500

(SEQ ID NO:21) (SEQ ID NO:22)

AAAAACAAGCTTTACAAGAG CATCTTGATCCAACTTATTTA

600

(SEQ ID NO:23) (SEQ ID NO:24)

AGCTATTGGTCCTGAAACAC ACCCCTTTTTTTGCTAAAAGG

700

(SEQ ID NO:25) (SEQ ID NO:26)

TTAACTTCGTTAAAAGTGAAT AATGGATTACTAATGAGCTTG

800

(SEQ ID NO:27) (SEQ ID NO:28)

ATCCAGTAAAAACCTTGA AAATGATTTTATTGCTGTTAC

900

(SEQ ID NO:29) (SEQ ID NO:30)

TTTGCGTTCCTTAGCACG TATAAAACAACAATTACTGAAG

1000

(SEQ ID NO:31) (SEQ ID NO:32)

Size analysis

[0357] To confirm that the M. genitalium cll6-2 genomes containing yeast vectors in the complete clones from the VL6-48N strain were the correct size, CHEF gel analysis was performed on 3 clones (11, 16, and 24) that were deemed complete by the MPCR. For this process, DNA was isolated from the clones in agarose plugs, using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF-DR III manual. To remove chromosomal DNA, plugs were pre-electrophoresed at constant voltage for several hours to remove yeast chromosomal DNA. To increase the efficiency of this step, the plugs were first digested with AsiSI, Fsel, and RsrII, which cleave yeast chromosomes but do not have recognition sites in M. genitalium.

[0358] After pre-electrophoresis, DNA was digested with either Eagl or BssHII. The fragments of the M. genitalium genome with vector insert that are produced by these enzymes and their sizes are indicated on the map in Figure 4A and in columns next to the map. The digested DNA was separated by field-inversion (Bio-Rad FIGE Mapper) gel electrophoresis. The results are summarized in Table 5 (gel not shown). Two of these three clones (11 and 16) were the expected size.

[0359] To confirm that the M. genitalium cll6-2 genomes containing yeast vectors in the complete clones from the W303a strain were the correct size, CHEF gel analysis was performed for 5 complete clones. For this process, DNA from these clones was isolated in agarose plugs as described for the VL6-48N strain above, with pre-electrophoresis for several hours at constant voltage to remove yeast genomes, as described above. Isolated DNA then was linearized with Eagl.

[0360] Samples were separated by pulsed-field electrophoresis. The synthetic

sMgTARBAC37 genome (see above) was cut with Notl and used as a positive control. The results are summarized in Table 5 (gel not shown). Four of the five clones were of the expected size; clone 4 contained a faint extra band of about 300 kb. b. Isolation and analysis of M. mycoides cll.l from yeast hosts by PCR

[0361] Genomes isolated from 48 individual clones recovered after transfer of M.

mycoides LC cll.l genome containing yeast vector insert to strain VL6-48N were analyzed by multiplex PCR, as described above, to confirm completeness. DNA was isolated from the clones in agarose plugs, using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF-DR III manual.

[0362] The PCR primers listed in Table 3 were designed and used to generate amplicons to assess completeness of the transferred M. mycoides genomes. As shown in Figure 5, an amplicon was located between most pairs of IS 1296 elements, indicated by arrowheads on the map of the genome with insert illustrated in Figure 5. An additional 230 bp amplicon was a region of the HIS3 marker of the yeast vector. Another primer set (NSF1179/18 and NSR1642/16; see Table 3) produced a 464 bp amplicon (region of S. cerevisiae rDNA), and was used as a positive control for the assay. The sets of primers and sizes of amplicons produced thereby are listed in Table 3.

[0363] A similar result was obtained with multiplex PCR analysis of M. mycoides LC cll.l genome containing yeast vector insert transformed into the Δ54 recombination-deficient strain (gel not shown).

[0364] Multiplex PCR analysis of DNA from W303a cells transformed with M. mycoides LC ell .1 genome containing yeast vector insert revealed that eight of 15 clones were complete (gel not shown).

Table 3: M. mycoides LC Multiplex PCR Primer Sequences

Amplicon

Forward Primer Reverse Primer

size (bp)

Size analysis

[0365] To confirm that the M. mycoides ell .1 genomes containing yeast vectors in the complete clones from the VL6-48N strain were the correct size, Southern blot analysis of a CHEF gel analysis was performed for 6 of the complete clones, revealing that five of the six were the correct size.

[0366] A CHEF gel analysis of three of these five clones recovered after transformation of the VL6-48N strain with M. mycoides cll.l genomes containing yeast vectors was performed as follows: DNA from clones (07, 14, and 38) was isolated in agarose plugs as described above, without pre-electrophoresis. The isolated DNA was digested with BssHll and then separated by pulse-field gel electrophoresis (CHEF). For each clone, the parent clone and 3-4 subclones were analyzed (gel results not shown). Markers and controls used in the analysis were: (1) Low Range PFG Marker (New England Biolabs, Ipswich, MA); (2) S. cerevisiae marker (Bio-Rad); VL6-48N (undigested (3) and ifosHII-digested (4)); and M. mycoides LC cll.l (undigested (5) and IfasHII-digested (6)). Results indicated that all three clones were the correct size and were stable. [0367] A CHEF gel analysis was performed on eight complete clones recovered after transformation of the W303a cells with M. mycoides LC ell .1 genome containing yeast vector insert to confirm size. For this process, DNA from the clones was isolated in agarose plugs as described above, with pre-electrophoresis as described above to remove yeast genome. DNA was either left untreated (-) or digested (+) with BssHII. DNA then was separated by pulsed-field gel electrophoresis. M. mycoides LC cll.l DNA was run as a positive control. Results are summarized in Table 5 (gel results not shown). The results indicated that each of the eight clones contained the correct size genome. c. Isolation and analysis of M. pneumoniae from yeast hosts by PCR

[0368] Genomes isolated from 20 individual clones recovered after transfer of M pneumoniae genomes containing yeast vectors to strain VL6-48N were analyzed by multiplex PCR as described above to confirm completeness. Two different multiplex PCRs were performed. Primers for set 1 and set 2 and the size of amplicons produced thereby are listed in Table 4 (gel results not shown). As shown in Figure 4 A, amplicons (indicated with black bars and numbers; inside: set 1, outside: set 2) were evenly spaced around the M. pneumoniae genome containing the vector insert. The results indicated that thirteen of the twenty transformants were complete.

Table 4: M. pneumoniae Multiplex PCR Primer Sequences

Size analysis

[0369] CHEF gel analysis was performed on nine of these complete transformants. For this process, DNA from these clones was isolated in agarose plugs using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF-DR III manual. To remove chromosomal DNA, plugs were pre-electrophoresed at constant voltage for several hours to remove yeast chromosomal DNA. The DNA then was digested with NotI or Sbfl. The fragments (numbered 1-6) of the M. pneumoniae genome with vector insert that are produced by these enzymes are indicated on the map in Figure 4B, with the fragments and their sizes listed in columns next to the map.

[0370] The digested DNA was separated by pulsed-field electrophoresis (Bio-Rad CHEF- DR II or III system). The results are summarized in Table 5 (gel results not shown).

Restriction fragments are numbered as in Figure 4B. Yeast clone 8 was not completely digested (data not shown). [0371] Table 5 summarizes results from Example 1(A), in which three Mycoplasma genomes containing integrated yeast vectors were transferred into yeast. Clones were screened for completeness by multiplex PCR with 1 or 2 sets of 10 amplicons each. Clones were tested for size by restriction digestion and gel electrophoresis, followed in some cases by southern blot.

Table 5: Cloning 3 Mycoplasma genomes containing an integrated yeast vectors in yeast

Example IB

Transfer of the M. senitalium genome to yeast host cells by homologous recombination of whole genome and yeast host vector.

[0372] The linearized, whole M. genitalium genome was transferred into yeast cells using the method depicted in Figure 2B, by homologous recombination of the genome with a yeast vector within the host cells. The M. genitalium genome contains 3 single-cut restriction sites, 2 of which lie within its rRNA operon. The third lies at the 3' end of a tRNA coding sequence. Because the cloning could be designed to preserve the integrity of the tRNA, a vector was inserted by homologous recombination adjacent to this Ascl site. [0373] The yeast cloning vector pARS-VN (described in V. N. Noskov et al. , BMC Genomics 4, 16 (2003)) was used as template for PCR with a pair of primers, each containing 60 bp homologous to the region flanking the insertion site in the M. genitalium genome, and 20 bp of homology to the vector. Primers were supplied by IDT PAGE-purified. Their sequences are as follows, with the vector sequence in bold and the Clal (first primer) or Xhol (second primer) site underlined:

[0374] TTAATAACAAAAAAATCTCTATTAAAAAAACCAACTTTAAAGTTGGTTT GAAATTCTAAA ATCGATGTCGAAAGCTACAT (SEQ ID NO:97) and

[0375] GGATAGAGTGTCTGGCTTCGGACCAGAAGGTTATGGGTTCAAGTCCTAT TGGGCGCGCCA CTCGAGCCACTATTTATACC (SEQ ID NO:98).

[0376] PCR of the vector with these primers amplified the entire vector except for 9 bp between the unique Clal and Xhol restriction sites, producing a 6.5 kb product.

[0377] A mixture of this linear vector DNA and DNA from M. genitalium strain MS5 was prepared for co-transformation into yeast strain VL6-48N spheroplasts. M. genitalium DNA was isolated in agarose plugs, as follows, to minimize breakage. M. genitalium genomic DNA was isolated in two batches in low melting point agarose plugs from strain MS5 grown in SP-4 medium. The culture for batch 2 was supplemented with gentamicin to 200 μg/ml. Adherent cells were rinsed twice with PBS and then scraped into a buffer containing 8.0 mM HEPES, pH 7.4, 272 mM sucrose, and 10% glycerol. Each plug contained DNA from about 6 (batch 1) or 10 (batch 2) cm2 of confluent cells. For lysis, cells in agarose were incubated for a period between overnight to 2 days at 50°C in 0.4 M EDTA, 0.4% N-lauroyl sarcosine, and 2 mgs/ml proteinase K, followed by a buffer change and a second treatment under the same conditions for the same time range. Plugs were dialyzed thoroughly against 10 mM Tris, 50 mM EDTA, then dialyzed 2 times for 2 hours each in 10 mM Tris, 50 mM EDTA

supplemented with PMSF to 0.1 mM, and then re-dialyzed and stored in 10 mM Tris, 50 mM EDTA.

[0378] Before transformation, the plugs were melted and digested with agarase, as follows. The first batch of plugs was electrophoresed twice by CHEF (Bio-Rad), which removed broken DNA, while leaving circular genomes intact (to increase the frequency of intact circular genomes in the plugs). The first electrophoresis was carried out on a 1% pulsed-field agarose gel, with 0.5X TBE and a 50-90 second switch time, over 20 hrs. The second electrophoresis was carried out on a 1% low melting point gel, with IX TAE and a 60-120 sec switch time, over 24 hrs. Both gels were run at 120°, 6 V/cm, at 14°C. Three plugs from each of the two batches were dialyzed thoroughly against sterile IX TAE, melted for several minutes at 73°C, equilibrated to 42°, then digested with β-Agarase I (New

England Biolabs, Ipswich, MA) for 1.5 hrs. One-half of each volume was moved to a fresh Eppendorf tube. Prior to transformation, the genomes were digested overnight at 37°C with 20 U Ascl (in IX NEB buffer 4; New England Biolabs, Ipswich, MA), which resulted in a double-strand break near the site of intended recombination with the host vector, as illustrated in Figure 6A.

[0379] For introduction of the donor genomes (by co-transformation with yeast vector) into host cells, yeast spheroplasts were transformed with DNA from the plugs, using the published method described by Kouprina and Larionov, Nat Protoc 3, 371 (2008), except that cultures were sometimes grown to less than the recommended OD. With this published method, as described above, yeast cells were suspended in 1M sorbitol and treated with Zymolyase™ (β-l, 3-glucan laminaripentaohydrolase) before transformation to remove cell walls. DNA recovered from agarose plugs was incubated with the spheroplasts. After recovery in growth medium, cells were plated in selective medium.

[0380] Clones were picked and evaluated by multiplex PCR and gel electrophoresis as described in Example 1 A(v)(a), above, except that two sets of 10 amplicons, instead of one set, were used. The primers used to generate the first set of amplicons were those listed in Table 2, above. The primers used to generate the second set of amplicons, and the sizes of amplicons produced thereby, are listed in Table 6, below.

Table 6: M. genitalium Multiplex PCR Primer Sequences (Set 2)

Amplicon

Forward Primer Reverse Primer size (bp)

146 bp: TTTCTATGAACTACATGATCTT GTTGTAGAATTGCCAGGT

(SEQ ID NO:99) (SEQ ID NO: 100)

250 bp: AAGGGAAGGATAGTAGTGGG AGGTGTTGGTGGTTTGGT

(SEQ ID NO:101) (SEQ ID NO: 102)

348 bp: TAAGACTTGGCAAGGTAG TCTTGATAGGAAAGTCCT

(SEQ ID NO: 103) (SEQ ID NO: 104)

[0381] Transformation with Ascl-digested DNA yielded forty-five transformants. All of these were examined by multiplex PCR, with the primers to produce the twenty amplicons as discussed above (Table 2, Table 6). Twenty-one appeared to be complete. These twenty-one transformants were examined by Southern Blot of a CHEF gel and fifteen appeared to be the correct size. Transformation with undigested M. genitalium genomes yielded fifty

transformants. All of these were examined by the same multiplex PCR, and seven appeared to be complete. One of these was the correct size. These results demonstrate successful transfer of a whole donor Mycoplasma genome by digestion with a restriction enzyme at the recombination site and co-transformation with a yeast host vector, followed by in vivo recombination within the yeast host cell.

Example 1C

Transfer of M. eenitalium genome to yeast host cells by assembly of overlapping fragments of genome and yeast host vector by in vivo recombination in yeast host cells

[0382] This example describes successful transfer to and propagation of M. genitalium donor genomes in yeast host cells, using the method illustrated in Figure 2C. In this method, genomes are assembled in the host cell (yeast) by homologous recombination of multiple overlapping fragments of the genome. [0383] This strategy has been performed using pieces derived from E. coli BAC clones {See Gibson et al, Science 319, 1215 (2008), including supplemental online materials;

Gibson et al. , PNAS USA, (2008) 105:20404-9; and U.S. Patent Application, publication No. 12/247,126, naming as inventors: Gibson et al).

[0384] In the present study, a synthetic M. genitalium genome was assembled from six pieces, using the first published method described above (the multi-stage process described in Gibson et al, Science 319, 1215 (2008) and supplemental online materials), by first generating quarter-genomes (approximately 144 kb each) by three stages of assembly using in vitro recombination and cloning in E. coli using BAC vectors. These four "quarter genomes" (1-4) are illustrated in Figure 6B.

[0385] Isolation of genomic DNA from host yeast cells was carried out as described in Example 1 A, without pre-electrophoresis and without digestion with yeast-specific enzymes to deplete yeast genomic DNA. Samples were analyzed using CHEF analysis, as described above. Southern blots also were performed (data not shown).

Table 7: Primers for analyzing M. genitalium genome transfer to yeast cells using homologous recombination using overlapping fragments

[0386] The results revealed that 6 of these transformants contained the correct sequences. With the non-digested samples, only two transformants were obtained, neither of which showed a complete M. genitalium genome in the PCR and southern analyses. Another study was performed, using the same process as described above, except that instead of Ascl- digestion, quarter 3 was cut at the unique BsmBI site in that quarter. The same transformation and analysis methods were used. The study with BsmBI digestion produced 73 transformants, 44 of which were correct when assayed by PCR. Five (5) out of 28 of these clones examined by Southern Blot were correct. These results revealed that this method for transferring donor genomes into yeast host cells (by in vivo recombination of overlapping fragments and vectors within the host) is more efficient when one of the fragments is cut with a restriction enzyme prior to transformation, likely due to higher efficiency of homologous recombination at DNA ends (Orr-Weaver et al, PNAS USA 78, 6354 (1981).

Example ID

Construction of a diploid yeast strain carrying two donor Mycoplasma genomes

(M. senitalium and M. mycoides)

[0387] This example describes production of a diploid yeast host strain, carrying two donor Mycoplasma genomes that were transferred in using the method depicted in Figure 2A (see Example 1 A, above). For this process, two haploid strains were crossed as described in D. C. Amberg et al. , Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, ed. 2005, 2005), pp. 230, each of which carried one of the genomes.

[0388] The W303a strain (mating type a) containing the M. genitalium cll6-2 was mated with the VL6-48 strain (mating type a) containing M. mycoides LC cll.l (see Example 1 A and Table 1, above). Prior to mating, the HIS3 marker in the M. genitalium genome was replaced with a TRP marker, as follows, to allow selection of diploids carrying both genomes on medium lacking histidine and tryptophan.

[0389] For replacement of the HIS3 marker with TRP1 , a 1059 bp TRP1 fragment was amplified by PCR from the plasmid pRS304 (described by Sikorski and Hieter, Genetics 122, 19 (1989), Genbank Accession No. U03436.1, gi number 416305). The fragment, which had homology to M. genitalium MS 5 cll6-2, was amplified from the plasmid using primers with the following sequences:

TACGAGGCGCGTGTAAGTTACAGGCAAGCGATCCTAGTACACTCTATATCAG

AGCAGATTGTACTGAGAGTGCACC (SEQ ID NO: 131) and CTACATAAGAACACCTTTGGTGGAGGGAACATCGTTGGTACCATTGGGCGC

GCATCTGTGCGGTATTTCACACCGC (SEQ ID NO: 132).

[0390] In each primer sequence, the portion homologous to the M. genitalium cll6-2 sequence is in bold. The 1059 bp fragment was transformed into yeast using lithium acetate, using techniques described by Gietz et al, Nucleic Acids Res 20, 1425 (1992).

[0391] Replacement of HIS3 with TRP1 was confirmed by amplification with two primers (sequences: ATTATTCCATCATTAAAAGA (SEQ ID NO: 133) and

AGTCAAGTCCAGACTCCTGT (SEQ ID NO: 134)), amplification with which produced a 1207 bp fragment when HISS is replaced with TRP1 and a 927 bp fragment when

replacement has not occurred. The results revealed correct replacement.

[0392] After replacement, the haploid strains carrying the two different donor genomes were crossed as described by Amberg et al. , Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, ed. 2005), pp. 230. Following cross, DNA from individual clones was isolated in agarose plugs using the protocol "Preparation of Agarose Embedded Yeast DNA" from the Bio-Rad CHEF-DR III manual. Plugs were preelectrophoresed at constant voltage for several hours to remove yeast chromosomal DNA. Isolated DNA was subject to linearization by heating at 55°C for 1 hour; control samples were left unheated (data not shown). The results demonstrated that five out of five diploids generated in this study contained both M.

genitalium and M. mycoides genomes, confirming successful generation of a diploid yeast host cell containing two full donor Mycoplasma genomes of different species.

Example IE

Maintenance of a Mycoplasma donor genome in yeast host cells

without the presence of an ARS sequence.

[0393] The yeast vector in the synthetic M, genitalium genome generated as described by Gibson et al, Science 319, 1215 (2008) and in Example 1C, above, was transferred from its original site within the RNaseP gene to a new site in MG411 so as not to interrupt an essential gene. For this process, the yeast clone containing the synthetic M. genitalium as described in Example 1C5 above, was co-transformed with two (2) fragments. The first fragment, which was 1842 bp in length, inserted yeast vector sequence containing URA3, the GAL1 promoter, and a centromere into MG411. This fragment was generated by PCR using primers with the sequences:

CAGATGGTATTCCTGAAAGGATATCAATAATAAGTGAAAGTTTTTTTCTTATT

TTTGGTTGCGGCCGCTTGATTTCGGTTTCTTTGAAAT (SEQ ID NO:135) and

TTAATTATTGCTAGTTATATAGGGGTTAGAACTTCATTTTTCCTTGTTTATCG

AT GCAGCGGCCGCGGGTCCTTTTCATCACGTG (SEQ ID NO: 136)

(M genitalium sequence is in bold; NotI sites are underlined). The template for this PCR was a construct having the sequence provided in SEQ ID NO: 137 (Table 8).

Table 8. Sequence of PCR template for generating yeast vector sequences

TTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTAATCTCCGAA.CAGAAGGAAGAACGA AGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAA ATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAAT CATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAG CTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCA CCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACA TGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCC GCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCA AATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACA CGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAG GAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAG AATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTAT TGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGT GTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGG TCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGC TAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGC CAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAG CTTCAATTTAATTATATCAGTTATTACCCACGGATTAGAAGCCGCCGAGCGGGTGACAGCC CTCCGAAGGAAGACTCTCCTCCGTGCGTCCTCGTCCTCACCGGTCGCGTTCCTGAAACGCA GATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACTAGCTTTTATGGT TATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATGAACGAATCAAAT TAACAACCATAGGATGATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCA GCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGCAAAAACTGCATTAA.CCACT TTAACTAATACTTTCAACATTTTCGGTTTGTATTACTTCTTATTCAAATGTAATAAAAGTA TCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACCGGCCTGA GAGCAGGAAGAGCAAGATAAAAGGTAGTATTTGTTGGCGATCCCCCTAGAGTCTTTTACAT CTTCGGAAAACAAAAACTATTTTTTCTTTAATTTCTTTTTTTACTTTCTATTTTTAATTTA TATATTTATATTAAAAAATTTAAATTATAATTATTTTTATAGCACGTGATGAAAAGGACCC

(SEQ ID NO: 137)

[0394] The second fragment was 302 bp in length, having the following sequence:

TTAAAGTCAGTTATTTATCTACAGCAATTGCTGTCATTACTTTAATTATTTGTTCTT AAAGCAACATTCCCTTACCAAAATTTAGGTTTCTTGCTTGTGGAGTTTACCGCGTT TCATACCTGGTTTTCACCAAGCTCGTCTCTGTGGCACTTTCAAAACATCATCATAG TATTAACCTTAGACTAGTTATGTCGTTATGGCTATCACATCCTAAATCTTATCGCT TTGATTTACACAAACACTACTTGCATTCCAGCAAGTGCAAGCATGGACTTTCCTC TACTTTAAATATATCTTTAAAG (SEQ ID NO:138). This fragment was used to replace the yeast vector insertion in RNaseV with M. genitalium sequence such that the coding region of this gene was restored. This fragment was generated by PCR from M. genitalium DNA using primers with the sequences TTAAAGTCAGTTATTTATCTACAGC (SEQ ID

NO:139) and CTTTAAAGATATATTTAAAGTAGAGG (SEQ ID NO:140).

[0395] Before cotransformation, TRP1 was inserted into MG411, as follows: an 1177 bp TRP1 gene fragment with homology to MG411 was amplified from the plasmid pRS304 (Genbank Accession No. U03436.1, gi number 416305), using two primers with the following sequences:

CAGATGGTATTCCTGAAAGGATATCAATAATAAGTGAAAGTTTTTTTCTTATT

T TTGGTTCAGAGCAGATTGTACTGAGA (SEQ ID NO: 141) and

TTAATTATTGCTAGTTATATAGGGGT

TAGAACTTCATTTTTCCTTGTTTATCGA TGCACGCATCTGTGCGGTATTTCA

(SEQ ID NO: 142). In each primer, portions of homology to M. genitalium genome are set forth in bold. TRP1 gene insertion was confirmed by PCR using a set of primers (sequences GCCATTGTTTCACTAATTGC (SEQ ID NO: 143) and TAATCCTATCTTTGGAGCTT (SEQ ID NO: 144)) that amplified 1739 bp (if insertion occurred) and 680 bp if it did not. Cotransformants, which were His- Trp- Ura+, were selected. Restoration of RNase? was confirmed by PCR amplification of a 513 bp product using primers with sequences CTCCATCATGCGCAGTAATA (SEQ ID NO:145) and CTTTAAA

GATATATTTAAAGTAGAGG (SEQ ID NO: 146). Replacement of TRPl with yeast vector sequence was confirmed by PCR amplification of an 1841 bp product using primers with sequences TTGATTTCGGTTTCTTTGAA (SEQ ID NO: 147) and

CAGGCAGGAATTTGATTCCC (SEQ ID NO: 148).

[0396] The vector inserted in the new site did not contain an ARS. The results of these studies confirmed that the vector containing the M. genitalium donor genome did not require the presence of the ARS sequence for maintenance in yeast host cells. The M. genitalium is AT-rich and thus is likely to contain sequences that can function as ARS in yeast. ARS-like sequences are frequent in eukaryotic AT-rich DNA (See Montiel et al, Nucleic Acids Res 12, 1049 (1984); Stinchcomb et al., PNAS USA 77, 4559 (1980)).

[0397] Collectively, the studies described in this Example confirm that three different whole donor Mycoplasma genomes (the largest being 1.1 MB in size) were successfully transferred, propagated and maintained in yeast host cells, using the provided methods. In each case, complete clones were recovered and no sign of instability was detected.

Additionally, in several of the studies, molecules as large as about 2 MB were recovered and detected by Southern blotting. These molecules likely represented clones of concatamers, and reveal that the provided methods can be used to clone and transfer larger genomes and nucleic acid molecules into yeast host cells. Such methods can be used to generate host cells containing donor genomes, which then can be propagated and modified in the host cells and transplanted into recipient cells using the provided methods.

Example IF

Stability and evaluation of the M. mycoides MCpMmycl.l genome during propagation in yeast

[0398] The stability of the M, mycoides YCPMmycl .1 geneome during propagation in yeast was assessed. Figure 18 A provides a schematic of the YCpMmycl .1 genome and the position of the integrated YCp is shown. The nine (9) individual primer pairs used in the PCR amplifications are shown at their approximate locations in the genome and are numbered corresponding to the amplicons in Figure 18B. The stability of the M. mycoides genome during propagation in yeast was tested by two methods. In the first, a yeast culture of a clone containing the genome was plated on solid synthetic media lacking histidine for two days and then indivisual colonies were patched onto a new plate. In the second, a yeast culture of a clone containing the genome was grown to saturation, diluted to a 1/100 fraction and again grown to saturation. The culture was then plated on solid synthetic media lacking histidine for two days and then individual clones were patched onto a new plate. In both methods, genomic DNA was isolated and used as template in multiplex PCR amplification using the nine individual primer pairs shown in Figure 18 A. The resulting amplicons were analyzed by gel electrophoresis. The numbers on the right side of the gel correspond to the individual primer pair amplicons as shown in Figure 18B. Lane G is a positive control and lane N is the no-genome negative control. Molecular weight markers are shown in lane M. The results shown are representative of the 40 samples analyzed. All 40 clones appear to contain complete genomes, demonstrating that the bacterial genome is stable during routine propagation in yeast (Figure 18B).

[0399] The M. mycoides YCP genomes in yeast manipulated at the type III restriction enzyme locus was evaluated. A schematic of the M. mycoides YCpMmycl.l genome is shown in Figure 18C; the position of the integrated YCp is shown. The 9 individual primer pairs used in the PCR amplifications are shown at their approximate locations in the genome and are numbered corresponding to the amplicons (gel results not shown). The diagonal line in Figure 18C represents the missing amplicons in clone 3 (gel results not shown). After transformation of a mycoides YCpMmycl .l yeast clone with a cassette containing URA3, genomes of Ura+ clones were evaluated by multiplex PCR and the resulting amplicons were analyzed by gene electrophoresis (gel results not shown). Amplicons 5 to 8 were missing in Clone 3, suggesting that there is a large deletion in this genome. The other four clones appeared to contain complete genomes.

EXAMPLE 2

Transplantation of whole Mycoplasma donor genomes, propagated in yeast host cells, into Mycoplasma recipient cells

[0400] Provided are methods for transfer of large nucleic acids, such as genomes, are transferred among different organisms and cell types (e.g., donor, host, and recipient), which can be of different species, kingdoms, and/or orders (e.g., different bacterial species and bacterial versus eukaryotic yeast cells). Thus, in some embodiments, the methods include steps for overcoming potential incompatibilities among the different cell types, such as methods for successfully transplanting into recipient cells donor genomes that have been propagated in host cells.

[0401] Example 3, below, describes the successful transplantation of a whole donor genome ( mycoides LC (Genbank accession NZ_AAZK00000000.1 (GI: 149364883), which had been propagated in yeast host cells, into recipient cells of a different species (M capricolum), using the provided methods. This Example describes analysis of differences among these three different organisms (donor, host, and recipient), and the development of various processes that can be used to overcome these differences using the provided methods.

[0402] Example 2B demonstrates that sufficient amounts of purified, intact donor

Mycoplasma genomic DNA can be recovered from yeast host cells for transplanting into the recipient cells. Example 2C demonstrates a provided transplantation method for transplanting native bacterial donor genomes into recipient cells with high efficiency. Example 2D describes evaluation of restriction-modification systems (not present in yeast) in the host and recipient cells, and of methyltransferase (which are expressed in yeast) expression and effects of methyltransferases on the donor genomes and activation. Example 2E describes treatments used in the provided methods to overcome host-donor-recipient incompatibility issues associated with restriction-modification (R-M) systems. Example 2F describes mutation of the R-M system of recipient cells, and Example 2G demonstrates successful transplantation of donor genomes (transferred from Mycoplasma to yeast host cells) from the yeast host cells to recipient bacteria of different species.

Example 2A

Bacterial strains, culture conditions and vectors

[0403] For the studies described in this Example and in Example 3, below, Escherichia coli DH10B [T-mcrA A(mrr-hsdRMS-mcrBC) <|>80d/flcZAM15 AlacX74 deoR recAX endAX araD\39 Aiara, leu)7697 galU galKX rpsL nupG] (Invitrogen, Carlsbad, CA) served as the host strain for cloning procedures and plasmid propagation. E. coli cells were grown in Luria- Bertani (LB) broth medium or in LB agar at 37° C. Depending upon the selection markers present in a given plasmid, E. coli transformants were grown in LB medium supplemented with 50 μg/ml of ampicillin, 5 μg/ml of tetracycline, or 125 μg/ml of puromycin. [0404] Two Mycoplasma species were used in the studies described in this Example and in Example 3, below: Mycoplasma capricolum subsp. capricolum (strain California Kid™) (ATCC 27343) and Mycoplasma mycoides subsp. mycoides (strain GM12) (Damassa et al, 1983; described above). The Mycoplasma cells were grown at 37°C in liquid or solid SP4 medium (Tully et al. 1977), containing 17% of fetal bovine serum (Invitrogen, Carlsbad, CA). Mycoplasma transformed with plasmid or whole-genome were grown at 37°C in SP4 medium supplemented with 5 μg/ml of tetracycline or 8 μg/ml of puromycin. Beta- galactosidase activity was detecting by plating Mycoplasma on solid medium containing 15(^g/ml of 5-bromo-4-chloro-3-indolyl- -D-galactopyranoside (X-gal, Promega, Madison, WI).

[0405] Two strains of Mycoplasma capricolum subsp. capricolum (M. capricolum) were used as recipient cells in the following Examples: wild-type (wt) M. capricolum and a restriction-free M. capricolum mutant (M caprico um- RE) that was obtained by inactivation of the CCATC -restriction enzyme gene in wt M. Capricolum (described in Example 2F, below). Donor genomic DNA for transplantation was from a Mycoplasma mycoides subsp. mycoides LC (M mycoides LC) clone (cl 1.1), described in Example 1, above, the genome of which contained the tetracycline resistance marker, the lacZ gene, and the yeast centromere plasmid integrated between ORF04334 (lppA) and ORF04335 (transposase B of IS1296). As described in detail, below, Mycoplasma genomic DNA was prepared in agarose plugs either directly from M. mycoides LC cells clone 1.1 (native genomic DNA) or from yeast host cells carrying M. mycoides clone 1.1 genome, generated as described in Example 1, above.

[0406] Some vectors used in the following Examples derived from oriC plasmids, which are able to replicate in M. mycoides LC (pMYCOl (SEQ ID NO: 149)) and in M. capricolum (pMYCOl (SEQ ID NO: 149); pSD4 (SEQ ID NO: 150)) (Lartigue et al. , Nucleic Acids Res 31, 6610 (2003)). Those plasmids were based on the pBS(+) plasmid (Stratagene) and contain the tetM gene from transposon Tn9\6 driven by the spiralin promoter, as a resistance marker (Lartigue et al, Plasmid 48, 149 (2002). Restriction buffers were from New England Biolabs, Ipswich, MA. Example 2B

Isolation of M. mycoides LC donor genomes from host yeast cells, confirmation of quantity of recovered whole genomic DNA and development of transplantation methods

[0407] In order to isolate and analyze intact Mycoplasma donor genomes from yeast cells, yeast W303a cells that had been transformed with the Mycoplasma mycoides Large Colony ( mycoides LC) GM12, clone 1.1, genome, as described in Examples lA(ii)b and lA(iv), above, were embedded in agarose plugs as described below. This genome carried the tetracycline resistance gene (tetM) and β-galactosidase gene (lacZ). DNA from the plugs was isolated and evaluated. Genomic DNA from native yeast not carrying donor genomes and native donor Mycoplasma cells isolated were evaluated in a similar manner for comparison. i. Yeast agarose plugs containing donor genomes

[0408] Yeast cultures were grown at 30°C in selective medium until the OD 0o reached approximately 1.5. Yeast cells were embedded in agarose plugs and DNA isolated from the plugs, using the CHEF mammalian Genomic DNA Plug Kit from Bio-Rad Laboratories (Valencia, CA), following the manufacturer's suggested protocol with the following details/modifications. To increase the amount of M. mycoides LC genomic DNA available per plug, 6 x 109 yeast cells (instead of 6 x 108 cells) were used per mL of plugs to be made, to yield 6 x 10 cells per plug. After embedding in plugs, rather than treatment with lyticase (Bio-Rad Laboratories), digestion with Zymolyase™ 100T enzyme (USB Corporation, Cleveland, OH) was used to digest yeast cell walls. The enzyme was added inside and outside of the plugs at a concentration of 5 mg/mL; the mixture was let stand for 2 hours at 37 °C. After a wash in lx TE buffer (20 mM Tris-HCL pH 8; 50 mM EDTA), embedded yeast cells (spheroplasts) were lysed and proteins degraded using two incubations with proteinase K Reaction Buffer (100 mM EDTA; 0.2 % Sodium Deoxycholate; 1 % Sodium Lauryl

Sarcosine; pH 8.0), supplemented with 200 μΕ Proteinase K per mL of plug, 24 hours each, at 50°C. The agarose plugs were then washed at room temperature 4 times, 1 hour each, in lx TE buffer (20 mM Tris-HCL pH 8; 50 mM EDTA),with agitation, and stored in the same buffer at 4°C. For yeast plugs that would be digested with restriction enzymes (see below), phenylmethanesulfonylfluoride (PMSF) was added during the second wash, for a final concentration of 1 mM. [0409] The yeast agarose plugs carrying M. mycoides LC genomic DNA and those containing control yeast DNA were prepared for analysis using the CHEF mammalian Genomic DNA Plug Kit from Bio-Rad (Valencia, CA). A series of 3 agarose plugs (A, B, and C) was made for the yeast containing the donor genomes (A2, B2, and C2) and for the native yeast (Al, Bl, and CI). The plugs were washed at room temperature, two times for one hour in 1 mL of IX TE buffer, and equilibrated for one hour at room temperature in 1 mL of IX NEB buffer 2 supplemented with BSA (100 μg/mL).

[0410] In order to remove endogenous yeast genomic DNA (which migrated at a similar position as the M. mycoides LC genomic DNA in CHEF gel analysis described below), plugs B and C (for each set of yeast) were incubated overnight at 37 °C with 50 units of AsiSl, Rsrll, and Fsel restriction enzymes (New England Biolabs) in a 500 μΕ reaction volume, which specifically cut yeast genomic DNA and left the donor DNA intact. Plug A was incubated without these enzymes under the same conditions. All 3 plugs then were washed at room temperature for 1 hour with 1 ml of IX TE buffer and loaded on 1% TAE agarose gel (120 minutes, 120 volts), to remove digested yeast genomic DNA fragments from the plugs.

[0411] After migration, agarose plugs were removed from the wells and washed two times for one hour in 1 mL 0.1X TE buffer and equilibrated for one hour in 1 mL of IX NEB buffer 2 (New England Biolabs, Ipswich, MA) supplemented with BSA (100 μg/mL). To linearize the M. mycoides LC genomic DNA, which allows entry of the DNA into the gel, plugs C were incubated overnight at 37 °C with 50 units of PspXl restriction enzyme. Plugs A and B (for each set of yeast) were incubated for a mock-digestion with no enzyme under the same conditions. Following the incubation, all plugs were washed for 1 hour at room temperature with 1 mL of IX TE buffer and loaded onto a pulse-field gel. ii. Native M. mycoides LC agarose plugs

[0412] For comparison of amount of DNA recovered, native donor M. mycoides LC agarose plugs containing different amounts of genomic DNA also were prepared from M. mycoides cells, using the CHEF mammalian Genomic DNA Plug Kit from Bio-Rad

(Valencia, CA). Whole intact genomic DNA isolation from M. mycoides LC was performed as described by Lartigue et al, Science 317, 632 (2007), with some modifications, in particular in the way the cells were cultured prior to isolation. Five hundred (500) mL M. mycoides LC {tetM, lacZ, YCp) cells were grown in SP4 medium, supplemented with 10 §/μ1 tetracycline and 10μ|*/μ1 streptomycin, until the pH of the medium reached 6.5

(approximately 109 cells / mL). Prior to the collection of the cells, 100 μ^μΐ chloramphenicol was added to the medium and the cells were incubated another 90 minutes at 37° C at this cell concentration, in order to synchronize ongoing rounds of chromosomal replication and inhibit further rounds of replication.

[0413] The cells were washed once in 10 mM Tris pH 6.5, 0.5 M sucrose, and

resuspended in 2 mL of the same buffer. From this cell suspension, 8 series of M mycoides LC genomic DNA (MLC gDNA) agarose plugs were prepared by 2-fold serial dilutions of the M. mycoides LC cells. Plugs from series 1 contained approximately 1010 native M.

mycoides LC cells per plug; plugs from series 7 contained approximately 1.5 x 108 per plug; and plugs from series 8 contained approximately 7 x 107 cells per plug. For comparison to the genomic DNA from yeast, the plugs containing native DNA and the plugs containing M. mycoides LC genomic DNA isolated from yeast (see above) were digested with PspXl to linearize MLC genome as described above for analysis on a pulse-field gel. iii. Comparison of recovered genomic DNA on pulse field gel

[0414] The amount of M. mycoides LC genomic DNA in yeast cells was estimated by comparing the amount of isolated genomic DNA from yeast cells in agarose plugs to the various amounts of native genomic DNA isolated from 2-fold serial dilutions of M. mycoides LC cells in agarose plugs. For this process, the yeast agarose plugs (Example 2B(i), plugs Al, Bl, and CI and A2, B2, and C2) and the eight M. mycoides LC agarose plugs (Example 2B(ii) were subjected to electrophoresis in a 1% certified pulse-field agarose gel (Bio-Rad, Valencia, CA) in TAE IX, with contour-clamped homogeneous electric field (Chu et al, Science 234, 1582 (1986)) (CHEF DR III; Bio-Rad). Pulse times were ramped from 60 to 120 s over 27h at 4.5 V/cm. After migration, the gel was stained with SYBR® GOLD nucleic acid stain (Invitrogen, Carlsbad, CA) (1/10,000 dilution) and PFGE patterns were scanned with a GE Typhoon 9410 imager. The S. cerevisiae CHEF DNA size marker was used to evaluate DNA size; this marker contained Saccharomyces cerevisiae chromosomes and is used for sizing in the 0.2-2.2 Mb range.

[0415] Lanes with plugs A2-C2 (from yeast containing M. mycoides donor genomes) and Al-Cl (native yeast) (Example 2B(i)) were run on a gel with a marker lane. Plugs (series 7 and 8) contained increasing concentrations of M. mycoides native DNA (Example 2B(ii)). The 1.12 Mb M. mycoides LC genome was detected at the expected position on the pulse- field gel in certain lanes. In the case of yeast host cells containing M. mycoides donor genomes, selective digestion of yeast genomic DNA with the enzyme cocktail (AsiSl, Rsrll Fsel restriction enzymes), followed by electrophoresis (samples B2 and C2; see Example 2B(i), above) improved recovery of M. mycoides donor genomic DNA (data not shown). Further, linearization of the M. mycoides LC genome (C2) greatly improved recovery of the 1.2 Mb M. mycoides (C2). No 1.2 Mb band was detected in the parallel samples from native (wild-type) yeast cells, which contained no M. mycoides genome (Bl, CI), confirming that the band at 1.2 Mb indeed represented the presence of M. mycoides genome in the yeast cells. The same band appeared in lanes containing native M. mycoides genomic DNA.

[0416] The amount of M. mycoides LC genomic DNA recovered from yeast cells was compared to that recovered from native M. mycoides LC genomic DNA standards, which had also been treated with PspXl as described above. The amount of M. mycoides LC genomic DNA obtained from 6 x 108 yeast cells was similar to the amount of genomic DNA recovered from native M. mycoides LC plugs from series 7 (approximately 1.5 x 10s native M. mycoides LC cells per plug). iv. Quantification of recovered DNA

[0417] A UV spectrophotometer was used to determine the amount of native M, mycoides LC genomic DNA present in melted plugs prepared from native M. mycoides cells as described in Example 2B(ii) above. Results are listed in Table 9, below. As shown in this table, plugs from series 7 contained approximately 12 ng/μΐ of genomic M. mycoides LC DNA (1.2 μg per 100 μΐ, plug). As noted above, the pulse-field gel revealed comparable 1.2 Mb band intensity in the lane with this sample (7) and the lane containing DNA recovered from yeast sample (C2) (see Example 2B(iii) above)). Thus, it was determined that that quantity of M. mycoides LC genomic DNA per 100 μΕ plug in recovered from the host cells containing donor genomes was equal roughly to 1 μg. Table 9: Quantification and transplantation of native M. mycoides LC genomic DNA

Transplantation of native M. mycoides LC genomic DNA

into wt M. capricolum recipient cells

Plug Quantity ^g) genomic DNA Number of transplants

series recovered from 1/5 plug (20 μΐ) after transfer of 1/5

plug to recipient cells

1 5.7 237

2 2.9 405

3 1.5 236

4 0.96 215

5 0.64 113

6 0.4 64

7 0.24 29

8 Below detection limit 12

Example 2C

Transplantation of DNA recovered from plugs into recipient cells

[0418] For each sample from the series of melted native M. mycoides LC agarose plugs (Example 2B(iv); Table 9), 1/5 of a plug (20 μί,) was transplanted into M. capricolum recipient cells, using a protocol similar to that described by Lartigue et al, Science 317, 632 (2007), with some modifications, as follows: i. Culture and preparation of recipient cells

[0419] Six (6) mL of M. capricolum recipient cells were grown in SOB(+) medium (Bacto SOB medium (Becton Dickinson; Franklin Lakes, NJ), supplemented with fetal bovine serum (17%), glucose (10 g/L), 2 ml of phenol Red (1%) and 100 μΐ of Penicillin G (5 mg/ml)) until the pH of the culture reached pH 5.7 to 5.85 (approximately 5x 107 cells / ml). The recipient cells were centrifuged at 4575g for 15 minutes at 10° C, washed once in S/T buffer (10 mM Tris-HCl, pH 6.5; and 250 mM NaCl), resuspended in 200 μΐ of CaCl2 (0.1 M) and incubated on ice for 30 minutes. ii. Preparation of isolated donor genomic DNA in agarose plugs

[0420] Before transplantation, the agarose plugs (series 1-7) containing M. mycoides LC genomic DNA were washed 2 times, for 30 minutes each, in 0.1X TE buffer [2 mM TRIS- HC1, pH 8.0 - 5 mM EDTA] under gentle agitation at room temperature. The buffer was completely removed and the agarose plugs were melted with 1/10 volume of 10X β-Agarase Buffer [10 mM Bis Tris-HCl pH 6.5; 1 mM Na EDTA] at 65° C for 10 minutes. The molten agarose was cooled down to 42° C for 10 minutes and incubated overnight at this temperature with 3 units of β-Agarase I (New England Biolabs, Ipswich, MA) per 100 μΐ of plug. iii. Transplantation using 5 % PEG

[0421] After 30 minutes on ice, 200 μΐ of the recipient cells were gently mixed with 400 μΐ of SP4 (-) medium [0% fetal bovine serum, 0.45% NaCl], containing 20 μΐ of melted donor genomic DNA agarose plugs (1/5 of the plug) as generated in Example 2B(ii) above. The plugs were added immediately before proceeding with the next step, as follows.

[0422] An equal volume (620 μΐ) of 2X fusion buffer (20 mM Tris-HCl pH 6.5, 250 mM NaCl, 20 mM MgCl2, 10% Fluka PEG-6000 (Sigma-Aldrich, St. Louis, MO)) was immediately added to the mixture of SP4(-), genomic DNA and cells and the mixture homogenized by rocking the tube gently for 30 seconds. After 50 minutes at 37°C, 5 ml of pre- warmed SP4 was added and cells were gently mixed. After another 3 hours at 37°C, cells were centrifuged at 4,575g for 15 minutes at 10°C, resuspended in 0.6 ml of SP4 and plated on SP4 plates containing 4 μg ml of tetracycline and 150 μg/ml of X-gal. After 3-4 days, individual colonies were picked and grown in broth medium containing 10 μg/ml of tetracycline.

[0423] The results are presented in Table 9, above, which indicate that the number of transplants (colonies of recipient cells with donor DNA) recovered increased proportionally with the amount of native M. mycoides LC genomic DNA present in the transplantation reaction. A decrease in number of transplants was observed at the highest DNA concentration tested (series 8). Thirty (30) transplants were obtained with 200 ng genomic DNA.

Approximately 200 transplant colonies per 1 μg native M. mycoides LC donor genomic DNA was routinely obtained using this method in subsequent experiments. These data

demonstrated that the protocol efficiency was high enough that the quantity of donor M. mycoides LC DNA obtained from yeast host cells would not be a limiting factor in genome transplantation using this method.

[0424] The transplantation method described above can also be used to transform M. capricolum recipient cells with plasmid DNA (not in agarose plugs) by substituting 10 μg of plasmid DNA in solution for the 20 iL of melted agarose plugs. Example 2D

Evaluation of restriction-modification (R-M") systems

[0425] Because differences in restriction-modification systems between donor cells, host cells, and recipient cells could lead to difficulty in genome transplantation, these systems were investigated. This Example demonstrates components of restriction-modification systems that are present and active in some of the Mycoplasma cells used in transplantation herein, and demonstrates aspects of the provided methods used to subvert these systems for successful transplantation. i. Identification of predicted R-M systems in donor and recipient cells

[0426] The M. mycoides LC genome, which has been sequenced (Genbank Accession No.: NZ_AAZK00000000; GI: 149364883), was predicted to contain six different restriction- modification systems (five Type II systems and a single Type III system). The M. capricolum genome sequence showed the presence of a single Type II system. The recognition site specificities of the Type II enzymes were predicted from the gene sequences (Dr. R. Roberts, personal communication), as described in Roberts RJ et al, Nucleic Acids Res. 35(Database issue) :D269-70 (2007). See also REBASE, The Restriction Enzyme Database, available at the World Wide Web address: rebase.neb.com/rebase/rebase.html. These recognition sites and commercially available restriction enzymes that cleave at these sites are listed in Table 10, below. The specificity of the Type III system was not predicted.

Table 10: Restriction-modification (R-M) systems predicted from M. capricolum and M. mycoides LC sequences

operon Specificity Specificity RE

Type ll Type III Isoschizomer

Wt M. capricolum M1-M2-RE CCATC Bed (1 system)

M1-M2-RE CCATC Bed

Wt M. mycoides LC M-RE CCTTC HpyAV

(6 systems)

M-RE GANTC HinFI

M-RE GATC Mbol

M1-M2-RE GCATC SfaNI

M-RE Unknown ii. Confirmation of R-M systems

a. Methylation status of restriction sites

[0427] Commercially available restriction enzyme isoschizomers corresponding to the predicted Type II restriction enzyme systems were used to confirm that the native genomes of M, mycoides LC and M. capricolum were methylated at the predicted sites listed in Table 10. Digestion of the M. mycoides LC and M. capricolum genomic DNA with the isoschizomers indicated that the native genomic DNAs were methylated at the predicted sites (data not shown). These results showed that M. capricolum and M. mycoides LC both contain a CCATC restriction-modification system.

[0428] For this study, genomic DNA from M. mycoides LC and M. capricolum was purified using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI), following the manufacturer's directions. Approximately 1 μg each of M. mycoides LC and M capricolum genomic DNA was incubated with Bed, Hinfl, HpyAV, Mbol and SfaNl, respectively, as described by the manufacturer (New England Biolabs, Ipswich, MA). The DNA was then analyzed by agarose gel electrophoresis (data not shown).

[0429] As expected based on the predicted R-M systems (see Table 10), M. mycoides LC genomic DNA was resistant to cleavage by all 5 restriction enzyme isoschizomers tested, indicating the DNA was methylated at each of these sites. On the other hand, M. capricolum genomic DNA was resistant only to cleavage by the restriction enzyme isoschizomer (Bccl), the restriction-modification system identified in both organisms. These results confirmed the presence of these respective R-M systems (Table 10) in the Mycoplasma species and showed, for example, that M. mycoides LC and M. capricolum both contained a CCATC restriction- modification system.

[0430] The availability of a commercial restriction enzyme isoschizomer corresponding to the predicted restriction enzyme system from M. capricolum enabled us to test whether the two genomes were methylated at the appropriate restriction site. Genomic DNA from M. mycoides and M. capricolum was purified using the Wizard Genomic DNA Purification Kit. Approximately 1 μg each of M. mycoides and M. capricolum genomic DNA was incubated with Bccl. The DNA was then analyzed by agarose gel electrophoresis. As expected, both M. mycoides and M. capricolum genomic DNA were resistant to cleavage by Bccl, the enzyme that corresponds to the homologous R-M system of the two organisms (data not shown). b. Restriction enzyme activity

[0431] Cell-free extracts from M. mycoides LC and M. capricolum were prepared to demonstrate that restriction enzymes were active in both species. As described below, the extracts were used in restriction enzyme assays to test their ability to cleave M. mycoides LC, M. capricolum, and M. genitalium genomic DNA. c. Preparation of cell extracts

[0432] For M. mycoides LC, a 1 liter culture of the cells in SP4 medium was grown at 37°C until a pH of 6.2-6.3 was reached. The culture was harvested by separating the cells into five 200 mL fractions and centrifuging at 5,000xg in a SLA-1500 Sorvall rotor at 4°C for 15 minutes. Each M. mycoides LC pellet was then washed with 200 mL of 8mM Hepes, pH 7.4, and 272 mM sucrose and centrifuged at 5,000xg in a SLA-1500 Sorvall rotor at 4°C for 15 minutes. Each resulting pellet was resuspended in 1 ml Extract buffer (20 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 150 mM NaCl, 1 mM DTT, and 10% glycerol) and subsequently sonicated on ice 5 times with 10-12 seconds bursts, using a microtip, at an output control of three. Each solution was clarified by microcentrifugation at 18,000xg for 30 minutes at 4°C. Each resulting soluble fraction was combined, tested for protein concentration, aliquoted into 200 μΐ fractions, and stored at -80°C. Protein concentration of extracts prepared in this manner typically ranged from 15 to 25 mg/ml.

[0433] For M. capricolum, extracts were prepared using the same method described for M. mycoides LC, except that the 1 liter culture was grown in SP4 medium containing 10 μg/ml of tetracycline. d. Restriction enzyme activity assay

[0434] Restriction enzyme activity of the M. mycoides LC extract was tested as follows. Two (2) μg of genomic DNA, isolated using a WIZARD® Genomic DNA purification kit (Promega Corporation, Madison, WI) from M. capricolum, M. mycoides LC and M.

genitalium, individually in separate reactions, was incubated in IX of NEB restriction enzyme buffer 4 plus 100 μΜ deoxynucleotides with 8 μg of the extract, in a total volume of 100 μΐ, at 37° C. Protein was added last and at 0, 5, 10 and 15 minutes time intervals, a 20 μΐ aliquot was removed and added to 20 μΐ of 2X Stop buffer (2% SDS, 20 mM EDTA). The solution was extracted with 40 μΐ of phenol/chloroform/isoamylalcohol (25:24: 1) and centrifuged at 18,000xg for 2 minutes at room temperature. The aqueous phase was placed into a fresh tube with 4 μΐ of 10X Blue Juice (Invitrogen, Carlsbad, CA) and 18 μΐ of each solution was loaded onto a 0.8% IX TAE agarose gel and run under FIGE conditions of 120V, 0.1-0.6 linear and 80V, 0.1-0.6 linear for 16 hrs. The agarose gel was then stained with SYBR® GOLD nucleic acid stain (Invitrogen, Carlsbad, CA) (1/10,000 dil.) for 30 minutes and scanned with a GE Typhoon 9410 imager.

[0435] Restriction enzyme activity of the M. capricolum extract was tested in the same manner, with the exception that IX NEB restriction enzyme buffer 1 and 12 μg of M.

capricolum extract was used in each reaction, and aliquots were removed and processed at 0, 15, 30 and 45 minutes intervals.

[0436] Results from the study described in Example 2D(ii)(a) (gel results not shown) suggested that M. mycoides LC genomic DNA should be protected from cleavage by the restriction-modification system of M. capricolum but that the M. capricolum genomic DNA should be readily cleaved by the restriction-modification systems of M. mycoides LC. Indeed, as predicted by the homologous restriction-modification system, genomic DNA from M. mycoides LC and genomic DNA from M. capricolum were not cleaved, while genomic DNA from M. genitalium, which does not contain any restriction-modification systems, was readily cleaved. Cleavage of M. genitalium genomic DNA was due to the activity of restriction enzyme in M, capricolum. This was evidenced by the fact that a crude extract derived from a strain of M. capricolum, in which the predicted restriction enzyme gene was disrupted (See Example 2F), did not cleave genomic DNA from any of the three Mycoplasma strains tested. Also as expected, genomic DNA from M. capricolum but not M. mycoides LC was cleaved when incubated with M. mycoides LC crude extracts. These results demonstrated that M. capricolum and M. mycoides LC contain active restriction-modification systems, which have the potential to affect activation of unmethylated M. mycoides LC donor genomes isolated from yeast. Lambda DNA was digested by wild-type M. capricolum extract. Incubation of the DNA with the extract made from the M. capricolum RE(-) strain did not result in the appearance of bands indicating the absence of the restriction activity from this strain. e. Genome sequencing and genome comparison of M. mycoides donor and transplant clones.

[0437] Two M. mycoides clones were sequenced. One was the donor genome described by Lartigue et al. in the 2007 "Genome transplantation in bacteria: changing one species to another" paper published in Science {317, 362) (1,088,905 bp, GenBank# CP001621). The other was the transplanted M. mycoides clone containing the Type III restriction enzyme gene deletion, (Atypelllres; Figure 17)(1,084,586 bp, Genbank # CP001668).). The clone used in the 2007 paper was sequenced using only Sanger DNA sequencing chemistry. The Type III restriction enzyme gene deletion clone described herein was sequenced to 8X coverage by the Sanger method and also with 454 FLX paired-end read pyrosequencing chemistry.

[0438] To confirm that the transplants were entirely M. mycoides and not chimeras containing either yeast sequences or M. capricolum recipient cell sequences, and to determine whether the bacterial genomes were stable when cloned in yeast, the two sequences were compared. All of the assembled Atypelllres genome matched M. mycoides, except for those regions that matched the YCp vector. Additionally, except for differences deliberately built into the genome, the transplant M. mycoides genome sequence with the Type III restriction enzyme gene deletion was identical to the previously sequenced M. mycoides genome except at 95 sites. It should be noted that these 95 sequence differences are not differences between the donor M. mycoides strain used herein and the engineered genome. They are differences between the sequence of the M. mycoides strain (Genbank # CP001621) used in the 2007 paper (Id.) and the engineered genome herein (Genbank # CP001668). We sequenced each one of those 95 sites in M. mycoides YCpMmycl.l, which was used to generate the original M. mycoides yeast clone. In each instance, the transplant sequence matched the

YCpMmycl .1 donor from which it was derived. Thus, none of the 95 sequence differences arose during cloning in yeast, propagation and engineering in yeast, or transplantation out of yeast to create the engineered M. mycoides strain. It was concluded that no sequence changes other than those deliberately engineered occurred during cloning and propagation in yeast, and transplantation back in a bacterium based on the assumption that all sequences that are the same in the two completely sequenced M. mycoides genomes are also the same in the YCpMmycl.l donor strain.

[0439] These data indicate there was no recombination of either yeast or recipient cell genomes with the M. mycoides donor genome, and that these bacterial genome sequences are stable during propagation, engineering, and storage in yeast as YCps. Example 2E

Methods for protecting donor genomes and nucleic acids from restriction-modification system incompatibility

[0440] This example describes two methylation methods that were employed to protect Mycoplasma {e.g., M. mycoides LC) donor genome from cleavage by restriction-modification systems. Methylation assays were performed for each method, to confirm efficacy. i. Methylation by constructed and purified methyltransferases

[0441] First, as described below, the determined sequence of the M. mycoides LC genome was used to exogenously express and purify each of the identified methyltransferases (See Table 10, above). Because the only R-M system identified in M. capricolum was the same as that identified in M. mycoides LC only the M. mycoides LC methyltransferases were purified for this study. a. Methyltransferase construction

[0442] The coding sequences of the five identified methyltransferases (CCATC-M, CCTTC-M, Typelll-M, GCATC-M and GANTC-M) from potential restriction-modification systems in M. mycoides LC were codon optimized for expression in yeast. These sequences were then constructed from multiple overlapping 60 bp oligonucleotides using a one-step isothermal DNA assembly method, described in Gibson et al., Nature Methods 6, 343 - 345 (2009) and in U.S. Patent Application No. 12/371,543, filed February 19, 2009, by the concerted action of a 5' exonuclease, a DNA polymerase, and a DNA ligase. Briefly, with this method, DNA fragments are first recessed by the 5' exonuclease, yielding single-stranded overhangs, which then specifically anneal, followed by gap-filling and covalent joining using the polymerase and the ligase. After construction, the CCATC-M, CCTTC-M and Typelll-M sequences were cloned into the pTYBl expression vector (New England Biolabs, Ipswich, MA; SEQ ID NO: 156). The GCATC-M and GANTC-M sequences were cloned into an N- terminal His tag expression vector with GATEWAY® recombination cloning technology (Invitrogen, Carlsbad, CA). b. Methylase purification

CCATC-M. CCTTC-M expression plasmids

[0443] The CCATC-M and CCTTC-M expression plasmids were transformed into BL21(DE3) codon plus cells (Stratagene, La Jolla, CA) and transformants were used to separately inoculate 250 ml of ZYM-505 medium (Studier, FW, Protein Expr Puriflc 41 :207- 34 (2005)) containing 100 mg/ml carbenicillin and 34 mg/ml chloramphenicol and grown at 37° C with vigorous shaking (315 rpm). After approximately 4 hours, the cultures were transferred to 16° C and expression was induced by the addition of 0.3 mM IPTG, overnight. The cells were pelleted, suspended in 50 ml Intein lysis buffer (25 mM HEPES-NaOH pH 7.2, 500 mMNaCl, 1 mM EDTA, 10% glycerol, plus protease inhibitors (Complete protease inhibitor cocktail, Roche Applied Sciences, Indianapolis, IN)') and lysed by two passages through a high-pressure homogenizer.

[0444] The lysates were clarified by centrifuging at 20,000xg for 20 minutes at 4° C. The clarified lysates were purified on a 1.5 ml column of chitin beads as suggested by the manufacturer (New England Biolabs, Ipswich, MA). Fractions containing the appropriate methyltransferases were pooled and dialyzed against Enzyme buffer (50 mM HEPES-NaOH pH 7.2, 50 mM NaCl, 0.1 mM EDTA, 10% glycerol). Following dialysis, the

methyltransferases were concentrated using an Amicon Ultra Centrifugal Filter Unit

(Millipore, Billerica, MA).

TvpeIII-M

[0445] The TypeIII-M protein was purified using the same protocol, with the exception that after purification on the chitin column, the protein was further purified using a HiTrap MonoQ column (GE Heathcare). The protein was loaded in Buffer A (50 mM HEPES-NaOH pH 7.2, 50 mM NaCl, 1 mM EDTA, 10% glycerol) and eluted with a linear gradient from 0- 100% Buffer B (50 mM HEPES-NaOH pH 7.2, lM NaCl, 1 mM EDTA, 10% glycerol). The fractions containing TypeIII-M were pooled, dialyzed into Enzyme buffer containing 100 mM NaCl and concentrated as described for the CCATC-M and CCTTC-M proteins.

GCA TC-M and GANTC-M expression plasmids

[0446] The M.GCATC and M.GANTC expression plasmids were transformed into BL21(DE3) codon plus cells and transformants were used to separately inoculate 2 ml of ZYM-505 medium containing 100 mg/ml carbenicillin and grown at 37 °C with vigorous shaking overnight. One milliliter of the overnight culture was used to inoculate 250 ml of ZYM-5052 media (Studier, FW, Protein Expr Purific 41 :207-34 (2005)). Cells then were grown for 20 hrs at 27° C with vigorous shaking. The cells were pelleted, suspended in 50 ml Nickel lysis buffer (50 mM HEPES-NaOH pH 7.2, 500 mM NaCl, 30 mM imidizole, 10% glycerol, plus protease inhibitors (Complete protease inhibitor cocktail, Roche Applied Sciences, Indianapolis, IN)) and lysed by two passages through a high-pressure homogenizer. The lysates were clarified by centrifuging at 20,000xg for 20 minutes at 4 °C. The clarified lysates were purified using a 5 ml HisTrap column with Nickel lysis buffer as the running buffer and Nickel lysis buffer with 300 mM imidizole as the elution buffer. The M.GCATC protein was pooled, dialyzed into Enzyme buffer containing 100 mM NaCl and concentrated as above. The M.GANTC protein was further purified using a 1 ml HiTrap MonoQ heparin column utilizing Buffers A and B as for the M.Typelll. The M.GANTC containing fractions were pooled, dialyzed into Enzyme buffer containing 100 mM NaCl and concentrated as described above. c. Methyltransferase studies

[0447] The purified methyltransferases were used in methylation assays to determine whether they could methylate a plasmid containing Mycoplasma DNA. The methylation assays were performed using buffer conditions described by Wilson and Hoffman, Anal Biochem 191, 370 (Dec, 1990). Reactions were performed in 100 μΐ volumes, at 37° C.

Reaction mixtures contained 100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 3 μΜ DTT, 200 μΜ S-adenosylmethionine (SAM), 3 μg pSmart-pMYCOl plasmid DNA (yeast-E. coli- Mycoplasma tri-shuttle vector).

[0448] To evaluate whether DNA had been methylated by the purified methyltransferases, 4 μΐ of each sample was cleaved using restriction enzyme isoschizomers, purchased from New England Biolabs, according to the manufacturer's instructions. The restriction enzyme isoschizomer used depended on the sequence being evaluated for methylation (Bed

(recognition site, CCATC), HinSL (GANTC), HpyAV (CCTTC), Sf Nl (GCATC). Samples were run on 1% 48-well agarose E-gels (Invitrogen, Carlsbad, CA) at 70V for 25 minutes. Gels were scanned on a GE Typhoon 9410 imager.

[0449] The results demonstrated that the individual purified methyltransferases were capable of completely methylating Mycoplasma plasmid DNA, as judged by the complete inability of the corresponding restriction enzyme isoschizomers to cleave the plasmid DNA after incubation with the individual methyltransferases (see Table 10) and S- adenosylmethionine (SAM) (gel data not shown). [0450] In another study, the M. mycoides crude extract was used to treat pMYCOl plasmid DNA with or without SAM. The DNA was then digested by Bed to examine the activity of the methyltransferase in the extract (data not shown). An extract of M. mycoides also protected the incoming donor DNA. The additional restriction-modification systems present in the M. mycoides donor genome did not affect transplantation. ii. Methylation by crude extracts

[0451] In order to eliminate the possibility of cleavage, even after methylation, by enzymes from unidentified restriction-modification systems not identified in the genomic sequences (and thus not addressed by the purified methylases), a protocol was developed for methylating DNA using crude extracts prepared from M. capricolum and M. mycoides LC. The extracts can be used as a source of methyltransferase activity by the addition of 10 mM EDTA, which inhibits nucleases. a. Preparation of cell extracts

[0452] For M. mycoides LC, a 1 liter culture of the cells in SP4 medium was grown at 37° C until a pH of 6.2-6.3 was reached. The culture was harvested by separating the cells into 5 x 200 ml fractions and centrifuging at 5,000xg in a SLA- 1500 Sorvall rotor at 4° C for 15 minutes. Each M. mycoides LC pellet was then washed with 200 ml of 8mM Hepes, pH 7.4, and 272 mM sucrose and centrifuged at 5,000xg in a SLA-1500 Sorvall rotor at 4° C for 15 minutes. Each resulting pellet was resuspended in 1 ml Extract buffer (20 mM Tris-HCl, pH 7.5, 0.1 mM EDTA, 150 mM NaCl, 1 mM DTT, and 10% glycerol) and subsequently sonicated on ice 5 times with 10-12 seconds bursts using a microtip at an output control of 3. Each solution was clarified by microcentrifugation at 18,000xg for 30 minutes at 4° C. Each resulting soluble fraction was combined, tested for protein concentration, aliquoted into 200 μΐ fractions and stored at -80° C. Protein concentration of extracts prepared in this manner typically ranged from 15 to 25 mg/ml.

[0453] For M. capricolum, extracts were prepared using the same method described for M. mycoides LC, except that the 1 liter culture was grown in SP4 medium containing 10 μg/ml of tetracycline. b. Assessing methylation by crude extracts

[0454] Methylation assays were used to demonstrate the ability of the crude extracts to methylate Mycoplasma plasmid DNA grown in various host cells, as follows. The

methylation assays using crude extracts were performed using buffer conditions described by Wilson and Hoffman, Anal Biochem 191, 370 (1990). c. Evaluating methylation of CCATC, GANTC, CCTTC, AND GCATC by M. mycoides LC extracts

[0455] To evaluate methylation (and thus protection) of CCATC, GANTC, CCTTC, and GCATC sites by M. mycoides LC extracts, reactions were performed in 100 μΐ volumes, at 37° C. Reaction mixtures contained 100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 3 μΜ DTT, 200 μΜ S-adenosylmethionine (SAM) (absent in control samples, as indicated) 3 \ag of pMYCOl plasmid DNA (SEQ ID NO: 149)), isolated from E. coli and 20 μg of M. mycoides LC extracts.

[0456] At 0, 2-, 4-, and 16-hour time intervals, a 20 μΐ aliquot was removed from each reaction mixture and added to 2X stop buffer (2% SDS, 20 mM EDTA). DNA extraction was performed on each aliquot, using 40 μΐ phenol/chloroform/isoamylalcohol (25:24: 1), followed by centrifugation at 18,000xg for 2 minutes at room temperature. Each aqueous phase was placed into a fresh tube and DNA was precipitated by adding 80 μΐ of ice-cold 100% ethanol and 1 μΐ of Ambion® GlycoBlue™ (Invitrogen, Carlsbad, CA) and incubating at -20° C overnight. Each sample was then centrifuged at 18,000xg for 15 minutes at 4 °C and each resulting pellet was washed with 100 μΐ of ice-cold 70% ethanol. After

centrifugation at 18,000xg for 5 minutes at 4 °C, each supernatant was discarded, and each pellet dried and resuspended in 20 μΐ of TE pH 8.0.

[0457] To evaluate whether DNA had been methylated by respective Type II

methyltransferases, 4 μΐ of each sample was cleaved using restriction enzyme isoschizomers, purchased from New England Biolabs, appropriate for the particular sequence being evaluated, according to the manufacturer's instructions (Bed (recognition site, CCATC), Hmfl (GANTC), HpyAV (CCTTC), SfdNI (GCATC). Samples were run on 1% 48-well agarose E-gels (Invitrogen) at 70V for 25 minutes. Gels were scanned on a GE Typhoon 9410 imager. d. Evaluating GATC site methylation by M. mycoides LC extracts

[0458] When testing for GATC methylation by M. mycoides LC extracts, the above protocol was modified by using 3 μg of pMYCOl plasmid DNA isolated from M. capricolum in the first step and cleaving with Mbol restriction isoschizomer. e. Evaluating CCATC site methylation by M. capricolum LC extracts

[0459] Methylation of CCATC sites by M. capricolum extracts was tested as above, except that 3 μg each of pSmart-pMYCOl plasmid DNA (yeast-E. coli-Mycoplasma tri- shuttle vector), isolated from E. coli, and pMYCOl isolated from M. capricolum and M. mycoides LC were used, and the reactions were carried for 4 hours in the presence or absence of S-adenoylmethionine. The methylated DNA was then checked by incubating with Bccl as above. f. Results

[0460] The M. capricolum crude extract was able to completely methylate the two plasmids isolated from E. coli, evidenced by the fact that the corresponding restriction enzyme isoschizomer, Bccl, was unable to cleave the plasmids that had been incubated with crude extract and SAM (gel data not shown).

[0461] The results of the study assaying for methylation (and thus protection) of CCATC, GANTC, CCTTC, GCATC, and GATC sites by M. mycoides LC extracts are as follows: M. mycoides LC extract was able to completely methylate Mycoplasma plasmid DNA in the case of 4 restriction-modification systems, and only partially in the case of 1 system (the GATC restriction-modification system) (gel results not shown). Because the endogenous M.

mycoides LC GATC methyltransferase showed low activity in the M. mycoides LC extract, the commercially available E. coli dam methyltransferase (New England Biolabs, Ipswich, MA) was used to successfully supplement its activity.

[0462] Methylation of the Mycoplasma plasmid DNA by both crude extracts dramatically increased transformation efficiency in M. capricolum (data not shown), indicating that incubation with crude extracts in the provided methods can help overcome potential incompatibility of donor genomes propagated in yeast cells that are being transplanted into M. capricolum recipients. Effectiveness of Type III methyltransferase was not evaluated in the M. mycoides LC crude extract because its site-specificity is unknown. iii. Increased transformation efficiency with methylation

[0463] Unmethylated plasmids, and plasmids methylated with the M. mycoides LC extract, as described above, were transformed into M. capricolum cells, and compared. The results indicated an increased transformation efficiency of the methylated plasmids, demonstrating a positive effect of DNA modification prior to transformation. iv. Additional analysis, confirmation effects and treatment of DNA after methylation

[0464] Although crude extracts protected donor plasmid DNA from host restriction- modification system and increased efficiency of transformation, crude extracts also completely inhibited genome transplantation experiments involving native M. mycoides LC genomic DNA isolated in agarose plugs and M. capricolum cells (See Example 3, below).

[0465] To study the inhibition in more detail, endogenous M. mycoides LC genomic DNA, isolated in agarose plugs (prepared as described in Example 2B(ii), above), in the absence or presence of M. capricolum or M. mycoides LC Mycoplasma crude extracts (prepared as in Example 2E(ii)(a) above), was analyzed by fluorescence microscopy. M. mycoides LC genomic DNA agarose plugs were melted with β-agarase I, as described above (Example 2C(ii)). 2 μΐ diluted (1/2000) SYBR® Gold nucleic acid gel stain (Invitrogen, Carlsbad, CA) was then gently mixed to 5 μΐ of melted agarose, and let stand for 5 minutes at room temperature. The mixture was dropped onto a glass slide and covered with a coverslip.

[0466] M. mycoides LC genomic DNA then was visualized using an upright Axioskop® 2 microscope (Carl Zeiss, Inc) (with objective lens (100X); rhodamine filter), equipped with an AxioCam® MRc5 color camera (Carl Zeiss, Inc, Thornwood, NY). Fluorescence

microscopic images were acquired and analyzed with Axio Vision release 4.7.1 software from Carl Zeiss, Inc. Figure 7A illustrates initial treatment of the agarose plugs and the result of untreated agarose plugs. Results of methylation and deproteinisation steps are presented in Figs. 7B-7C, respectively, in which samples and treatment are indicated above pictures.

[0467] As shown in Figure 7B, native genomic DNA treated in the absence of crude extracts (shown to allow transplant into recipient cells) displayed a punctate pattern (right panel), while endogenous genomic DNA treated in the presence of crude extracts (shown to inhibit transplant) formed large aggregates (left two panels). This result suggested that conformation of DNA is important for transplantation experiments.

[0468] To confirm that confirmation was important, samples were treated with proteinase K to remove cell extracts after treatment, as follows. Each yeast plug was incubated for 4h at 50° C in 1 rriL of Proteinase K Reaction Buffer [100 mM EDTA; 0.2% Sodium

Deoxycholate; 1% Sodium Lauryl Sarcosine; pH8.0], supplemented with 40 μΐ Proteinase K. The plugs were then were washed 4 times, 45 minutes each, with 1 ml IX TE buffer (20mM Tris-HCl pH 8; 50 mM EDTA) and 2 times, 30 minutes each, in 0.1X TE buffer with soft agitation at room temperature. After removing the final wash buffer, the plugs were melted with β-agarase I and analyzed by fluorescence microscopy as described above. The results are presented in Figure 7C, which shows that removal of the crude extracts by proteinase K treatment after incubation with the genomic DNA in agarose plugs restored the punctate pattern originally observed with the untreated genomic DNA. Further, as described below (Example 3), proteinase K treatment to some extent restored the transplantation efficiency of native genomic DNA that had been treated with crude extracts. Thus, removal of proteins in crude cell extracts (e.g., by proteinase K treatment) provided a means by which M. mycoides LC donor genomic DNA isolated from yeast host cells could be methylated using crude extracts, and still be successfully transplanted into recipient cells.

Example 2F

Mutation of R-M systems (Generation of M. capricolum ARE)

[0469] Another method was employed as a means to overcome restriction barriers between host cells and recipient cells. In this method, the single restriction enzyme identified in M. capricolum (See Example 2D(i) and Table 3, above) was inactivated by interruption of the coding region of the gene. The restriction enzyme gene was interrupted by integration of a puromycin resistance marker into the coding region of the gene.

[0470] The heterologous pSD4 Spiroplasma citri oriC plasmid (SEQ ID NO: 150) has been shown to transform M. capricolum (Lartigue, C. et al. Nucleic Acids Res. 31 :6610-8 (2003)). This plasmid is efficient for integration of foreign sequences and for targeted mutagenesis in the M. capricolum genome. To inactivate the potential restriction enzyme gene (MCAP0050) in M capricolum, an internal fragment of the gene was amplified from M. capricolum genomic DNA using oligonucleotides RE-Mcap-F (5'- gatctctagactaatgttcaattggatgatata G-3' (SEQ ID NO:157)) and RE-Mcap-R (5'- gatctctagactcaagtcttgtaggagaatc-3' (SEQ ID NO: 158)) that include a Xbal site. The fragment was then cleaved by Xbal and cloned into an Xbal cleaved pSD4 plasmid (SEQ ID NO: 150), yielding pSD4-AMcap0050.1 (SEQ ID NO: 159). Ten micrograms of this plasmid was used to transform wild type M. capricolum cells using the 5% PEG mediated protocol, described in Example 2C, above. Transformants were selected on solid SP4 plates containing 4 μg/mL tetracycline. After 7 days of incubation at 37° C, several colonies were picked in liquid medium containing 10 μg/ml tetracycline and cells were propagated for 15 passages (15P). Clones then were analyzed by Southern blot to verify the presence of the plasmid and its possible integration at the target gene by homologous recombination via a single crossing- over.

[0471] One clone, M. capricolum ARE clone 10 15P, was selected because (as evidenced by Southern blot) its hybridization pattern demonstrated the interruption of MCAP0050 gene by the plasmid. No free plasmid was detected. Centrifuge-clarified lysate extracts also were prepared as described in 2D(ii)(b), and used in the restriction enzyme assay described in Example 2D(ii). The results revealed a complete absence of restriction enzyme activity in clone 10 15P clone compared to wild type M. capricolum (data not shown).

[0472] Using the method described in Example 2E(ii), above, M. capricolum ARE clone 10 was used as a source to make crude M. capricolum cellular extracts for in vitro

methylation experiments. The M. capricolum ARE clone 10 was not, however, a good candidate recipient cell for transplantation of M. mycoides LC because it contained the same resistance marker gene (tetM) as the M. mycoides LC donor genomic DNA present in yeast. Accordingly, using the cloning strategy described above, another M. capricolum ARE mutant was constructed, which carried the YCp and puromycin resistance gene instead of the tetM gene. Centrifuge-clarified lysate extracts were prepared from the M. capricolum ARE clone 17.5 15P, as described in 2D(ii)(b), and used in the restriction enzyme assay described in Example 2D(ii). The results revealed a complete absence of restriction enzyme activity in clone 17.5 15P clone compared to wild type M. capricolum. Accordingly, this clone was chosen for transplantation.

[0473] These results demonstrate that removal of the M. capricolum restriction activity from recipient cells allows donor M. mycoides LC genomic DNA, isolated from yeast, to survive within the M. capricolum cytoplasm. Alternatively, as described above, the provided methylation methods can be used to treat the donor DNA prior to transplantation to protect it.

EXAMPLE 3

Transplantation of M. mycoides LC-YCp genomic DNA from yeast host cells into M.

capricolum

[0474] Example 1, above, describes the successful cloning of complete bacterial genomes (including these Mycoplasma) in yeast host cells. This example describes the successful transplantation of whole Mycoplasma donor genome (M mycoides LC (Genbank Accession No.: NZ AAZK00000000; GI: 149364883)) DNA, which had been propagated in yeast host cells, into Mycoplasma recipient cells of a different species ( . capricolum). The donor and recipient were chosen based on their rapid growth. The method could also be performed, however, using other Mycoplasma donors and recipients, such as M. genitalium

genomes/cells, which are described above. Further, the methods described in this Example can be used in conjunction with steps for modifying the donor genomes in vivo while in the host cell (e.g., using the repertoire of yeast tools during propagation of the bacterial donor genome) prior to transfer. Thus, the methods can be used to genetically engineer donor genomes, such as genomes from bacteria with relatively poorly developed genetic systems.

[0475] For example, the methods can be used to generate synthetic cells that contain synthetically engineered genomes. A complete synthetic genome of non-pathogenic strain of Mycoplasma genitalium has been synthesized (Gibson et al, Science 319:1215-20 (2008); Gibson et al, PNAS USA 105:20404-9 (2008)). In that study, the genome was assembled in the final step as a centromeric plasmid in yeast.

[0476] Such synthetically produced and natural genomes {e.g., Mycoplasma or other bacterial genomes) propagated in host cells {e.g., yeast host cells) can be transplanted into recipient cytoplasm to generate synthetic cells using the provided methods, such as those described in this Example. For example, to express a bacterial synthetic donor genome (propagated in yeast) in a bacterial recipient, the methods can be used to transplant it from yeast into a bacterial {e.g., Mycoplasma) recipient.

[0477] As described in Example 2, above, different restriction-modification systems can present incompatibility issues when transplanting a donor genome from a host cell in which it has been propagated to a recipient cell of a different species. In particular, it was determined that upon introduction and propagation of the M. mycoides LC genome into yeast host cells (See Example 1, above), it was unlikely that the methyltransferases that are endogenously expressed by these Mycoplasma (See Example 2B, above) were expressed in the yeast host cells. This determination was based on the fact that the methyltransferase genes contain UGA tryptophan codons, which are treated as stop codons by the eukaryotic yeast host cells. This determination indicated that M. mycoides LC donor genomic DNA, isolated from yeast, would be unmethylated and susceptible to the M. capricolum recipient cell restriction- modification system upon transfer into that cell. It was also possible that one or more M mycoides LC restriction enzymes could cleave the donor genome, once expressed following transplantation. Various aspects of the provided methods for overcoming R-M

incompatibility issues are described in Example 2, above. Such aspects were selected and used in the following study to achieve successful transplant of donor Mycoplasma genomes, propagated in yeast, into Mycoplasma recipient cells of a different species.

Example 3A

Transplant methods

[0478] This Example describes the use of these techniques to successfully transplant donor Mycoplasma genomes from yeast host cells to Mycoplasma recipient cells. Figure 8 shows three alternative transplantation approaches that can be used to transplant whole genomic DNA. Variations on these three approaches were used in the examples, described below. The first approach (denoted with the number "1 "labeling the arrows in Figure 8), includes digestion of agarose plugs containing the genomic DNA {e.g., with β-agarase (melting step)), followed by transplantation directly into recipient cells. This method is typically used, as shown in Figure 8, for transplantation of donor genomes or nucleic acids from one cell {e.g., donor Mycoplasma cell) into a similar cell, such as from a Mycoplasma donor cell into a Mycoplasma recipient cell.

[0479] The second approach (denoted with the numbers "2") is identical to the first method, except that recipient cells had been modified to mutate the restriction enzyme genes (ARE; generated as described in Example 2F, above). With this approach, as indicated in Figure 8, genomic Mycoplasma DNA grown in yeast host cells and isolated in yeast plugs can successfully be transplanted into Mycoplasma recipient cells. With the third approach (denoted with the numbers "3" in Figure 8), samples were methylated and subjected to a deproteinisation step (treatment with proteinase K), prior to the melting step (β-agarase digestion) and transplantation into recipient cells. As indicated in the figure, the methylation and deproteinisation steps also facilitate efficient transplant of donor Mycoplasma genomes, isolated after propagation in yeast, into Mycoplasma recipient cells. As described below, control studies included conditions similar to the third approach, where samples were treated in parallel, under the same conditions, without the presence of methylases ("mock

methylation"). These approaches and the results obtained with each are described in detail below. i. Preparation of agarose plugs

[0480] In each approach, M. mycoides LC genomic DNA was isolated in agarose plugs from yeast strain VL6-48N (described by Larionov et al, PNAS USA 94:7384-7 (1997)), as follows.

[0481] Yeast cells containing the M. mycoides LC genomic DNA (generated as described in Example 1 A) were grown at 30° C in selective medium until the OD reached

approximately 1.5; control cells not containing the donor genome were grown under the same conditions. Agarose plugs were prepared from each cell type, using the CHEF mammalian Genomic DNA Plug Kit (Bio-Rad Laboratories, Valencia, CA), following the instructions recommended by the manufacturer for yeast (eukaryotic) DNA extraction, with the following modifications. 6x109 yeast cells were used per plug, (instead of 6x108 cells, as recommended by the kit), to yield 6xl08 cells per plug, in order to increase the amount of M. mycoides LC genomic DNA available per plug. After embedding the cells in the plugs, to digest the cell walls, Zymolyase™ 100T enzyme (USB Corporation, Cleveland, OH) was used instead of Lyticase (Bio-Rad Laboratories, Valencia, CA). The enzyme was added inside and outside of the plugs at a concentration of 5 mg/ml and let stand for 2 hours at 37 °C.

[0482] After a wash in IX TE buffer (20mM Tris-HCl pH 8; 50mM EDTA), embedded yeast cells were lysed and proteins digested by two incubations of 24h at 50° C with 5ml of Proteinase K Reaction Buffer [100 mM EDTA; 0.2% Sodium Deoxycholate; 1% Sodium Lauryl Sarcosine; pH8.0] supplemented with 200μ1 of Proteinase K, per ml of plug. The agarose plugs then were washed at room temperature, 4 times, 1 hour each, with 40 ml of IX TE buffer with agitation and stored in the same buffer at 4 °C. For yeast plugs that would subsequently be digested with restriction enzymes (see below), 1 mM of

phenylmethanesulfonylfluoride (PMSF) was added during the second wash.

[0483] Clean-up

[0484] Prior to these studies, it was unknown whether yeast genomic DNA, isolated along with the M. mycoides LC donor genomic DNA extracted from yeast, would affect or abrogate transplantation reactions. Accordingly, with each approach, two sets of donor genomic DNA were prepared, one of which was submitted to the optional "clean-up" step after digestion of cell walls and proteinase K treatment. The "clean-up" step was designed to remove yeast genomic DNA from the samples.

[0485] The "clean-up" samples were either treated with a cocktail of restriction enzymes that specifically digests yeast genomic DNA and then cleared of small yeast DNA fragments by electrophoresis or directly loaded on Pulse Field agarose gel to separate circular genomes that are being caught into the well, and linear yeast chromosomes that are electrophoresed out of the well (Lartigue et al, Science 317, 632 (2007).

[0486] For clearing with the cocktail of enzymes, yeast plugs were washed two times, 1 hour each, in 1ml of 0.1 X TE buffer (2mM Tris-HCl pH 8.0 - 5mM EDTA), equilibrated lh in 1ml of IX NEB buffer 2 (New England Biolabs, Ipswich, MA ) supplemented with BSA, and the genomic DNA present in the plug was digested over-night with 50 units of restriction enzymes cocktail (AsiSI, RsrII and Fsel) in a 500μ1 reaction volume. The yeast plugs were washed at room temperature for 1 hour with 1 mL of IX TE buffer (20mM Tris-HCl pH 8.0 - 50mM EDTA) and loaded on 1% TAE agarose gel (120 minutes, 120 volts). Agarose plugs were removed from the well and stored at 4 °C.

[0487] For clean-up via electrophoresis alone, the other yeast plugs were subjected to electrophoresis in a 1% LMP gel in TAE IX, with contour-clamped homogeneous electric field (6) (CHEF DR III; Bio-Rad). Pulse times were ramped from 60 to 120 s over 24 h at 3.5 V/cm. After migration, plugs were removed from the wells and stored in IX TE buffer at 4° C. ii. General Transplantation method

[0488] With each approach, transplantation proceeded as follows, with the exception that with the third approach, samples were subject to methylation and proteinase K treatment prior to melting with β-agarase, as described in the Example 3 A(iii), below. a. Recipient cells

[0489] Twelve (12) mL of M. capricolum recipient cells (wild-type or ARE (as produced in Example 2F)) were grown in SOB(+) medium (Bacto SOB medium (Becton Dickinson, Franklin Lakes, NJ) supplemented with fetal bovine serum (17%), glucose (10 g/1), 2 ml of phenol Red (1%) and 100 μΐ of Penicillin G (5 mg/ml)) until the pH of the culture reached pH 5.7 to 5.85 (approximately 5x 107 cells / ml). The recipient cells were centrifuged at 4575xg for 15 minutes at 10° C, washed once in 6 mL S/T buffer (Tris-HCl lOmM pH 6.5; NaCl 250mM), resuspended in 400 μΐ of CaCl2 (0.1 M) and incubated on ice for 30 minutes. b. Preparation of isolated donor genomic DNA in agarose plugs

[0490] Before transplantation, the agarose plugs, prepared as described in Example

3 A(i)(a), above, containing M. mycoides LC genomic DNA from yeast, were washed 2 times, for 30 minutes each, in 0.1X TE buffer [Tris-HCl 2mM pH 8.0, EDTA 5mM] under gentle agitation at room temperature. The buffer was completely removed and the agarose plugs were melted with 1/10 volume of 10X β-Agarase Buffer [10 mM Bis Tris-HCl pH 6.5; 1 mM Na2EDTA] at 65° C for 10 minutes. The molten agarose was cooled down to 42° C, for 10 minutes, and incubated overnight at this temperature with 3 units of β-Agarase I (New England Biolabs, Ipswich, MA) per 100 μΐ of plug. As described in Example 3A(i)(c), below, methylation and proteinase K treatment were performed before β-Agarase treatment in the third approach (Figure 8 ("3")). c. Transplantation in the presence of 5 % PEG

[0491] After 30 minutes on ice, 400 μΐ of the recipient cells were gently mixed with 800 μΐ of SP4 (-) medium [0% fetal bovine serum, 0.45% NaCl], containing 100 μΐ of melted donor genomic DNA agarose plugs as generated in Example 2B(ii) above. The plugs were added immediately before proceeding to the next step, as follows.

[0492] Thirteen hundred (1300) μΐ of 2X fusion buffer (20 mM Tris-HCl pH6.5, 250 mM NaCl, 20 mM MgCl2, 10% PEG-6000 from Fluka] was immediately added to the mixture of SP4(-), genomic DNA and cells and the mixture homogenized by rocking the tube gently for 30 seconds. After 50 minutes at 37° C, 10 ml of pre-warmed SP4 is added and cells were gently mixed. After another 3 hours at 37° C, cells were centrifuged at 4575xg for 15 minutes at 10° C, resuspended in 1.2 mL of SP4 and plated on SP4 plates containing 4 μg/ml of tetracycline and 150 μg ml of X-gal (two plates per sample). After 3-4 days, individual colonies were picked and grown in broth medium containing 10 μg/ml of tetracycline. iii. Methylation and proteinase digestion (specifics of the third approach)

[0493] With the third approach (Figure 8, "3"), prior to melting with β-Agarase, M.

mycoides LC genomic DNA from yeast agarose plugs was methylated, followed by a deproteination step. For this process, the plugs were washed two times 30 minutes in 200 mM Tris-HCl pH 7.5; 50 mM EDTA and equilibrated two times 30 minutes in methylation buffer (100 mM Tris-HCl pH 7.5; 10 mM EDTA, 3 μΜ DTT, 200 μΜ S-adenosylmethionine) with soft agitation. Following equilibration, each yeast plug was cut into 4 pieces and added to 100 μΐ methylation reaction (IX methylation buffer plus methyltransferases) and incubated 16 hours at 37° C. For 100 μΐ of reaction, either 5 μΐ of wild type M. mycoides LC cellular extracts, or 7.5 μΐ of M. capricolum ARE (clone 10 15P) cellular extracts (approximately 125 μg protein) or 2.5 μΐ of each purified M. mycoides LC specific methyltransferases

(M.GANTC, M.CCATC, M.GCATC, M.CCTTC, M.Type III). Each cell extract was prepared as described in Example 2E(ii), above and purified methyltransferases were prepared as described in Example 2E(i), above. The methylation reactions containing M. mycoides LC cellular extracts or purified methyltransferases were also supplemented with 5 μΐ of dam methyltransferase (New England Biolabs, Ipswich, MA).

[0494] Following methylation, each yeast plug was incubated for 4 hours at 50° C in 1 mL Proteinase K Reaction Buffer [100 mM EDTA; 0.2 % Sodium Deoxycholate; 1 % Sodium Lauryl Sarcosine; pH8.0] supplemented with 40 μΐ of Proteinase K. The plugs were then washed 4 times 45 minutes with 1 ml of IX TE buffer (20 mM Tris-HCl pH 8; 50 mM EDTA) and 2 times 30 minutes in 0.1X TE buffer with soft agitation at room temperature. After removing the final wash buffer, the plugs were melted with β-Agarase I as described in section (b), above, followed by transplantation. Example 3B

Study demonstrating successful transplantation using the provided methods

[0495] Using the general method described in Example 3 A, above, transplantation of M. mycoides LC genomic donor DNA from yeast host cells into wild-type and restriction enzyme-deficient M. capricolum recipient cells was carried out, under the following conditions listed in Table 11. "Untreated" samples were not methylated, nor treated with proteinase , prior to melting. "Mock-methylated" samples were incubated under the same conditions as methylated samples, without enzymes or cell extracts. Methylation treatments included methylation with donor or recipient cell extract and methylation with purified methylases.

Table 11: Transplantation conditions

[0496] Results were scored by selecting for growth of blue colonies on SP4 medium containing tetracycline at 37° C and are presented in Table 12A, below. As indicated in that table, for methylation with M. mycoides extracts and transplanted into wild-type cells (sample 2), some samples were cleaned-up to remove yeast DNA, as described above, either by digestion with yeast-specific enzymes (b) or by electrophoresis (c).

Table 12A: Quantification of transplant colonies with donor phenotype

Number of transplants from recipient cells

Yeast Methylation (colonies/plugs)8

Genome

strain treatment M. capricolum RE(-) Wild-type M.

capricolum

Untreated 37 ± 3 0

VL6- clYCpl.l M, capricolum 32 ± 13 9 ± 4

48N extracts

M. mycoides 15 ± 8 22 ± 8 [13 ± 4] b [10 LC extracts ± 4] c

Mock- 34 ± 17 0

methylated

clYC l.l Untreated 22 ± 5 Not done

W303a Atypelllres: Untreated 52 ± 10 Not done

:URA3

Atypelllres Untreated 52 ± 12 Not done

A500 b Untreated 0 Not done a Average of at least three experiments. The error reported is the mean deviation.

b Yeast plugs have been cleared of yeast genomic DNA using AsiSl, Rsrll, Fsel cocktail restriction enzymes protocol.

0 Yeast plugs have been cleared of yeast genomic DNA using Pulse field gel electrophoresis protocol.

[0497] As shown in Table 12 A, above, in the samples that were methylated using the M.

mycoides LC extracts or purified methylases, and transplanted into either wild-type or ARE recipient cells (samples 2, 3, 7, and 8), colonies were obtained that were phenotypically

similar (based on similar appearance and growth rate) to M. mycoides LC (as described by

Lartigue et al, (2007) Science 317:632-8.(6)). This result confirmed that the M. mycoides LC donor genome that had been propagated in yeast was resistant to both restriction enzymes produced from M. mycoides LC, and enzymes produced by the recipient cell system.

[0498] On the contrary, transplantation of mock-methylated and untreated M. mycoides

LC genomes produced donor-phenotype colonies only in the case of M. capricolum ARE

recipient cells (samples 6 and 10) and not in the case of wild-type recipient cells (samples 1 and 5). For example, thirty-four and thirty-seven colonies, respectively, were obtained when the mock-treated and untreated donor genomic DNA was transplanted into the M. capricolum ARE recipient cells (samples 6 and 10). However, no colonies were obtained when either mock-treated or untreated M. mycoides LC genomic DNA were transplanted into wild-type

M. capricolum recipient cells (Table 12A).

[0499] Similarly, colonies were obtained in both recipient cell types with donor genomes treated with the M. capricolum extract (samples 4 and 9) (32 and 9 colonies, Table 12A).

Because the M. capricolum extract provides protection against the M. capricolum restriction enzyme, this result demonstrates that avoidance of the M. capricolum recipient restriction system was important for successful transformation of the M. mycoides LC donor genomes, propagated in yeast cells. The fact that inactivation of the M. capricolum restriction system

(M. capricolum ARE recipient cells) was sufficient to allow successful transplantation and activation of the M. mycoides donor genome suggested that inactivation of this recipient cell restriction system also was sufficient for these events. Thus, donor M. mycoides LC

restriction systems (which could have been activated upon transplantation into the recipient cells) did not appear to constitute a barrier to transplantation of the donor genome from yeast into M. capricolum recipient cells. [0500] Recovery of colonies in the transplantation experiments was dependent on the presence of M. capricolum recipient cells, as no colonies were observed when recipient cells were omitted from the reactions. Moreover, the transplantation experiments were also dependent on a mycoides LC genome from yeast, as no colonies were obtained when only yeast genomic DNA or YCp plasmid from yeast was used as donor DNA. Southern blots confirmed that the recipient cell colomes having received the donor genomes from yeast were of the M. capricolum and M. mycoides LC genotype.

[0501] Without "clean-up," yeast DNA was present in samples containing genomic DNA. Purifying the donor genomic DNA away from yeast genomic DNA (denoted by "b" and "c" in Table 12 A, above) did not substantially alter transplantation results, demonstrating that the recipient M. capricolum cells were able to tolerate the presence of non-specific or carrier DNA (Table 12). In addition, positive transplantation results were obtained with donor genomic DNA isolated from two different yeast strains (VL6-48N and W303a), indicating that the genotype and/or phenotype of the host yeast strain may not be important for transplantation experiments.

[0502] Taken together, these results demonstrate the capacity of M. capricolum cells to activate a phenotypically dormant M. mycoides LC genome from yeast, leading to the generation of living M. mycoides LC cells, and thus that the provided methods can be used to transplant a whole prokaryotic genome, grown in a eukaryotic host cell, into a recipient prokaryotic cell of a different species than either the donor or the host.

[0503] Transplantation of the non-methylated M. mycoides LC genome from yeast into the M. capricolum ARE recipient cells confirmed that the transformed, selected, recipient cells contained donor genomes and were not selected due to the presence of some M. mycoides LC component other than genomic DNA. This confirmation was due to the fact that no M.

mycoides LC cells or components other than genomic DNA were present during

transformation.

[0504] In another example, YCpMmycl.l, as well as the engineered YCp genomes (YCpMmycl.l-AtypeIIIres::URA3 and YCpMmycl.l-Atypelllres), were also isolated from yeast strain W303a. Transplantation of all three YCp genomes into M. capricolum recipient cells resulted in similar numbers of tetracyclineresistant blue colonies (Table 12B). The large deletion clone (YCpMmycl.l-A500kb) discussed above served as an appropriate control because it lacks many presumed essential genes yet retains the YCp element and tetM. As expected, no colonies were recovered when this genome was transplanted into M. capricolum recipient cells.

[0505] Recovery of colonies in all these transplantation experiments was dependent on the presence of both M. capricolum recipient cells and an M. mycoides genome. The experiments described here used donor YCp genome DNA that included yeast genomic DNA. However, purifying the donor YCp genome DNA away from yeast genomic D A did not substantially alter transplantation results, which indicates that the recipient M. capricolum cells are able to tolerate the presence of non-specific or carrier DNA (Table 12B). Positive transplantation results were obtained with donor YCp genome DNA isolated from four independent transformant cultures of strain VL6-48N and four of strain W303a. Thus, bacterial genomes can be stably cloned in both yeast strains. Verification that the recovered colonies were M. mycoides was done by Southern blot analysis using an M. mycoides— specific IS 1296 element as probe (data not shown). It was shown that the Type III restriction gene was deleted in the engineered bacterium by PCR by Southern blot analysis using the Type III restriction gene sequence as probe (data not shown), and by sequencing the locus (Figure 17).

Table 12B

Number of transplants

Yeast Meth tation ttotoni s or plugs)

Genome

strain treatment

β(-ϊ M. capricolum

VCpNtmydLl 37 * 3 0

M QpfCOffMI 32 + 13 9 t 4 extracts

M, mytotiles 15 ± 8 22 t a [13 t 41*

110 * 4J† ft«ck-«»th tted 34 i 17 0

20 * 1? 13 * 10 ffM iiieft iases

»3a YCjttmycLl Untreated 22 + 5 Hot done

Untreated 52 * 10 Not done

Unseated 52 t 12 Mot dene

Untreated 0 Ne done

≠χ - mm deafed of yeast geraeeie ΜΆ ay digestion th a cocktaH ø f M ¾» la ft ami f 1 fe towed hif piteeM Md fel f¥«ast l« wsfe dusted of seass* ga tek. flUPi If MSM¾ pui-*J«i*M gai eleetaph&f eSs.. [0506] Table 12B provides the results of transplantation of M. mycoides YCp genomes from yeast into wild-type and RE(-) M. capricolum recipient cells. The number of tetracycline-resistant, blue colonies obtained after the transplantation of M. mycoides YCp genomes from yeast into M. capricolum recipients was counted. Wild-type M. capricolum and M. capricolum RE(-) transplantation was performed using methods described in Figure 8. For untreated samples, yeast plugs were digested with β-agarase (melting step) and transplanted into both recipient cells. The treated samples were methylated and treated with proteinase K before the melting step. The mock-methylated sample was treated the same as the methylated samples, except that no extract or purified methyltransferases were added. VL6-48N yeast agarose plugs used in this experiment carried YCpMmycl .1.W303a yeast agarose plugs carried YCpMmycl.l, YCpMmycl.l that was engineered in yeast

(YCpMmycl. l-AtypeIIIres::URA3 or YCpMmycl. l-Atypefflres), or YCpMmycl.1-A500kb. The number of transplants is the average of at least three experiments. The error reported is the absolute mean deviation.

Example 4

Modification of donor genomes within yeast host cells

[0507] This example describes the use of methods for introducing a seamless modification into a Mycoplasma donor genome that has been cloned into a yeast host cell.

[0508] The yeast Saccharomyces cerevisiae has been developed as a host capable of cloning large DNA fragments, as both linear and circular yeast artificial chromosomes (YACs). Once cloned in yeast, these YACs can be manipulated using standard genetic tools. Transfer of this modified DNA to host cells suitable for expression allows the functional study of genes and their regulation. Cloning of whole bacterial genomes in yeast, and subsequent transplantation of such genomes back into their original cellular environments, has extended this application from the gene to the genome level.

[0509] Two-step recombination protocols utilizing counter-selectable markers can be used to modify YACs in yeast (Tucker and Burke (1996) Nucleic Acids Res, 24, 3467-3468). In these methods, a counter-selectable marker is first recombined into the YAC and selected for. Next, a new DNA fragment containing the desired alteration is recombined in place of the marker, which is selected against. The most frequently used marker in these procedures is the URA3 gene, which restores Uracil autotrophy in deficient strains. Counter-selection for the replacement of the URA3 gene is performed by treatment with 5-fluoroorotic acid (5- FOA) (Boeke et al, (1984) Mol Gen Genet, 197, 345-346). First, the method restores uracil auxotrophy, which can then be used again for a further round of modification. Second, the method creates a seamless modification. This basic method for seamless modification has been improved in a number of ways. The delitto perfetto method introduces a double-strand break (DSB) near the target locus by utilizing the endonuclease \-SceI (Storici et al. (2001) Nat Biotechnol, 19, 773-776). The formation of a DSB stimulates the efficiency of homologous recombination repair by several orders of magnitude (Storici et al. (2003) PNAS USA, 100, 14994-14999). Another method, referred to as tandem repeat pop-out, creates tandem repeat sequences flanking the target site (Akada et al. (2006) Yeast, 23, 399-405). This method requires only one transformation followed by 5-FOA counter-selection, whereas other methods require two transformations. These methods can be adapted for deletions, point mutations, or gene replacement.

[0510] The assembling and cloning of a synthetic M. genitalium genome as a circular YAC in yeast has been described by Gibson et al. {Science, 319, 1215-1220; and Gibson et al. (PNAS USA, 105, 20404-20409 (2008)). Yeast can be used as a platform to directly engineer or redesign a synthetic bacterial genome in vivo.

[0511] As described in individual sub-sections below, five different site-specific modification methods were performed to modify a target region (target locus) containing a single-based cytidine deletion (309,388) in the CDS139 locus of the synthetic

sMgTARBAC37 M. genitalium genome that had been introduced into and maintained in yeast host cells, as described by Gibson et al, Science 319, 1215 (2008) and U.S. Publication No. 20090275086, by Gibson et al, and as described in Example 1C, above.

[0512] The Saccharomyces cerevisiae strains VL6-48N (MATa his3-A200 trpl -Δ1 ura3- 52 lys2 ade2-101 metl4) and W303a (MATa ade2-l ura3-l his3-l l,15 trpl-1 leu2-3,112 canl-100 RAD5), carried the synthetic genome as described by Gibson et al, Science Id. and provided in Example 1, above. Yeast cells were grown in standard rich medium (YEPD) and synthetic dextrose (SD) or synthetic galactose (SG) minimal medium (Amberg et al. , (2005), "Methods in yeast genetics: A Cold Spring Harbor Laboratory Course Manual.," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp.230). [0513] The nucleic acid sequences of primers that were used in the various studies described throughout this Example (Example 4) are listed in Table 13. A dash in the primer sequence indicates that the primer was chimeric in structure. Portions of primer sequences that are homologous to M. genitalium portions are set forth in lowercase type. Portions of primer sequences that are not homologous to M. genitalium are set forth in uppercase type. The l-Scel cleavage site (see below) is set forth in underlined text. In the methods described in this example, all primers were custom-synthesized (Integrated DNA Technologies (IDT)). Primers longer than 60 bp were purified by polyacrylamide gel electrophoresis.

[0514] PCR constructs were introduced into the yeast strain containing the M. genitalium genome using lithium acetate integrative transformation according to a published method (Gietz et al. , Nucleic Acids Res, 20, 1425 (1992)), using 2-3 μg PCR product and 25 μg carrier DNA (Salmon testis DNA, Sigma).

Table 13: Primers used in mutagenesis studies

Example 4A

Modification using conventional two-step homologous recombination method.

[0515] A conventional two-step homologous recombination method (Rothstein, R.

Methods Enzymol, 194, 281-301 (1991)) was used in to introduce a site-specific mutation to correct the single base cytidine deletion in the synthetic M. genitalium genome that had been maintained in yeast. This method is illustrated schematically in Figure 12 A. i. Introduction of URA3 gene by homologous recombination - Traditional Sequence Replacement

[0516] Using primers listed in Table 13, the conventional method (traditional sequence replacement) was performed as follows. In the first step, which involved two sequential transformations, a URA3 gene (1,066 bp) was PCR amplified from the plasmid pRS306 (described in R. S. Sikorski and P. Hieter, Genetics 122, 19 (1989)) using primers URA-F and URA-R, the sequences of which are listed in Table 13, above. This amplified URA3 gene contained two 50-bp terminal sequences identical to portions of the region of the M.

genitalium genome that was targeted for mutation. The PCR reaction was performed using DNA polymerase (Takara, Madison, WI), under conditions recommended by the

manufacturer. The PCR product was introduced into the yeast strain containing the M.

genitalium genome using lithium acetate integrative transformation.

[0517] Individual Ura+ transformants were selected and analyzed by PCR, using diagnosis primers Seq-F and Seq-R, listed in Table 13, above, to confirm that the amplified URA3 gene had been inserted at the correct location within the donor genome. The Seq-F and Seq-R primers flanked the target locus (region of the target genome being modified), and were separated along the genome by 0.4 kb, such that amplification from a genome containing the URA3 marker replacement would produce a 1.35 kb PCR product (shown schematically in Figure 12 A). Products from the PCR reaction were separated on an agarose gel, which was visualized to verify correct insertion of the URA3 gene. ii. Second round of transformation: introduction of wild-type fragment and selection

[0518] For a second round of transformation, a 328 bp wild type DNA fragment

(homologous to a portion of the target region but not containing the CDS 139 locus single base deletion) was produced by PCR amplification with primers Amp-F, and Seq-R, listed in Table 13, above. This fragment was introduced into the t/ft iJ-replaced strains obtained from the first round of transformation using the lithium acetate integrative transformation method.

[0519] After the second round of transformation, cells were grown SD-HIS plate at 30°C overnight, to deplete the residual orotidine-5 '-phosphate decarboxylase (encoded by the URA3 gene) in any yeast cells that had lost the URA3 gene. SD medium supplemented with 5-fluoroorotic acid (FOA) (SD-HIS plates containing FOA) was used to select for URA3 gene loss (Boeke et al, Mol Gen Genet, 197, 345-346 (1984)).

[0520] Correction of the mutation was assessed via PCR of the genomic DNA from selected clones using the diagnosis primers, Seq-F and Seq-R (described above and listed in Table 13). The PCR reaction was performed using Takara DNA polymerase (Takara, Madison, WI), under conditions recommended by the manufacturer. PCR products were separated on an agarose gel. Using these primers, amplification of genomic DNA containing the CDS 139 locus (either the original locus with the single base deletion or the replaced wild type sequence) would give rise to a PCR product of 0.4 kb DNA fragment (data not shown).

[0521] Ninety-seven FOA resistant colonies were tested by this method. Full results are summarized in the first row of Table 14; as shown in Table 14, none of the FOA resistant colonies gave rise to the correct 0.4 kb fragment by PCR amplification of genomic DNA. This result suggested that no precise homologous recombination (HR) had occurred between the incoming wild type DNA fragment and the target site. Instead, loss of the URA 3 marker in these FOA-resistant colonies might have been caused by unwanted deletions. This possibility was likely, given that the M. genitalium genome, propagated as a circular YAC in yeast, does not have functional complementation with its host, aside from histidine prototrophy. Thus, deletions and rearrangement in donor bacterial genome would likely have been neutral to host cell viability.

Hi. Multiplex PCR

[0522] To test this possibility by evaluating the integrity of the M. genitalium genomes in selected yeast, Multiplex PCR (MPCR) was performed as described by Gibson et al. , PNAS USA, 105(51):20404-9 (2008) and Gibson et al, Science 319, 1215 (2008). Isolation of total DNA from the yeast for PCR analysis was performed according to a published protocol (Kouprina and Larionov, Nat. Protoc. 3, 371 (2008)), as described in Example 3, above. The primer set for MPCR (set 3) was designed to produce 10 amplicons (ranging from 125 bp to 1025 bp, in 0.1 kb increments) distributed around the M. genitalium genome approximately every 60 kb DNA (Gibson et al, PNAS USA, 105(51):20404-9 (2008)). Multiplex PCR was done using Multiplex PCR Kit from Qiagen (Valencia, CA). A 1/50 volume (2 μΐ) of the DNA extract and 1 μΐ of a 10X primer stock containing 20 oligos at 5 μΜ each were included in each 10-μ1 reaction. Cycling parameters were 94° C for 15 min, then 35 cycles of 94° C for 30 s, 52° C for 90 s, and 72° C for 90s, followed by a single 3-min incubation at 72° C. Then 2 μΐ of each reaction was loaded onto a 2 % E-gel (Invitrogen) and 72 V was applied for 30 minutes. Bands were visualized using an Amersham Typhoon 9410 Fluorescence Imager.

[0523] The results showed that for each of twenty-two FOA-resistant colonies, amplification of total DNA did not give rise to all ten amplicons. Two amplicons, 0.55 and 0.65 kb in length (which cluster together in M. genitalium genome), were not produced by MPCR of any of the FOA-resistant clones. The CDS 139 target locus locates 3 kb upstream of the 0.65 kb amplicon (gel results not shown).

[0524] This result demonstrated that some unspecific deletions or rearrangements had occurred in the M. genitalium genome propagated in yeast. Loss of the URA3 marker in these clones (evidenced by their selection with FOA) had likely resulted from homologous recombination among repetitive sequences in M, genitalium genome. Cells in which the URA3 marker was deleted as a result of this recombination were able to survive on FOA medium. Thus, with this non-conventional method, there was a higher probability of nonspecific loss of the URA3 gene than replacement of URA3 replacement by the intended recombination event with the introduced wild-type DNA fragment. [0525] This problem with the conventional modification methods is illustrated schematically in Figure 9, where introduction of the wild-type fragment into yeast carrying the M. genitalium with URA 3 insertion (Figure 9A) (as generated in Example 4A(i), above), followed by selection on SD-HIS plates containing FOA, results in selection of two different types of recombination events (PI (recombination between the wild-type fragment and the genome) and P2 (recombination among repeats within the genome)) (Figure 9B). These events would produce cells carrying the alternative products illustrated in Figure 9C. Because the M. genitalium genome contains multiple repeats, the probability of nonspecific loss of the URA3 gene (P2) was greater than the probability of loss due to the intended recombination (PI). Prevalent nonspecific loss likely accounts for the observed lack of any clones containing the intended sequence, using this conventional method. These results demonstrate the need for improved methods for modifying donor genomes in yeast host cells.

Table 14: Number of correct sequence replacements and complete Mycoplasma genitalium amplicons among FoA+ clones

Example 4B

Alternative seamless modification methods

[0526] Two other seamless modification methods, which are reported to be more efficient, were used in attempt to modify the same target region of the synthetic M. genitalium donor genome in yeast, described above. i. Delitto Perfetto

[0527] The first of the two reportedly efficient methods, delitto perfetto (Storici, F. et al, Nat Biotechnol, 19, 773-776 (2001)), is illustrated schematically in Figure 10A. In this method, introduction of a double-strand break into a target DNA site stimulates

recombination by several orders of magnitude.

[0528] The delitto perfetto method used herein used a construct having a 50 bp sequence homologous to the region upstream of the target locus and a 50 bp sequence homologous to the region downtream of the target locus flanking a CORE cassette that includes: a nucleic acid sequence recognized by a particular endonuclease, an inducible promoter, a gene encoding the particular endonuclease under the control of the inducible promoter, and a selectable/ counterselectable marker (Figure 10A). Thus, the cassette is designed such that, upon induction of expression of the endonuclease, the endonuclease cleaves at its recognition site within the cassette, generating a double-strand break and increasing recombination efficiency at the desired site. a. Generation of dellitto perfetto cassette

[0529] The delitto perfetto mutagenesis cassette was generated by fusion PCR to fuse a first fragment, containing the GALl promoter (inducible promoter) and the l-Scel gene (endonuclease-encoding gene), to a URA3 (selectable/counterselectable marker) gene fragment. The URA3 gene fragment (1,066 bp) was amplified, as described in Example 4A, above, from plasmid pRS306, using primers URA-F and URA-R, listed in Table 13, above. The 1 , 184 bp fragment containing the GALl promoter and the l-Scel gene (GALl/l-Scel gene fragment) was amplified from the plasmid pGSKU (described in Storici et al., PNAS USA, 100, 14994-14999 (2003)), using the primers Gal-F and Gal-R, listed in Table 13, above. Fusion PCR was carried out using a recombinant PCR technique, essentially as described in Shevchuk et al, Nucleic Acids Res, 32, el 9 (2004). b. First round of transformation

[0530] The cassette was introduced into the yeast strain containing the M. genitalium genome, using lithium acetate integrative transformation. Individual Ura+ transformants were selected and analyzed by PCR, using diagnostic primers Seq-F and Seq-R (shown as small, single-head arrows flanking the insertion site in Figure 10A), listed in Table 13, above, to confirm that the gene had been inserted at the correct location within the donor genome. PCR of genomes containing the inserted cassette using these primers would produce a 2.5 kb product. Products from the PCR reaction were separated on an agarose gel, which was visualized to verify correct insertion of the URA3 gene. c. Induction of endonuclease expression and second-round

transformation

[0531] Clones testing positive in the PCR reaction with diagnostic primers were grown in SD/galactose/-HZS medium for 4 hours to induce expression of the I-Secl endonuclease, which was controlled by the GAL1 promoter and thus expressed when yeast were grown in medium containing galactose as the only carbon source. Induced expression of the endonuclease was intended to produce a double-strand break by cleaving the 18 bp recognition sequence within the cassette, located just downstream of the region of homology to the genome. After induction, the wild-type DNA fragment was transformed into the cells as described in Example 4A, above.

[0532] Cells were grown on SD-HIS plates containing FOA to select for cells that had lost the URA3 marker, as described in Example 4A. Diagnostic PCR using the Seq-F and Seq-R primers was performed to determine whether selected FOA-resistant cells contained genomes in which the cassette had been replace with the wild-type fragment (which would have produced a PCR product of 400 base pairs). As indicated in Table 14, above, none of sixty tested FOA-resistant isolates produced the amplicon of the correct size. The results revealed that the M.genitalium genomes from sixty FOA resistant isolates contained imprecise deletion ofthe CDS139 locus. ii. Tandem repeat pop-out

[0533] The second of the two reported seamless deletion methods, the tandem repeat pop- out, was based on a precise excision of a nucleic acid segment by homologous recombination (HR) between two tandem repeat sequences and is described in Akada et al, Yeast, 23, 399- 405 (2006). This technique can be adapted for use in gene replacement. With this method, instead of correction of the single-base deletion, a seamless deletion of the CDS 139 locus was performed in the same yeast strain harboring the M. genitalium genome. a. Generation of the tandem repeat cassette by fusion PCR

[0534] A fusion product was generated that contained the URA3 marker and a 358 bp fragment ("repeat" fragment) homologous to a portion just upstream of the target locus (large arrow labeled as "repeat" in Figure 10B). The 1,066 bp URA3 marker fragment was produced by PCR using the Ura-F and Ura-R primers (Table 13), using the same method as described in Example 4A. The 358 bp repeat fragment was produced by PCR amplification with Amp-F and Seq-R primers, listed in Table 13.

[0535] The two Portions were joined by fusion PCR, using a recombinant PCR technique, as described in Example 4B(i), above, as follows. First, chimeric fusion primers Fusl and Fus2, listed in Table 13, above, each containing a portion of homology to the URA3 gene and the "repeat" fragment, were used in a PCR to amplify the URA 3 gene and in another PCR to amplify the repeat fragment. The product from each reaction included a region of homology to the product of the other reaction, for a total of 40 base pairs of overlapping homologous sequence shared between the two amplified products. The products then were subjected to cycles of PCR without primers, with a low annealing temperature to join the products, yielding a fusion product containing the joined fragments.

[0536] To generate the final mutagenesis cassette (see Figure 10B), the fusion product was PCR-reamplified, using the chimeric primers UM2-70 and MUT-70, listed in Table 13, above. As shown in that table, each of these primers contained homology to the fusion product and 50 base pairs (bp) of homology to the target region (5' end; lowercase). The resulting cassette (illustrated in Figure 10B) contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), the URA3 marker, the repeat cassette, and 50 bp of homology to a 3' portion of the target region. The cassette was designed in this orientation so that upon transformation into the yeast host cells, replacement of a 450 base pair target region within the CDS139 locus of the M. genitalium genome with this cassette (by HR) would result in a region in the genome containing two tandem repeat sequences (large arrows in Figure 14B labeled as "repeat") flanking the URA3 selection marker. The tandem repeat sequences were included to facilitate deletion (pop-out) of the cassette by homologous recombination between the two repeat sequences. Such an event would remove the URA 3 marker and could be selected for by growth on FOA- containing medium. b. Transformation and analysis

[0537] The cassette was introduced into the yeast strain containing the M. genitalium genome, using lithium acetate integrative transformation. Individual Ura+ transformants were selected and analyzed by PCR, using the diagnostic primers, Seq-F and M2-detl-R (shown as small, single-head arrows flanking the insertion site in Figure 10B), listed in Table 13 above, to confirm that the gene had been inserted at the correct location within the donor genome. PCR of wild-type genomes with these primers would produce a 1 kb product. PCR of genomes containing the inserted cassette, on the other hand, produced a 1.973 kb product. Products from the PCR reaction were separated on an agarose gel, which was visualized to verify correct insertion of the URA3 gene.

[0538] Cells testing positive by PCR for the correct insertion were grown on SD-HIS plates containing FOA to select for cells losing the URA3 marker, as described in Example 4A. Diagnostic PCR using the primers Seq-F and M2-detl was performed to determine whether selected FOA-resistant cells contained genomes in which the cassette had been deleted, leaving a seamless deletion of a 450 base-pair portion of the target region. PCR with these primers on genomes in which such precise deletion had occurred would have yielded a 0.55 kb product. As indicated in Table 14, above, none of the thirty-eight FOA-resistant isolates yielded a product in this PCR amplification.

[0539] MPCR was performed, as described in Example 4A, on DNA from nine of the FOA-resistant isolates. As indicated in Table 14, above, only one out of these nine isolates generated a complete replicon (all 10 products). Absence of a complete replicon indicated that recombination had occurred between repetitive sequences within the donor genome itself. This result suggested that the frequency of recombination between the tandem repeat sequences flanking the URA 3 marker was much lower than recombination among repetitive sequences in M.genitalium genome.

[0540] Results from the studies described in Examples 4A and this example (4B), collectively indicated that the'known methods based on the URA3/FOA system were not sufficient in this particular system to manipulate and engineer the M.genitalium donor genome in these yeast host cells and that the majority of FOA-resistant colonies recovered in these studies had nonspecifically lost the URA 3 marker via unintended recombination events during the course of manipulation, demonstrating a need for improved methods for modifying donor genomes in yeast host cells.

Example 4C

Modification Method using Tandem Repeats and Endonuclease Cleavage (TREC)

[0541] Based on the results of the studies described in Examples 4A and 4B, it was reasoned that frequency of recombination between the intended tandem repeats in the pop-out method (Example 4B(ii)) might be enhanced by an introduction of a double-strand break near the target locus. Provided is such a method (TREC), which uses tandem repeats and endonuclease cleavage (TREC) and can be used to modify donor nucleic acids in yeast host cells. This Example describes the use of this provided method to modify the same target locus in the M. genitalium donor genome in yeast. The results of the study confirm that the introduction of ds break near the target site increases recombination efficiency via tandem repeats in this system.

[0542] A method was designed to reduce background of unspecific loss when counter- selecting against the URA3 marker and create both tandem repeat sequences and a double strand break near the target site, which greatly enhances the efficiency and specificity of target-specific recombination. This TREC method is efficient enough to seamlessly engineer an M. genitalium genome in yeast. i. Generation of TREC Cassette

[0543] In another example, the TREC mutagenesis construct was generated by fusing the (GAL1/I-Scel)-URA3 fusion product (produced as described in Example 4B(i)) with the 358 bp "repeat" fragment located upstream of the target locus (described in Example 4B(ii)). Fusion of the (GAL1A-Scel)-URA3 product and the repeat fragment was carried out by fusion PCR, as follows. Chimeric primers, Fusl and Fus2 (listed in Table 13, above), each having portions of homology to the (GALlA-SceT)-URA3 fusion product and the repeat fragment, were used in a PCR amplification with the (GAL1A-Scel)-URA3 fusion product as a template and in another PCR amplification with the "repeat" fragment as a template. The products then were subjected to a primer-less PCR, as described in Example 4A and 4B, above, to generate a ((GALl/I-SceI)-URA3 Repeat fusion product. [0544] The ((GAL1A-Scel)-URA J)-Repeat fusion product then was amplified using the Sce-Intl and the MUT-70 primers, listed in Table 13, above. As shown in that table, each of these primers contained homology to the ((GALl/I-Sce/)-t/iL43)-Repeat fusion product and 5' 50 base pair (bp) portions of homology to portions at the ends of the target region (5' lowercase portion). The Sce-Intl primer further contained an l-Scel recognition site

(underlined).

[0545] The resulting TREC cassette (illustrated in Figure IOC) contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), a CORE cassette (consisting of the 18 bp l-Scel recognition site, the GAL1 promoter, a gene encoding l-Scel endonuclease and the URA3 marker), the "repeat" (358 bp portion homologous to sequence of the genome just upstream of the target locus), and 50 bp of homology to a 3' portion of the target region (downstream of the single-base deletion being corrected).

[0546] Thus, this cassette was designed so that upon transformation into the yeast host cells, replacement of a 450 base pair target region within the CDS139 locus of the M.

genitalium genome with this cassette (by HR) would result in a region in the genome containing two tandem repeat sequences (large arrows in Figure 10B labeled as "repeat") flanking the URA3 selection marker and an endonuclease cleavage site that could be inducibly cleaved by promoting endonuclease expression by growth on galactose. As in the tandem repeat pop-out method, the tandem repeat sequences were included to allow seamless deletion by homologous recombination between the two repeat sequences. As in the delitto perfetto method, the inducible endonuclease gene and the endonuclease recognition site were included to allow inducible double-strand break production at the desired site of

recombination. Selection of seamless deletion by recombination could be carried out by growth on FOA-containing medium. ii. Transformation and selection

[0547] The TREC cassette was introduced into the yeast strain containing the M.

genitalium genome, using lithium acetate integrative transformation. Individual Ura+ transformants were selected and analyzed by PCR, using the diagnostic primers Seq-F and M2-detl (shown as small, single-head arrows flanking the insertion site in Figure IOC), listed in Table 13, above, to confirm that the gene had been inserted at the correct location within the donor genome. PCR of genomes containing the inserted TREC cassette using these primers would produce a 2.884 kb product. Products from the PCR reaction were separated on an agarose gel, which was visualized to verify correct insertion of the URA3 gene. iii. Induction of endonuclease expression, FOA selection, and evaluation

[0548] Clones then were replica-plated onto plates containing SG (synthetic galactose)- His and SD-HIS (containing glucose) and grown for 24 hours. Growth on SG medium, containing galactose as the only carbon source, was done to induce expression of the I-Secl endonuclease, controlled by the GAL1 promoter. Growth on SD-HIS plates under the same conditions was carried out as a control. Expression of the endonuclease was intended to produce a double-strand break by cleaving the 18 bp recognition sequence within the cassette, located just downstream of the region of homology to the genome. After 24 hours of incubation, induced and control (non-induced) cells were replica-plated onto SD-HIS plates containing FOA (SD-HIS + FOA) to select for cells that had lost the URA3 marker, as described in Example 4A.

[0549] Cells that had been subjected to galactose induction produced a large number of colonies when grown on SD-HIS + FOA. Control cells, on the other hand, produced few colonies. Cells were re-streaked to obtain FOA-resistant single colonies derived from both induced and uninduced cells. Diagnostic PCR using the Seq-F and M2-detl diagnostic primers (listed in Table 13, above) was performed to determine whether selected FOA- resistant cells contained genomes in which the TREC cassette had been removed, resulting in seamless deletion of a portion of the target locus. PCR of genomes containing the seamless deletion yielded a product of 0.55 kb. All twenty-four colonies tested from the galactose- induced cells contained the M. genitalium genome with the intended modification. Only two positive clones were isolated from uninduced cells.

[0550] Integrity of the M. genitalium genome was further analyzed by MPCR on the first ten induced and uninduced clones tested by diagnostic PCR analysis, as described in

Examples 4A and 4B, above. PCR of DNA from all ten tested galactose-induced colonies yielded a complete replicon (all 10 amplicons); PCR on DNA from the uninduced cells did not generate complete replicons (data now shown). These results are summarized in Table 14, above. The results demonstrate the successful seamless deletion of a portion of a bacterial donor genome within yeast host cells with high efficiency. iv. Exemplary TREC

[0551] The complete synthetic Mycoplasma genitalium genome (-583 kb) has been assembled and cloned as a circular plasmid in the yeast Saccharomyces cerevisiae. Attempts to engineer the cloned genome by standard genetic methods involving the URA3/5- fluoroorotic acid (5-FOA) counter-selection have shown a high background of 5-FOA resistant clones derived from spontaneous deletions of the bacterial genome maintained in yeast. Here, we report a method that can precisely modify the bacterial genome in yeast with high efficiency. This method involves two sequential homologous recombination events. First, the target region is replaced with a mutagenesis cassette that consists of a knock-out CORE (anl8-bp \-SceI recognition site, the l-Scel gene under the control of GALl promoter, and the URA3 gene) and a DNA fragment identical to the sequence upstream of the target site. The replacement generates tandem repeat sequences flanking the CORE. Second, galactose induces the expression of 1-SceI which generates a double-strand break (DSB) at the 1-SceI site. This DSB promote intra-molecular homologous recombination between the repeat sequences, leading to an excision of the CORE. As a result, it creates a seamless modification. This method can be adapted for a variety of genomic modifications and, therefore, provides an alternative way to modify and design synthetic genomes in yeast.

Materials and Methods

Yeast strains and media

[0552] Saccharomyces cerevisiae yeast strains VL6-48N (MATa his3-A200 trpl-ΔΙ ura3- 52 lys2 ade2-101 met 14) and W303a ( MATa ade2-l ura3-l his3-l l,15 trpl-1 leu2-3,112 canl-100 RAD5) housing a 0.6 Mb Mycoplasma genitalium whole genome YAC were constructed as previously described (Lartigue et al. (2009) Science, 325, 1693-1696; and Gibson et al. (2008) PNAS USA, 105, 20404-20409). Yeast cells were grown in standard rich medium (YEPD) and synthetic dextrose (SD) or synthetic galactose (SG) minimal medium (Amberg et al. (2005) Methods in yeast genetics: A Cold Spring Harbor Laboratory Course Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp.230). SD medium supplemented with 5-fluoroorotic acid (5-FOA) was used to select for URA3 gene loss (Boeke et al. (1984) Mol Gen Genet, 197, 345-346). Production of mutagenesis cassettes

[0553] All primers were custom synthesized (Integrated DNA Technologies). Primers longer than 60 bp were purified by polyacrylamide gel electrophoresis. Primers used for construction of all mutagenesis cassettes are summarized in Table 13. The URA3 gene (1,066 bp) was amplified from the plasmid pRS306 (Sikorski and Hieter (1989) Genetics, 122, 19- 27); the GALl promoter (450 bp) was amplified from the plasmid pYES2 (Invitrogen); the 1,184 bp fragment containing the GALl promoter and the l-Scelge was amplified from the plasmid pGSKU (Storici et al. (2003) PNAS USA., 100, 14994-14999); and the Cre recombinase gene (1,032 bp) was amplified from the plasmid pBS185 (Sauer and Henderson (1990) New Biologist 2, 441-449).

[0554] All PCRs were performed with Takara Ex Taq DNA polymerase (Takara Bio Inc.) using the conditions recommended by the manufacturer. Gene fusions were performed by a recombinant PCR technique (Shevchuk et al. (2004) Nucleic Acids Res, 32, el9) with minor modifications. In each case of PCR-based fusion, complementary ends overlapped by 40 bp (Table 13). To generate each final mutagenesis cassette, a fusion product was PCR- reamplified by chimeric primers, each containing 50 bp of homology to the target site (Table 13).

[0555] Primers containing a dash in the middle are chimeric in structure; lowercase letters indicate M. genitalium homologous sequences; uppercase letters indicate non-homologous sequences; and underlined is l-Scel cleavage site.

Transformation and PCR analysis

[0556] Lithium acetate integrative transformation was performed according to a published method (Gietz et al. (1992) Nucleic Acids Res, 20, 1425). Two to three μg of integrative construct DNA and 25 μg of carrier DNA (salmon testis DNA, Sigma) were used in routine experiments. Isolation of total DNA from yeast for PCR analysis was performed according to a published protocol ( ouprina and Larionov. (2008) Nat Protoc, 3, 371-377). Correct integration of each mutagenesis cassette was verified by PCR using primers located upstream and downstream of the target site (Table 13). Multiplex PCR was used to confirm completeness of M. genitalium clones as described previously (Gibson et al. (2008) PNAS USA, 105, 20404-20409). The primer set used for multiplex PCR (set 3) was designed to produce 10 amplicons (ranging from 125 bp to 1025 bp in 0.1 kb increments) distributed around the M. genitalium genome approximately every 60 kb (Gibson et al. (2008) PNAS USA, 105, 20404-20409).

Results

[0557] Engineering a point mutation in the MG259 locus of a synthetic M. genitalium genome maintained in yeast by the classical method involved two homologous recombination events (Figure 12 A). After the first homologous recombination, the exact replacement of a target region in the synthetic genome with the URA3 gene was confirmed by PCR. After the second round of homologous recombination, however, we were not able to identify the correct replacement of the URA3 gene with the DNA segment by PCR screening from 5-FOA resistant colonies (Figure 12B and Table 15).

Table 15:

Efficiency of several yeast DNA modification methods in engineering an M. genitalium genome in yeast

[0558] Unique PCR primer sets were used to analyze FOA+ clones for the correct replacement. Ten primer pairs were used for multiplex PCR analysis. Production of all ten amplicons was considered a complete genome.

[0559] These results suggest that a precise homologous recombination did not occur between the incoming DNA fragment and the target site. The loss of the URA 3 marker might be due to unexpected deletions. The M. genitalium genome propagated as a circular YAC in yeast does not have functional complementation with its host, except histidine prototrophy. Any deletion and rearrangement in the bacterial genome is likely neutral for the yeast's viability. Multiplex PCR was used to evaluate the integrity of the M. genitali m genome in yeast. The primer set was designed to produce 10 amplicons (ranging from 125 bp to 1025 bp in 0.1 kb increments) distributed around the M. genitalium genome approximately every 60 kb. Total DNA prepared from 22 5-FOA-resistant colonies did not give rise to all ten amplicons (Figure 12C). Two amplicons, 0.525 and 0.625 kb (adjacent in the M. genitalium genome), were missing in all clones. The MG259 locus is located 3 kb upstream of the 0.65 kb amplicon. This result demonstrates that some spontaneous deletions or rearrangements occurred in the M. genitalium genome propagated in yeast. The loss of the URA3 marker may have resulted from homologous recombination among repetitive sequences in the M.

genitalium genome. As a result, the cells with the URA3 marker deletion could survive on 5- FOA medium. The probability of unspecific loss of the URA3 gene is higher than that of URA3 replacement by the incoming DNA fragment (Figure 12D). We also employed two other methods to engineer the same locus and produce a point mutation or 450 bp deletion by the delitto perfetto or the tandem repeat pop-out method, respectively (strategies outlined in Figure 10A and 10B). However, we were not able to identify any correct modifications by PCR screening 5-FOA resistant colonies (Table 15). Therefore, we concluded that the majority of 5-FOA-resistant colonies were derived from cells that unspecifically lost the URA3 marker during the course of manipulation.

[0560] The frequency of recombination between two tandem repeats might be greatly enhanced by the introduction of a DSB near the target site. Therefore, we combined two strategies- the tandem repeat pop-out method and the delitto perfetto method. A mutagenesis construct was generated by fusing a CORE cassette with 358 bp of DNA upstream of the target site. Replacement of the 450 bp target region with this construct would produce two repeat sequences encompassing the CORE, which contains the l-Scel recognition site (Figure 13). Then, homologous recombination between the repeats would result in a seamless deletion. Following transformation of the mutagenesis construct into yeast, I-Scel endonuclease expression was induced on SG-minus HIS agar. After 24-hours of incubation, cells were replica-plated onto SD-minus HIS+5-FOA agar. Cells with galactose induction produced significantly more colonies on SD-HIS+5-FOA agar than uninduced cells (data not shown). 5-FOA-resistant cells derived from both induced and uninduced cells were re- streaked, and single colonies selected and analyzed. Transformants with the correct deletion were identified by PCR. DNA with precise removal of the CORE cassette would result in the generation of a 0.55 kb amplicon. All 24 colonies derived from the galactose-induced cells contained the correct modification of the M. genitalium genome; only 2 positive clones were isolated from colonies derived from uninduced cells (data not shown). M.gemtalium genomic integrity was further evaluated by multiplex PCR. DNA from 10 induced clones that were examined produced the complete set of 10 amplicons. DNA from uninduced cells did not generate the complete set of 10 amplicons data not shown). Hence, results from both PCR analyses demonstrate that the TREC method can perform a seamless deletion on a bacterial genome cloned in yeast with a high efficiency (Table 15).

[0561] Finally, the efficiency of the TREC method was compared with that of the Cre- loxP system for deletions in a bacterial genome cloned in yeast. The Cre-loxP system is a highly efficient site-specific recombination method. It has been successfully used for removing selection markers and large genomic DNA segments in a wide range of organisms (Gueldener et al. (2002) Nucleic Acids Res, 30, e23). A mutagenesis construct was made by two rounds of PCR (Materials and Methods). It consisted of the URA3 marker, the Cre gene under the control of the GAL1 promoter, and two mutant loxP sites flanked by the two terminal sequences homologous to the target site (Figure 15). The mutant loxP sites prevent a reverse recombination event (Araki, et al. (1997) Nucleic Acids Res, 25, 868-872).

[0562] The same region that was modified previously was targeted by this construct. A similar procedure and analyses were carried out to produce and detect the site-specific deletions. PCR analysis showed that 93% (28/30) of the 5-FOA resistant isolates contained the desired deletion and multiplex PCR results suggested that 100% (4/4) of isolates with the correct deletion contained the complete M. genitalium genome (Table 15). In conclusion, the efficiency of the TREC method is comparable with that of the Cre-/oxP system in

engineering an M. genitalium genome cloned in yeast.

[0563] Seamless genome engineering often requires a counter-selectable marker that can be selected against and subsequently removed. Several existing methods that adapt the counter-selection URA3/5-FOA system have been successfully demonstrated for

modification in yeast chromosomes (Rothstein (1991) Methods Enz mol, 194, 281-301). However, we have shown that those methods are not suitable for engineering an M.

genitalium genome episomally maintained in yeast. The synthetic M. genitalium genome was shown to be stably maintained in yeast even though the genome contains up to 4% of repetitive sequences (Peterson et al. (1995) PNAS USA, 92, 11829-11833). Thus, spontaneous deletions or rearrangements might still occur in low frequency while maintaining in yeast. This would potentially generate unwanted URA3 -negative clones during the course of manipulation and therefore complicate 5-FOA selection for site-specific mutagenesis.

[0564] We demonstrated that the TREC method can efficiently generate a seamless modification of the M. genitalium genome in yeast. It is a simple method that only needs a single transformation and is adaptable to other kinds of modifications (insertions, gene replacements, or point mutations). The preparation of the mutagenesis construct takes less than a day. In fact, rather than performing the fusion reaction, we found that co- transformation of the CORE cassette and the repeat fragment with 50 bp of overlap to each other was enough to obtain a correct gene replacement (data not shown). The high frequency of homologous recombination when using the TREC method is mainly attributable to the fact that every cell, in principle, is engaging in repair during the induction of the DSB and that the repair substrates (repeat sequences and DSB) are in close proximity. The performance of TREC is comparable with the Cre/loxP system. However, since TREC does not leave a scar it is more valuable than the Cre/loxP system in genomic engineering. Recently, a new method, called MIRAGE, was shown to produce a seamless modification of the yeast genome with high efficiency. This method is based on the introduction of an inverted repeat near the target site, flanked by two short tandem repeats. The unstable inverted repeat greatly promotes an excision between the two tandem repeats. However, inverted repeat sequences also introduce the potential problem of imprecise deletion due to replication slippage

(Gordenin et al. (1992) PNAS USA, 89, 3785-3789). Another drawback of using the

MIRAGE method is that the generation of the knock out construct is time consuming, as it requires a two day preparation.

[0565] Delivering an engineered bacterial genome carried as a YAC back to its original cell can determine the function and regulation of genes and gene clusters (Vrancic et al. (2008) Food Tech Biotechnol 46, 237-251). Seamless modification is a favorable means of engineering a YAC, since additional sequences remaining in engineered site could potentially cause unexpected consequences. Additionally, chromosomes of many higher eukaryotic cells contain a high fraction of repetitive sequences. The method described here should be beneficial for modifying their gene(s) cloned in yeast. We have also applied this method to generate a seamless deletion of a Type III restriction enzyme in a Mycoplasma mycoides large colony (M. mycoides LC) genome cloned in yeast. A precise deletion was confirmed by sequencing. Subsequent genome transplantation has created an M. mycoides LC strain with a genome deletion that would be difficult to make in the host cell, due to limited genetic tools in this organism (Lartigue et al. (2009) Science, 325: 1693). Yeast has been successfully demonstrated as a host for the assembly of the whole M.genitalium genome. TREC provides a complementary mean to design synthetic genomes that can be used to create synthetic cells.

[0566] The use of yeast provides advantages over E. coli becausecloning foreign DNA greater than 300 kb in E. coli is not very common, which limits its application. Yeast cells, on the other hand, provide the capability of mega-base pair cloning.

Example 4D

Cre-LoxP Modification System

[0567] For comparison, a known modification system for bacterial genome modification, the Cre-loxP system, was used to modify the same bacterial genome in yeast host cells. The Cre-loxP system is a known efficient site-specific recombination method that has been successfully used to remove selection markers and large genomic DNA segment in a large number of different organisms. See Gueldener et al, Nucleic Acids Res, 30, e23 (2002).

[0568] A Cre-loxP mutagenesis construct with mutant loxP genes was produced by two rounds of PCR reactions, as described in the previous examples. Mutations of loxP prevent reverse recombination events, as described in Araki, . et al, Nucleic Acids Res, 25, 868-872 (1997). i. Generation of Cre-loxP Cassette

[0569] The loxP-RE-GALl-Cre-URA3-loxP-LE mutagenesis cassette was produced using a Cre recombinase gene ORF fragment (1,032 bp) amplified from the plasmid pBS185 (Sauer and Henderson. New Biologist 2, 441-449 (1990)), using Cre-F and Cre-R primers (Table 13), a GAL1 promoter (450 bp) amplified from the plasmid pYES2 (Invitrogen, Carlsbad, CA)) using the primers Gal-F and Gal-R (Table 13), and a 1066 bp URA3 gene fragment produced by PCR as described in the previous examples, using the Ura-F and Ura-R primers (Table 13). [0570] A Gall-Cre-URA3 fusion product was generated using PCR fusion using the Cre- Fus2 and Cre-Fus4 primers (Table 13), and mutant loxP sites were introduced by

amplification of the fusion product using chimeric primers Lox-F and Lox-R (Table 13) which contained portions of homology to the GAL1-Cre-URA3 fusion product and mutant LoxP sites. This amplification generated LOXP-RE-GAL1-CTQ-URA3-IOXP- E fusion product. This fusion product then was amplified using the Int-F2 and Int-R2 primers, listed in Table 13, above. As shown in that table, each of these primers contained homology to the LoxP-KE- GALl-CiQ-URA3-loxP-LE fusion product and 5' 50 base pair (bp) target region homology segments (in lowercase type).

[0571] The resulting LoxP-KE-GALl-Cre-URA3-loxP-LE mutagenesis cassette (illustrated in Figure 10D) contained, in the following order, 50 bp of homology to a 5' portion of the target region (upstream of the single-base deletion), a first loxP site (loxP-KE), the GAL1 promoter, a Cre recombinase gene ORF, the URA3 marker, a second loxP site (loxP-LE), and 50 bp of homology to a 3' portion of the target region (downstream of the single-base deletion). Thus, this cassette was designed so that upon transformation into the yeast host cells, replacement of a 450 base pair target region within the CDS 139 locus of the M.

genitalium genome with this cassette (by HR) would result in a region in the genome containing loxP sites that could be inducibly targeted for recombination and deletion by inducing Cre expression from the same cassette by growth on galactose. Deletion of the cassette, which contained a URA3 marker, could be selected for by growth on FOA medium. ii. Transformation and selection

[0572] The loxP-Cre cassette was introduced into the yeast strain containing the M.

genitalium genome, using lithium acetate integrative transformation. Individual Ura+ transformants were selected and analyzed by PCR, using the diagnostic primers Seq-F and M2-detl (shown as small, single-head arrows flanking the insertion site in Figure 10D and listed in Table 13) to confirm that the gene had been inserted at the correct location within the donor genome. This PCR of genomes containing the inserted loxP-Cre cassette would produce a 3.068 kb product. Products from the PCR reaction were separated on an agarose gel, which was visualized to verify correct insertion of the cassette. iii. Induction of endonuclease expression, FOA selection, and evaluation

[0573] Clones then were replica-plated onto plates containing SG (synthetic galactose)- His and SD-HIS (containing glucose) and grown for 24 hours. Growth on SG medium, containing galactose as the only carbon source, was done to induce expression of the Cre recombinase, which was controlled by the GAL1 promoter. Expression of the recombinase was intended to induce recombination at the LoxP sites within the cassette. After induction, cells were replica-plated onto SD-HIS plates containing FOA (SD-HIS + FOA) to select for cells that had lost the URA3 marker, as described in Example 4A.

[0574] 5-FOA resistant colonies were subjected to diagnostic PCR (as described in Examples 4A-C) using the Seq-F and M2-detl primers (Table 13) to determine whether selected FOA-resistant cells contained genomes in which the cassette had been removed, resulting in seamless deletion of a portion of the target locus. As presented in Table 14, the results indicated that 93 % of the 5-FOA-resistant isolates tested (28/30) contained the desired deletion.

[0575] Integrity of the M. genitalium genome was further analyzed by MPCR on four of the clones testing positive by diagnostic PCR analysis, as described in Examples 4A and 4B, above. As indicated in Table 14, above, 100 % (4/4) of these colonies contained all 10 amplicons, evidencing the completeness of the genomes.

[0576] Results from the studies presented in Examples 4C and 4D indicated that for modification of Mycoplasma genomes in yeast host cells, the efficiency of the provided TREC method (which is a simple method that can be performed with a single transformation and is adaptable to deletion, insertion, gene replacement and point mutation) was equal, if not greater, than that of the well-known cre-loxP modification method. Unlike the Cre-loxP method, however, the TREC method resulted in seamless modification, making it

exceptionally advantageous.

EXAMPLE 5

Transfer of donor genome into host cells, modification by TREC within host cells, and transplantation into recipient cells

[0577] This Example describes manipulation of a donor genome using a combination of the provided methods for transferring donor genomes into host cells, modifying donor genomes within host cells (TREC modification), and transplantation of donor genomes into recipient cells. The methods were used to successfully engineer an M. mycoides LC genome in yeast that did not previously exist either in the laboratory or in nature. As described below, the Type III restriction enzyme gene was deleted from a donor M. mycoides LC genome that had been cloned in a yeast host. The Type III restriction enzyme gene was chosen because it was expected to be nonessential for viability and transplantation. The modified genome then was transplanted into M. capricolum recipient cells, generating a new cell containing a modified whole genome.

Example 5A

Transfer of donor genome into host and modification of the genome

[0578] The M. mycoides LC-YCp genome was transferred to and propagated in yeast strain W303a, as described in Example 1A, above.

[0579] In one example, the type III restriction enzyme gene was replaced with a cassette containing a URA 3 marker, which was subsequently removed by 5-fluoroorotic acid (5-FOA) selection, using the TREC method described in Example 4C, above. For this process, which is illustrated schematically in Figure 11, a TREC knockout cassette was generated by PCR fusion, as described in Example 4C, above, with the following details. First, a CORE cassette (containing a GAL1 gene, a Seel gene and a URA3 marker, in that order) was generated.

[0580] A tandem repeat sequence (TRS) fragment also was generated by PCR. This fragment contained homology to a portion of the M. mycoides LC genome, upstream of the Typelll Restriction enzyme target locus. The TRS fragment and corresponding homologous portion in the genome upstream of the target region are labeled with large horizontal arrows in Figure 11. The TRS fragment was included so that tandem repeats would be present in the genome after integration of the cassette into the genome by homologous recombination to facilitate pop-out of the cassette by recombination.

[0581] The CORE cassette was fused to the TRS fragment by fusion PCR as described in Example 4, above. Fusion primers were used in a PCR using the CORE cassette as a template and in another PCR with the TRS fragment as a template. The products then were combined and subject to primer-less PCR to join the products. The resulting fusion product then was amplified using additional primers which contained homology to the CORE-TRS fusion product and also 50 bp regions of homology to the target region. The primer further contained an 18 bp l-Scel recognition site. Thus, the TREC knockout cassette contained, in the following order: 50 bp of homology to a 5' portion of the target region, an 18 bp l-Scel recognition site, a CORE cassette (consisting of, in this order: the GAL1 promoter, a gene encoding l-Scel endonuclease and the URA3 marker), the TRS repeat fragment, (portion homologous to sequence of the genome just upstream of the target locus; indicated with large horizontal arrow in Figure 10A), and 50 bp of homology to a 3' portion of the target region.

[0582] For modification of the M. mycoides LC-YCp donor genome in the yeast W303a host, the TREC knockout cassette was transformed into the host cells, using lithium acetate integrative transformation as described in Example 4C(ii), above. To select for replacement of the TypeR III ORF (target locus) with the TREC knockout cassette (via the 50-bp homologous regions at the termini of the cassette to the target sites, cells were grown, individual URA+ transformants were selected and analyzed. This process produced genomes in which the Type III restriction enzyme gene had been replaced by the Cassette (labeled as Atypelllres:: URA 3 in Figure 11).

[0583] Cells then were grown on plates containing SG-His medium, such that galactose was the only carbon source. This step induced expression of the l-Seel endonuclease, which was under control of the GAL1 promoter, in order to promote cleavage of the 18-bp l-Scel site (asterisk in Figure 11), creating a double strand break. The double-strand break then would promote homologous recombination between the tandem repeat sequences (horizontal large arrows), promoted by the double-strand break.

[0584] To select for this recombination event, cells were grown on SD-HIS 5-FOA medium to select for cells having lost the URA3 marker, which were presumed to have lost the TREC cassette. This process was carried out to select genomes in which there had been seamless deletion of the typelllres gene (labeled as AtypelllR in Figure 11).

[0585] In another example, a knock-out cassette can be constructed in three steps. First, a 2.3 kb of DNA fragment, referred as the Knock-Out Core ( OC), was produced by PCR using primer RC0293

(CAGGTGGACAAAACAATGAGATTAACTAATAAACAAGAATTTGTAGTGCAT

AGGGATAACAGGGTAATACGGAT; SEQ ID NO: 152) and primer RC0294 fATCTTGTCTATTTAATTCTAAAACAGGGTAATAACT GATATAATTAAATTGAAG; SEQ ID NO: 153). The resulting PCR product contains, starting from 5' end, a 50 bp segment (highlighted in bold in primer RC0293) homologous to the upstream of 5' target site, an 18 bp l-Scel recognition site, the GAL1 promoter, a gene encoding l-Scel homing endonuclease and URA3 marker. Second, a 400-bp upstream of target site was amplified by primer RC0295

rAATTTAATTATATCAGTTATTACCCTGTTTTAGAATTAAATAGACAAGATAATGG ; SEQ ID NO: 154) and primer RC0296

(ATAAGTAATTTTTTATTTTAACAATTTAATAATCTTCTTTAACAATATCTTGC

ACTACAAATTCTTGTTTATTAGTTA; SEQ ID NO: 155) using M. mycoides LC genomic DNA as template. The PCR product, referred as Tandem Repeat Sequence (TRS), contains a 50 bp segment (highlighted in bold in primer RC0296) homologous to the downstream of 3' target site. Third, two PCR products, KOC and TRS, overlapping each other by 50 bp (underlined in primer RC0294 and RC0295) was joined together by PCR-based fusion method. The fusion product, knock-out cassette, was gel-purified by gel extraction kit from Qiagen and re-amplified by primer RC0293 and primer RC0296. The final 2.7 kb fragment was then transformed into yeast 303a strain harboring M. mycoides LC genome (Benders et al., Science, submitted (2009)) using lithium acetate (LioAc) method as described (Gietz et al., Nucleic Acids Res 20, 1425 (Mar 25, 1992)) and selected for both uracil and histidine prototrophy. Total DNA was prepared from transformants as described (Kouprina and Larionov, Nat Protoc 3, 371 (2008)). The replacement of knock-out cassette with the type III RE locus was verified by PCR screening using primer 5

(GATTTTTATGCTGGATCTGGAACA; SEQ ID NO: 192), located at the upstream of target site and primer 6 (TCCGTATTACCCTGTTATCCCTA; SEQ ID NO: 193), resided inside the knock-out cassette. To make a mark-less deletion of Type III RE, the PCR-positive strains were grown in medium containing galactose as the sole carbon source, followed by 5- FOA counter-selection as described in Example 4. All PCR amplification experiments described above were carried out using Phusion DNA polymerase (New England Biolabs). Purified M. mycoides LC genome from transplants were amplified by PCR using primer 5 and primer 7 (CTACTTCAAATAGTATTCTTTTAAGCG; SEQ ID NO: 194) located at the downstream of the target site. The PCR products were purified by kit (Qiagen) and used for sequencing using primer 5 and 7. [0586] Thus, the modification method was designed to produce two modified M. mycoides LC genomes in the yeast host cells. The first modified genome was the one obtained after insertion of the TREC cassette but prior to recombination promoted by l-Secl endonuclease digestion and selection on 5-FOA. This first genome contained the URA3 -contaimng (TREC) cassette, which had replaced the wild-type gene at Type III restriction enzyme locus

(Atypelllres:: URA). The second genome was the final product obtained after removal of the cassette, which contained a seamless deletion of the Type III restriction enzyme gene (Atypelllres).

[0587] To demonstrate that the modified genomes {Atypelllres:: URA, Atypelllres) produced in this study were the correct size, isolated genomic DNA was run on a CHEF gel, as follows, to compare their sizes to the size of unmodified M. mycoides LC genome. For this process, yeast plugs were washed and digested over-night with 50 units of AsiSI, RsrII, and Fsel restriction enzymes (which specifically cut yeast genomic DNA as described above). The DNA plugs then were loaded on a 1% TAE agarose gel in order to purify the donor DNA by running out the digested yeast genomic DNA fragments. Plugs were removed from the wells and the remaining genomic DNA digested with the PspXI restriction enzyme, which linearized M. mycoides LC genomic DNA. After that digestion, all plugs were washed and loaded onto a pulse-field gel. The gel was stained with SYBR Gold (diluted 1:10,000). PFGE patterns were observed after scanning the gel with a GE Typhoon 9410 imager (data not shown).

[0588] The samples designed to have Atypelllres:: URA, and Atypelllres modified genomes correctly exhibited genomes of comparable size to the unmodified genome. This process further revealed that another clone (zl500kb) had been produced during the course of the study. Based on the size of the band recovered from this clone, its genome contained a 500 kb deletion. This clone was used in later studies as a control because it presumably lacked many essential genes but retained the YCp (yeast centromeric plasmid) element and the tetM selection marker.

[0589] Another example of generation of Type III restriction enzyme deletions is illustrated in Figure 19. YCpMmycl.l was engineered in yeast by creating a seamless deletion in a non-essential Type III restriction endonuclease gene. Briefly, a YCpMmycl.l yeast clone was first transformed with a cassette containing a URA3 marker and the SCEI endonuclease gene under the control of the GAL1 promoter. Insertion of the cassette into the Type III gene was used as a selection criterion; four of five clones contained intact genomes, and one contained a genome with a large deletion (YCpMmycl.l-A500kb) (Figure 11). The URA3 cassette was removed by cleavage at an I-Sce I recognition site near one end of the cassette (Figure 19). Counter selection with 5-fluoroorotic acid (5-FOA) produced clones that had lost the URA3 cassette. Thus, two M. mycoides YCp genomes were obtained: one that contained the URA3 cassette and the other that contained a seamless deletion of the Type III restriction enzyme gene (Figure 19). The changes to the genome were verified by PCR (data not shown).

Example 5B

Transplantation of modified genomes into donor cells

[0590] Each of these M. mycoides LC modified genomes (including the J500kb control) and the unmodified M. mycoides LC genome were transplanted into M. capricolum recipient cells using the methods described in Example 3, above. Transplantation was performed using the third protocol described in Example 3, above, which is illustrated in Figure 8, indicated with the number "3." As described in Example 3, this method included a methylation step, deproteinisation step (treatment with proteinase K), and a melting step prior the

transplantation reaction. Transplantation is into wild-type recipient cells. For this process, agarose plugs were prepared as described in Example 3 A(i), and cleaned-up with both the restriction enzyme cocktail and gel electrophoresis, as described in Example 5A, above (see also Example 3A(i)). Transplantation was carried out, as described in Example 3 A(ii) and 3 A(iii), in the presence of 5 % PEG and with methylation using the cell-free M. mycoides LC extract and proteinase K digestion. Genomes were transplanted into wild-type (not RE- deficient) M. capricolum cells, as described in Example 3, above. Successful transplantation was evaluated by selecting for growth of blue colonies on SP4 medium containing tetracycline at 37 °C. Results are presented in Table 17, below. Table 17

Transplantation of modified M. mycoides LC genomes into wild-type M. capricolum recipient cells

[0591] The number of transplants represents an average of at least three studies. The error reported is the mean deviation.

[0592] As shown in Table 17, transplantation of the two intended modified genomes (Atypelllres ::URA3 and Atypelllres) resulted in similar numbers of tetracycline-resistant blue colonies (average of 28 and 33 colonies per plug, respectively) compared to the numbers observed upon transplantation of unmodified M. mycoides LC genome (average 28 colonies per plug). As was expected, transplantation of the control clone containing the 500 kb deletion (and presumably lacking essential Mycoplasma genes but retaining the YCp element and tetM) into M. capricolum recipient cells produced no colonies.

[0593] To verify the sequences of selected colonies containing transplanted modified genomes, the Type III locus in those genomes was sequenced. The sequencing results revealed that the expected modifications were present in both modified strains

(Atypelllres: :URA3 and Atypelllres). For example, deletion of the typelllres gene in the Atypelllres genome was verified with the sequence of the nucleic acid containing the junction of the typelllmod gene (See Figure 11), adjacent to the typelllres gene in the wild-type genome, and the DNA downstream of the native typelllres gene, evidencing seamless deletion of that gene in these cells.

[0594] To verify that the genotype of the recovered colonies was M, mycoides LC, genomic DNA from selected blue colonies was analyzed by Southern blot, using the IS 1296 element as probe. Copies of the IS 1296 insertion sequence are dispersed throughout the M. mycoides LC (donor) genome, but are absent from the M. capricolum (recipient) genome. To verify complete loss of the Typelll restriction enzyme sequence in modified genomes, blots were further probed with a probe containing the M. mycoides LC typelllres gene sequence. Southern blotting was carried out as follows.

[0595] Mycoplasma total DNA was extracted from 10 ml cultures of the M. capricolum recipient cells transplanted with modified or unmodified M. mycoides genomes. Genomic DNA from native M. mycoides LC clone 1.1 donor cells and genomic DNA from M.

capricolum recipient cells were used as controls. Extraction was done using a Wizard genomic DNA purification kit (Promega). For Southern blot hybridization, 1.5 μg of DNA was digested with either Hindlll or EcoRV and the resulting samples separated by

electrophoresis on a 1% agarose gel. DNA fragments from gels were transferred to positively charged nylon membranes (Nytran Super Charge, Schleicher and Schuell) by alkali transfer. Twenty (20) ng/ml digoxigenin-labeled DNA probes (IS 1296 insertion sequence and typelllres gene sequence were hybridized to the membranes, to verify M. mycoides genotype and donor genome modification, respectively.

[0596] The membrane was incubated with Fab fragments of anti-digoxigenin antibodies coupled to alkaline phosphatase. Hybridization then was detected with the fluorescent substrate HNPP (2-hydroxy-3 -naphthoic acid-2'-phenylanilide phosphate) (Roche Molecular Biochemicals). Chemifluorescence was detected under UV with a camera and Quantity One software, designed for acquiring images (Bio-Rad Laboratories, Inc.).

[0597] Each of the selected transplanted colonies resulted in the same pattern (8 bands) in the blots probed with the IS 1296 probe (data not shown). As expected, no IS 1296 pattern was detected in lanes containing samples from recipient cells (r). This result strongly suggests that the recovered colonies indeed were the M. mycoides LC genotype. Further, lanes containing control samples from M. mycoides donor genomes contained a band recognized by the typelllres probe. This band was not detected, however, in the lanes containing samples from transplanted modified genomes.

[0598] These results indicated that the donor genomes modified in yeast host cells were successfully transplanted into recipient cells, which were of a different species than the donor. The results further demonstrate that both modified genomes contained the intended modification (loss of the Typelllres gene). Thus, the provided methods were successfully used to generate two synthetic recipient cells, containing transplanted synthetic donor M. mycoides LC genomes that did not previously exist either in the laboratory or in nature. These results demonstrate the first example of the genetic manipulation of a whole bacterial genome in yeast and its installation into a recipient cell to yield a novel bacterium.

EXAMPLE 6

Transplantation of a chemically synthesized donor genome or a semi-synthetic donor genome, assembled and propagated in yeast host cells, into recipient cells

[0599] A 1.08 Mbp Mycoplasma mycoides genome was chemically synthesized, and assembled in yeast as a centromeric plasmid; the genome was isolated as naked DNA and transplanted into Mycoplasma capricolum to create a new bacterial cell controlled only by the synthetic genome.

[0600] Described herein is the design, synthesis and assembly of the 1,077,947-bp Mycoplasma mycoides JCVI-synl genome from 1,078 1-kb synthetic DNA cassettes. The assembly was facilitated by in vitro and in vivo assembly methods. Cassettes in sets often were assembled by yeast recombination and propagated in a yeast/ 'Escherichia coli shuttle vector. The 10-kb assemblies were recombined in sets of ten to produce 100-kb assemblies. The resulting eleven 100-kb assemblies were recombined in a single final step into the complete genome. A yeast clone bearing the synthetic genome was selected and confirmed by multiplex PCR and restriction analysis.

[0601] The assembled synthetic genome has been propagated in yeast as a centromeric plasmid and successfully transplanted into restriction-minus Mycoplasma capricolum cells. The new cells have the phenotypic properties expected for M. mycoides and the designed synthetic DNA sequence, including watermark sequences and other designed gene deletions and polymorphisms. We refer to this strain as M. mycoides JCVI-synl. This is the second bacterial chromosome synthesized and the first over one million bp. It is a synthetic bacterial genome successfully transplanted into a recipient cell resulting in new cells that are controlled only by a synthetic chromosome. The new synthetic chromosome cells are capable of continuous self-replication. This study confirms the ability to start with digitized genetic information, synthesize new DNA and transplant that synthetic DNA into cells replacing all of the existing genetic information and, as a result, create new cells controlled only by that synthetic designed DNA. The existing (endogenous) genetic information is lost and as a result new cells are created which are controlled only by the designed synthetic chromosome.

Example 6A

Synthetic Donor Genome Design

[0602] Design of the M. mycoides JCVI-synl genome was based on the highly accurate finished genome sequences of two previously described laboratory strains of M. mycoides subspecies capri GM12 (Benders et al. , Nucleic Acids Res, (2010); Lartigue et al. , Science 325, 1693 (2009)). One was the genome donor used by Lartigue et al. [GenBank accession CP001621] (Lartigue et al, Science 317, 632 (2007)). The other was a strain created by transplantation of a genome that had been cloned and engineered in yeast, YCpMmycl.l- Atypefflres, [GenBank accession CP001668] (Lartigue et al., Science 325, 1693 (2009)). Differences at 95 sites were identified between the M. mycoides genomic sequences. We chose to use the sequence of the genome successfully transplanted from yeast (CP001668) as our design reference; all differences between previously synthesized cassettes that appeared to be of biological significance were corrected to match CP001668. Sequence differences between our synthetic cassettes and CP001668 that occurred at 19 sites appeared harmless, and so were not corrected. These provide 19 polymorphic differences between our synthetic genome (JCVI-synl) and the natural genome that we have cloned in yeast and use as a standard for genome transplantation from yeast, YCpMmycl.l (Lartigue et al, Science 325, 1693 (2009)). i. Genomic sequences

[0603] GenBank accession no. CP001621 is the sequence of the M. mycoides strain used as the genome donor as described by Lartigue et al. {Science 317, 632 (2007)), with a length of 1,089,202 bp.

[0604] mmycDRAFT - Design of our synthetic M. mycoides genome was begun using a draft genome sequence from the project that produced the above sequence (CP001621), with a length of 1,114,292 bp. This draft was found to contain a large duplication.

[0605] GenBank accession no. CP001668 is the sequence of an M mycoides strain engineered in yeast by deleting the gene for a Type III restriction endonuclease, then transplanted to produce a Mycoplasma (Lartigue et al, Science 325, 1693 (2009)). This sequence has a length of 1,084,586 bp.

[0606] First the mmycDRAFT sequence was divided into cassettes 1080 bp in length, with 80 bp overlaps, and a Notl restriction site was added at each end, as follows: mmycO = bases 1-1080 preceded and followed by GCGGCCGC mmycl = bases 1001-2080 preceded and followed by GCGGCCGC mmyc2 = bases 2001-3080 preceded and followed by GCGGCCGC mmycl 113 = bases 1113001-1114080 preceded and followed by GCGGCCGC

mmycl 114 = bases 1114001-1114292 preceded and followed by GCGGCCGC

[0607] Designed cassettes located within parts of the mmycDRAFT sequence were ordered for synthesis by Blue Heron. This initial order of 1,072 cassettes included all 1,115 designed cassettes except mmyc0-mmycl4 (15 cassettes), mmyc835-mmyc852 (18 cassettes), and mmycl 105-mmycl 114 (10 cassettes).

[0608] Assembly of these 1 ,072 cassettes would yield two contiguous stretches of DNA, with two gaps corresponding to regions where the sequence was uncertain.

[0609] Design of the remaining cassettes was based on sequence CP001668 after it was completely finished, because that genome was known to be stably maintained in yeast and to be transplantable from yeast to produce a viable mycoplasma. First, cassettes were designed to fill the two largest gaps:

[0610] Cassettes to fill gap 1. "a" designates cassettes that were not part of the initial order from Blue Heron. Cassettes 835a-850a produce a sequence that matches CP001668 and fills the gap left by cassettes mmyc835-mmyc852, which were omitted from the initial Blue Heron order.

[0611] Cassettes to fill gap 2. Cassettes 2a-12ax fill the gap left where the cassettes mmycl 105-mmycl 114 and mmyc0-mmycl4 were located in the draft sequence (these were omitted from the Blue Heron order). This sequence matches CP001668 exactly and is considerably shorter than the corresponding region of the draft sequence, mainly due to problems with assembly of that sequence. The sequence of mmycl2ax is longer than most; hence, "x" for extended.

[0612] Cassettes to make the synthetic genome match CP001668 near the origin of replication. There were many differences between the mmycDRAFT sequence and

CP001668 in this region.

mmyc799a (overlaps mmyc798 by 80 bp - to 1084586, the end of CP001668) mmyc811a (-80 to 1074 of CP001668)

mmyc812a (995 to 2074 of CP001668)

[0613] Cassettes synthesized to match CP001668.

mmyc56a (344335 to 345333 of CP001668), mmyc58a (345252 to 345926 of CP001668), and mmyc938.1a, which goes between mmyc938 and mmyc939.

[0614] Cassettes "fixed" by oligonucleotide mutagenesis to match CP001668.

[0615] "f ' cassettes had small numbers of sequence differences that could be fixed by oligonucleotide mutagenesis to exactly match CP001668. See below for details on how these cassettes were fixed. The following cassettes were fixed: mmyclOl If, mmycl028f, mmyc247f, mmyc248f, mmyc342f, mmyc399f, mmyc400f, mmyc528f, mmyc529f, mmyc578f, mmyc579f, mmyc632f, mmyc642f , mmyc759f, and mmyc874f. In addition, for constructing genomes with the "94D" deletion, which is missing mmyc936-mmyc939, cassette mmyc940f was produced to contain a 5' overlap with cassettes mmyc935. This region was demonstrated to be dispensable by deleting it from the natural genome in yeast, then transplanting to produce a viable mycoplasma.

[0616] Cassettes containing watermark sequences.

[0617] (1) mmycWMl replaces mmyc282-287 (5' 80 bp overlap from mmyc282; 3' 80 bp overlap from mmyc287), (2) mmyc WM2b replaces mmyc447 (both 80 bp overlaps are from mmyc447), (3) mmycWM3 replaces mmycl06 (both 80 bp overlaps are from mmycl06), and (4) mmyeWM4 replaces mmyc680 (both 80 bp overlaps are from mmyc680).

[0618] Nucleotide 1 is at the initiation codon of the dnaA gene. [0619] Both M. mycoides sequences CP001621 and CP001668 use a numbering system in which nucleotide 1 is at the initiation codon of the dnaA gene, in the vicinity of the DNA replication origin. The mmycDRAFT sequence used for the initial cassette design was numbered from a different origin but in the same direction. Consequently, nucleotide 1 of the genome sequence is located in cassette mmyc81 la.

[0620] Differences between cassette designs and CP001668 that were not fixed.

[0621] There are 19 differences between cassette designs and the CP001668 sequence that appeared harmless, which we opted not to fix. These were all differences in lengths of homopolymer or dinucleotide runs and were located between annotated genes. Some may affect the spacing between the -35 and -10 sequences of promoters, and so could affect gene expression. Table 18 gives details of these 19 differences. They provide more sequence differences to distinguish the synthetic genome from the natural M. mycoides genome that have been cloned in yeast, in addition to the watermark sequences.

[0622] DNA cassette sequence corrections

[0623] The synthetic cassettes comprising the synthetic genome were ordered based on an imperfect draft sequence. Because of this, there were small differences between the ordered synthetic cassette sequences and the completed base M. mycoides subspecies capri genome sequence. Forty-three cassettes contained differences. Many of the differences were small insertions or deletions in homopolymer or dinucleotide runs not predicted to be located in genes. These changes were thought to be benign and were not fixed. Sixteen cassettes were chosen to be fixed. The differences were all single base changes except for a deletion of a 12 bp repeat unit in one cassette.

[0624] Two strategies were employed to change the synthetic cassette sequences to match the completed M. mycoides subspecies capri genome sequence. The QuikChange® II site directed mutagenesis kit (Stratagene) was used for some of the single base changes. The remainder of the changes were performed by a combination of PCR and in vitro

recombination (Gibson et al., Nat Methods 6, 343 (2009)). Primers (BH pUC bckbn Fori and Revl) were used to amplify the plasmid backbone for use in the recombination reaction. Complements of backbone primers (BH insert Fori and Revl) were used in conjunction with error correcting primers (Cassette Fix Fori and Revl) to produce amplicons with regions of homology to each other and the BH backbone amplicon. The three PCR products were used in in vitro recombination to generate the corrected cassette (data not shown). All fixes were performed on the 1,080 bp cassette clones.

[0625] Primers BH pUC bckbn Fori (5 '-

CGTCAAAGCAACCATAGTACGCGCCCTGTAG-3'; SEQ ID NO.: #) and BH pUC bckbn Revl (5'-CTGACTCGCTGCGCTCGGTCGTTCGGC-3'; SEQ ID NO.: #) were used to amplify the plasmid backbone of a cassette clone. This amplicon (BH backbone) is ~ 2,600 bp and contains the ampicillin resistance marker and origin of replication. Primers BH insert Fori (5 '-GCCGAACGACCGAGCGCAGCGAGTC AG-3 '; SEQ ID NO.: #) and BH insert Revl (5'-CTACAGGGCGCGTACTATGGTTGCTTTGACG-3'; SEQ ID NO.: #) are the reverse complements of BH pUC bckbn Fori and BH pUC bckbn Revl and are used as the forward and reverse primers with the correction primers to amplify the cassette insert and create homology regions with the BH backbone for in vitro recombination.

[0626] To change a single nucleotide in a cassette, two oligonucleotides are required. The first primer contains the fixed nucleotide sequence flanked by approximately 20-25 bases and the second is the complement of the first. Examples of primers used to change a nucleotide to a G are shown. Cassette Fix Fori (5'-

GAACTGAAAATTATATATCAGGTAGATATGAATAGGAAATAGTATGTC-3' SEQ ID NO.: #) and Cassette Fix Revl (5'-

GACATACTATTTCCTATTCATATCTACCTGATATATAATTTTCAGTTC-3' SEQ ID NO.: #) with the nucleotide to be changed in bold. PCR is used to change the selected base. Primers BH insert Fori and Cassette Fix Revl are used to amplify part of a corrected insert and primers BH insert Revl and Cassette Fix Fori are for amplifying the remaining insert also with the correction. Because the Cassette Fix Fori and Cassette Fix Revl primers are reverse complements of each other this creates a homology region for in vitro recombination between the amplicons. As mentioned previously, the BH insert primers create homology with the BH backbone piece, allowing a three piece in vitro recombination reaction to create the corrected insert plasmid.

[0627] One synthetic cassette contained five repeats of a 12 bp sequence whereas the completed genome sequence showed six repeats of this sequence. PCR and in vitro

recombination were used as above to correct the 12 bp deletion with minor changes. The forward primer used to add the 12 bp repeat unit contained four repeat units on the 5' end followed by 27 bases of non-repeat sequence on the 3' end. This primer was used with primer BH insert Revl to create an amplicon with four repeat units at the 5' end. The reverse primer used to add the 12 bp repeat unit contained the complement of four repeat units on the 5' end followed by 27 bases of non-repeat sequence on the 3' end. This primer was used with primer BH insert Fori to create an amplicon with four repeat units at the 3' end. Following in vitro recombination, clones were sequenced to identify the clones that recombined between two repeat units on the 3' end and two units on the 5' end of the amplicons resulting in a cassette insert sequence with six 12 bp repeat units.

[0628] A further change was made in cassette 940 that was not related to differences between the synthetic and native sequences. Cassettes 936-939 were difficult to assemble. Further work demonstrated that cassettes 936-939 were not essential for the viability of M. mycoides subspecies capri and could be deleted. In order to delete this region during construction of the synthetic genome, the 5' 80 bp overlap of cassette 940 was changed to match the 80 bp 3' overlap of cassette 935. Upon construction, cassette 935 would then join with cassette 940 deleting cassettes 936-939. To change the overlap region, cassette 940 was amplified with BH insert Revl and a forward primer that binds adjacent to the 5' 80 bp overlap region. The 5' overlap from cassette 936 (which is identical to the 3' 80 bp overlap of cassette 935) was obtained by amplifying cassette 936 with BH insert Fori and a reverse primer that binds the 3' 40 bp of the overlap with a 5' extension that is the complement of the forward primer used to amplify cassette 940. In vitro recombination was then used with the BH backbone piece to generate cassette 940 with a 5' 80 bp overlap to cassette 935. ii. Watermarks

[0629] To further differentiate between a synthetic genome and a natural one, four watermark sequences were designed to replace one or more cassettes, added at places where insertion of additional sequence would not interfere with viability.

[0630] Watermark-1, 321 unencoded characters, 1246 base pairs

J. CRAIG VENTER INSTITUTE 2009

ABCDEFGHIJKLMNOPQRSTUVWXYZ

0123456789#@() -+\=/ :<;>$&}{ *] "[%!'., SYNTHETIC GENOMICS, INC.

< !DOCTYPE HTML><HTML><HEAD><TITLE>GENOME

TEAM</TITLEx/HEAD><BODYxA

HREF="HTTP: //WWW. JCVI.ORG/ ">THE JCVI</AxP>PROVE YOU'VE

DECODED THIS

WATERMARK BY EMAILING US <A

HREF="MAILTO :MROQSTIZOJCVI . ORG" >HERE ! </Ax/Px/BODYx/HTML>

TTAACTAGCTAAGTTCGAATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAATACT

GTGCGCTTGACTGTGATCCTGATAAATAACTTCTTCTGTAGGGTAGAGTTTTATTTAAGGCT

ACTACTGGTTGCAAACCAATGCCGTACATTACTAGCTTGATCCTTGGTCGGTCATTGGGGGA

TATCTCTTACTAATAGAGCGGCCTATCGCGTATTCTCGCCGGACCCCCCTCTCCCACACCAG

CGGTGTACATCACCAAGAAAATGAGGGGAACGGATGAGGAACGAGTGGGGGCTCATTGCTGA

TCATAATGACTGTTTATATACTAATGCCGTCAACTGTTTGCTGTGATACTGTGCTTTCGAGG

GCGGGAGATTCTTTTTGACATACATAAATATCATGACAAAACAGCCGGTCATGACAAAACAG

CCGGTCATAATAGATTAGCCGGTGACTGTGAAACTAAAGCTACTAATGCCGTCAATAAATAT

GATAATAGCAACGGCCTGACTGTGAAACTAAAGCCGGCACTCATAATAGATTAGCCGGAGTC

GTATTCATAGCCGGTAGATATCACTATAAGGCCCAGGATCATGATGAACACAGCACCACGTC

GTCGTCCGAGTTTTTTTGCGCGACGTCTATACCACGGAAGCTGATCATAAATAGTTTTTTTG

CTGCGGCACTAGAGCCGGACAAGCACACTACGTTTGTAAATACATCGTTCCGAATTGTAAAT

AATTTAATTTCGTATTTAAATTAATGATCACTGGCTATAGTCTAGTGATAACTACAATAGCT

AGCAATAAGTCATATATAACAATAGCTGAACCTGTGCTACATATCCGCTATACGGTAGATAT

CACTATAAGGCCCAGGACAATAGCTGACTGACGTCAGCAACTACGTTTAGCTTGACTGTGGT

CGGTTTTTTTGCTGCGACGTCTATACGGAAGCTCATAACTATAAGAGCGGCACTAGAGCCGG

CACACAAGCCGGCACAGTCGTATTCATAGCCGCACTCATGACAAAACAGCgGCgCGCCTTAA

CTAGCTAA (SEQ ID NO: #)

[0631] Watermark-2 326 unencoded characters, 1081 base pairs

MIKKEL ALGIRE, MICHAEL MONTAGUE, SANJAY VASHEE, CAROLE

LARTIGUE, CHUCK MERRYMAN, NINA ALPEROVICH, NACYRA ASSAD- GARCIA, GWYN BENDERS, RAY-YUAN CHUANG, EVGENIA DENISOVA, DANIEL GIBSON, JOHN GLASS, ZHI-QING Q .

"TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE . " - JAMES JOYCE TTAACTAGCTAACAACTGGCAGCATAAAACATATAGAACTACCTGCTATAAGTGATACAACT GTTTTCATAGTAAAACATACAACGTTGCTGATAGTACTCCTAAGTGATAGCTTAGTGCGTTT AGCTATATTGTAGGCTTCATAATAAGTGATATTTTAGCTACGTAACTAAATAAACTAGCTAT GACTGTACTCCTAAGTGATATTTTCATCCTTTGCAATACAATAACTACTACATCAATAGTGC GTGATATCCTGTGCTAGATATAGAACACATAACTACGTTTGCTGTTTTCAGTGATATGCTAG TTTCATCTATAGATATAGGCTGCTTAGATTCCCTACTAGCTATTTCTGTAGGTGATATACGT CCATTGCATAATTAATGCATTTAACTAGCTGTGATACTATAGCATCCCCATTCCTAGTGCAT ATTTTCATCCTAGTGCTACGTGATATAATTGTACTAATGCCTGTAGATAATTTAATGCCTGG CTCGTTTGTAGGTGAAATTTAGTGCCTGTAAAACATATACCTGAGTGCTCGTTGCGTGATAG TTCGTTCATGCATATACAACTAGGCTGCTGTGATATGGTCACTGCCCTTACTGTGCTACATA TTACTGCGAGGGGGATGACTATAAACCTGTTGTAAGTGATATGACGTATATAACTACTAGTG ATATGACGTATAGGCTAGAACAACGTGATATGACGTATATGACTACTGTCCCAAACATCAGT GATATGACGTATACTATAATTTCATAATAGTGATAAATAAACCTGGGCTAAATACGTTCCTG AATACGTGGCATAAACCTGGGCTAACGAGGAATACCCATAGTTTAGCAATAAGCTATAGTTC GTCATTTTTAAGGCGCGCCTTAACTAGTAA (SEQ ID NO: #)

[0632] Watermark-3 335 unencoded characters, 1109 base pairs

CLYDE HUTCHISON, ADRIANA JIGA, RADHA KRISHNAKUMAR, JAN MOY, MONZIA OODIE, MARVIN FRAZIER, HOLLY BADEN-TILSON, JASON

MITCHELL, DANA BUSAM, JUSTIN JOHNSON, LAKSHMI DEVI

VIS ANATHAN, JESSICA HOSTETLER, ROBERT FRIEDMAN, VLADIMIR NOSKOV, JAYSHREE ZAVERI .

"SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE."

TTAACTAGCTAATTTAACCATATTTAAATATCATCCTGATTTTCACTGGCTCGTTGCGTGAT

ATAGATTCTACTGTAGTGCTAGATAGTTCTGTACTAGGTGATACTATAGATTTCATAGATAG

CACACTGGCTTCATGCTAGGCATCCCAATAGCTAGTGATAGTTTAGTGCATACAACGTCATG

TGATACAACGTTGCTGGCTGTAGATACAACGTCGTATTCTGTAAGTGATACAATAGCTATTG

CTGTGCAAGGCCTATAGTGGCTGTAACTAGTGATATCACGTAACAACCATATAAGTTAGATT

TAATGCCCCTGACTGAACGCTCGTTGCGTGATAGTTTAGGCTCGTTGCATACAACTGTGATT

TTCATAAAACACGTGATAATTTAGTGCTAGATAAGTTCCGCTTAGCAAGTGATAGTTTCCGC

TTGACTGTGCATAGTTCGTTCATGCGCTCGTTGCGTGATAAACTAGGCAGCTTCACAACTGA

TAATTTAATTGCTGAATTGCTGGCTGTCTAGTGCTAGTGATCATAGTGCGTGATAGTTTAAG

CTGCTCTGTTTTAGATATCACGTGCTTGATAATGAAACTAACTAGTGATACTACGTAGTTAA CTATGAATAGGCCTACTGTAATTCAATAGTGCGTGATATTGAACTAGATTCTGCAACTGCTA ATATGCCGTGCTGCACGTTTGGTGATAGTTTAGCATGCTTCACTATAATAAATATGGTAGTT GTAACTACTGCGAATAGGGGGAGTTAATAAATATGATCACTGTGCTACGCTATATGCCGTTG AATATAGGCTATATGATCATAACATATATAGCTATAAGTGATAAGTTCCTGAATATAGGCTA TATGATCATAACATATACAACTGTACTATGAATAAGTTAACGAGGATTAACTAGCTAA

(SEQ ID NO: #)

[0633] Watermark-4 338 unencoded characters, 1222 base pairs

CYNTHIA ANDREWS-PFANNKOCH, QUANG PHAN, LI MA, HAMILTON SMITH, ADI RAMON, CHRISTIAN TAGWERKER, J CRAIG VENTER, EULA

WILTURNER, LEI YOUNG, SHIBU YOOSEPH, PRABHA IYER, TIM

STOCKWELL, DIANA RADUNE, BRIDGET SZCZYPINSKI, SCOTT DURKIN, NADIA FEDOROVA, JAVIER QUINONES, HANNA TEKLEAB .

"WHAT I CANNOT BUILD, I CANNOT UNDERSTAND." - RICHARD FEYNMAN

TTAACTAGCTAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCAC

AGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACATCATAGTGCG

TGAAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGT

GATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGTGATATTTTCACTACTGGCTTGA

CTGTAGTCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTG

TACATATTGTAATGCTGATAACTAGTGATATAATCCAACTAGATAGTCCTGAACTGATCCCT

ATGCTAACTAGGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTC

CATACATCGTCGTGCTTAAACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAAC

TAGTGATATGACTGCAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGT

GCTAGATACTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGG

TTTTGGCATACACTGTGCGTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTAGCA

CTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGT

TTAGTTGCTGTAACTAATATTATCCTGTGCCGTTGCTAAGCTGTGATATCATAGTGCTGCTA

GATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGT

GCTGCCGTTGAATAAGTTCCCTGAACATGTGATACTGATATTTTAGTGCTGCCGTTGAATAT

CCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTA

ATTATAGGCTAACATTGCCAATAGTGCGGCGGCCTTAACTAGCTAA (SEQ ID NO: #) [0634] Watermarks 1-4 replaced cassettes 282-287, 447, 106, and 680, respectively. The watermarks were inserted in regions experimentally demonstrated (watermarks 1 (1246 bp) and 2 (1081 bp)) or predicted (watermarks 3 (1109 bp) and 4 (1222 bp) to not interfere with cell viability. An all-6 reading frame stop codon is underlined at the beginning and end of each watermark; Afc I restriction sites are shown in bold italics. Since our data indicated that the genome sequence represented by cassettes 936-939 was dispensable, we produced a version of cassette 940 that contained an 80 bp overlap to cassette 935. This would produce a 4-kb deletion and further distinguish the synthetic genome from a natural one.

[0635] The synthetic genome design, with this deletion and the four watermark sequences is 1,077,947 bp in length. This sequence was partitioned into cassettes 1,080 bp in length with 80 bp overlaps, and a otl restriction site (GCGGCCGC) was added to each end. A map of the genes, the 1,078 cassettes from which it was assembled, expected polymorphisms, unexpected polymorphisms an inserted E. coli transposon, and other features of M. mycoides JCVI-synl was created which provides the genome map of M. mycoides JCVI-synl : Genes, structural RNAs, watermarks, polymorphisms relative to natural M. mycoides capri GM12, and the coordinates of the synthetic DNA cassettes were identified. Table 18 lists the differences between the synthetic genome and our control natural genome cloned in yeast, YCpMmycl.l.

Table 18

Differences between M. mycoides JCVI-synl and the natural genome YCpMmycl.l.

[0636] The differences are divided into two groups: 1) "designed differences" - 25 differences between the synthetic genome design and the natural YCpMmycl .1 genome, and 2) "undesigned" - 9 observed differences between the sequenced genome arising from one transplanted clone of sMmYCp235 and YCpMmycl.l. The differences are classified by type (column 1). The coordinate of each difference on the designed M. mycoides JCVI-synl sequence is indicated (column 2). The actual sequence differences on the synthetic and the natural genomes are listed for snps, and for homopolymer and dinucleotide runs; for watermarks the name of the watermark is given and the length of the substituted M. mycoides sequence is indicated; the size is of deletions and insertions given (columns 3 and 4). The cassettes affected by the difference and a search string to locate each difference is also shown (columns 5 and 6).

[0637] All designed 1 kb cassettes were ordered to be synthesized by Blue Heron; Bothell, Washington. All cassettes were individually synthesized and sequence-verified by the manufacturer. Example 6B

Synthetic Donor Genome Assembly and Transplantation

[0638] A hierarchical strategy was designed to assemble the genome in 3 stages by transformation and homologous recombination in yeast (illustrated in Figure 20). In the first stage, cassettes are taken 10-at-a-time to produce 10 kb assembly intermediates. In the second stage, these 10 kb intermediates are taken 10-at-a-time to produce eleven -100 kb assembly intermediates. In the final stage, all 11 DNA fragments are assembled into a complete synthetic genome. i. Host vector preparation

[0639] Polymerase chain reaction (PCR) amplification was used to produce a unique vector for the cloning of each assembly. The amplified vectors contain terminal overlaps to the ends of the assembly. The strategy for assembly vector preparation has previously been described (Gibson et al, Science 319, 1215 (2008)). Each PCR primer includes a 20 bp overlap with one end of the vector, a Notl restriction site, and a 40 bp overlap with one end of the cassette assembly. For the first stage of assembly, a yeast/E. coli shuttle vector, termed pCClBAC-LCYEAST was produced for template DNA in PCR. This vector was constructed by in vitro assembly (Gibson et ah, Nat. Methods., 6: 343 (2009)) of Afel-digested pCClBAC with a PCR product consisting of 40 bp overlaps to the Afel restriction fragment, a histidine selectable marker, a centromere, and an origin of replication (derived from pRS313 (Sikorski and Hieter, Genetics 122, 19 (1989))).

[0640] For the second stage of assembly, pRS314 (Sikorski and Hieter, Genetics 122, 19 (1989)) was used as template DNA in PCR (with the exception of the assembly of 831-840, which used pCClBAC as template DNA). Unique assembly vectors were generated by PCR using the Phusion® Hot Start High-Fidelity DNA polymerase with HF buffer (NEB) according to the manufacturer's instructions except reactions were supplemented with 1 mM additional MgCl2 and products were annealed at 60 °C and extended for 1 min per kilobase. PCR products were extracted from agarose gels after electrophoresis and purified using the QIAquick Gel Extraction kit (Qiagen) according to the manufacturer's instructions. Although we could have used the same second-stage vectors for cloning natural and synthetic fragments, an additional vector sequence was constructed for cloning natural 100-kb fragments. This vector sequence is named pCClBAC-URA and was constructed in the same way that pCClBACLC YEAST was constructed except pRS316 was used instead of pRS313. The primers used to produce the PCR-amplified assembly vectors are listed in Tables 19-21.

[0641] Table 19. Primers used to produce unique first-stage assembly vectors.

Overlaps to the ends of the cassette sequences are shown in upper case.

SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

2-10 GTTTTTAATTTAACTAATATTT TTTTCCAGATATAAATGCCG

ATTACAAATAAAAAACTTgcggc GAAATATTGGTTATAAGATT cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

11-20 ACAAAGATATCTGGAGTTTGT CCATATTCAGAAACTTTAAC

TTAGTTAATAAACAGTTTTgcgg TTTAGCTCTTTCTTTACCATg ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

21-30 TCAACAATTACAAGAAAAACA ATGAAGCTAGTAAAAAAGA

AAAAGTTAAATTTATGTATgcgg TAAACAAAAAATAACATCA ccgcgatcctctagagtcgacctg TTgcggccgccgggtaccgagctcgaattc

31-40 CAATAGTAGCAATTTGAGAAT TCTAAAGACTTAAACTCATA

TTAAATTATCAATTTCGTTgcgg TAGTCACATTAATCCTTGGT ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

41-50 TTTTAGTTCTCTTAGTCTATAA AATATCACTTGATTCTTCAT

ATTTCAATCATTTCTTATgcggcc ATTTGTTTGTTATAAAACTA gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

51-60 GTAGATGAATTATTAAACATA GTCAATAATTTAGAACAAAC

TTAAAAAACACTGATTTTAgcgg TTATAAAATAGCAAAAAAA ccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

61-70 TTTAACTTTCATATATAACCTC AAAAAATACGGAAAAGAAT

ATTTACTTTAATTATAAAgcggcc TTATTGATCTTTTAACATCTT gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

71-80 AATTAAATCAAAATTCATTTTG ATAAAATTGATTTACCTAGT

TTATTTTTTACTAATTCTgcggcc GCTGATGTTGATAAAGTTAA gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

81-90 TAATTACTGGAATTATTTCTAA ATTATTTTCTTTAACTAATA

ATTACTATCAATTGCTAAgcggc GATCTTCATCTCTAGTTTTTg cgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

91-100 AGAACTGATAGAGTTGGTAAC TAACATTTATCTTTTAATTTT

TTTAGAAAATATGAAAGAGgcg TCATTAACATTAGCAATTTgc gccgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

101- TCAAACAGCAAAGCAAATGTA CATTAGAGTTTTTATATTTA

110W TGGAGAAATGCTTCCAGAAgcg TATTGAGTTTGTCAAATTCC

M3 gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

111- TAATAGTTGATGCTATTATTAA ATCTTTATTAAAAGTACTAA 120 AACACAAATTAATGATAAgcgg AGAGTTTAATAAATTAAAAT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

121- TTCTGTATTATAAATTTGACGT GTTCTACTTTAACTATTTTAC 130 TTTTGTATTGAGTCTCACgcggcc TTTTTTTAAGTAGTTATTTgcg

gcgatcctctagagtcgacctg gccgccgggtaccgagctcgaattc

131- TTGAAAACGATTTTAAAATTG GCTTTATTTGCTTTTATAGGT 140 GTGAATCAATATAATTTGTgcgg AGTTTATTACAAAAAAAGAg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

141- TACTAATATAGCCGGTGTTGA TAGTTTATATAGTTTAGATT 150 AATAAATTCTGTAAAGAAAgcg TTAGTGTTGATGCTAAAAAG

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

151- GTTGGATCTGTTATTTTGTTAC CTACAGTATAAAACCAGGT

160 TGTTATTTAGGTATTTTTgcggcc ATGATGCCATCTACAACTCC

gcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

161- TAGAAGAATTTGAATCTTTAA ATTTGATGATCAAATTAAAT 170 ATTTAGGTAATTTTGAAGAgcgg TAGATCATAATATTACTTAT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

171- AATTTTCTATCTATCATAATGA TAATCAAGAACTAGAAATA

180 ACTAATATCATTACCTTGgcggc AGTTATATTCCAACTGATTT

cgcgatcctctagagtcgacctg Tgcggccgccgggtaccgagctcgaattc

181- ATTAGTTTTAACGCTTTGTCAA TTATTTATATTCAACAAGTT 190 ATTTATTATTATCAATTAgcggcc GTTTTGTAAATGATATTAAT

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

191- CTTTGATCAGATGTACTACATA CTGCTGTTAAACTTGGTATA 200 CATATAAAATCTTTTTTTgcggcc GGAATTGATTATAAATACCC

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

201- ATTTATAATGATTATCCTTTAG GTTTCAAATTCTCCTTTAAC 210 ATGTTTTGGTACATTATAgcggcc AAAACCAACGATTAATTATT

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

211- ACCTTTTGAATAATTATATTCA ACTACTATTAATAAACTTGT 220 TTTGCATATTTAATACTTgcggcc TGAACTAACTAAAATTTCAG

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

221- TTCAACTAAAATTTCATTATTA AGTAATAGTTTTAGTAAGTT 230 AGATCAAAAATAAAATTTgcggc CACTAGTAGTTATTTTTAGA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

231- AAAATTAATGTTAAAGCTAAA ATTTAGATAGATATGAGTAA 240 GCAACAAAATAAGTTCATTgcg TTTTTTGAAGCTGTTAAAGA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

241- CATTTAGAAATGTAGTTTCATT GTGGTAGCAACCTATTAGAT 250 TAATATTACTAAAGCTGAgcggc TAGGTGCTTAAATAAGGGCT

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

251- TTCATTAAGTTTTATCTCTCCA TTATCTTAGCATCTTGACCT 260 TGGTTCTTAATAAGATATgcggc CTAAAAATAGTATCAAATCT

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

261- AAGCAAATACTAGTATAAATA TTTAGAACAAAAAATAGGA 270 ATAAAGCAGAATTCAAGGAgcg GATATAGTTCTTATAAAGGA

gccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

271- TTTAATACACTGAACTCCAAG TTGTAACATGTAAACTCCTA 280 CTCTTTAGTTAACCTTAAAgcgg AAACTAAAATAGCTAATAA

ccgcgatcctctagagtcgacctg Ggcggccgccgggtaccgagctcgaattc

281- ATGGGGTTATCTTCATATGTAA AGATGATTGATTCTTATACC

290W ACTATTTAAAAAACGTGTgcggc CAGTAATAACTCCACACAAT

Ml cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

291- TCATTATTAAATGTTGATCGTT CAAATGAAGATTGAGAAGA 300 CTGCTGCATTATTTGGTTgcggcc TTTTATTGCTTTAGATGCTCT

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

301- CTTTTCTACTAATTTCATCAAA TGGTTTTGTTTTCTAAAGAT 310 TTTATGATTATGTCTTTCgcggcc TTTAATTTAGCTTCTAATCCg

gcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

311- ACTAAATTTAATCTATCTCTTC AAATATGTTTATATAAATAA 320 TAACTAAAAACAAAGGCTgcgg AAACGGAGAAGAACAAGAT

ccgcgatcctctagagtcgacctg Tgcggccgccgggtaccgagctcgaattc

321- TAAAAACTTTAAATTATTATTT CTAAATTAATTTCTTTCATA

330 GTAGGTGCTTCTAAATACgcggc ATAATACCTCCTATTAAGGT

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

331- AAAATACAAAAGAAATTATTG AGATTTTGATAAACTTCTTC 340 GCGGAGCTGGAGTTAGTGGgcg AATTGTATGAACTAAAATTG

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

341- AAATGATAATAATAAAGTTGA TATAATCTAGCAACTTCTTC 350 ATCAGTTCATTTATTAGATgcgg ACATAAATCATTTTTACTAG

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

351- TTCATATGATAAAATTGATGA ATTAGGTTTTACCCTAACTT 360 AGTTCCACTAAGCTTTACTgcgg CAACCTGCTCATGGCTAGAT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

361- GGAGGACCGAACCAGTATTCG AAAGTAACTTCAATTTGTGG 370 TTGAAAAGACTTTGGATGAgcg AATACCTCTAGGAGCTGGTT

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

371- TGAAATTGATGCTAATGGTAT GTTTGATTATTCTAGAAATC 380 TGTAAGTGTTTCAGCAAAAgcg AAAAAGATGCTAAGTTTAA

gccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

381- ATATATTTAGTTGTAATCTTAT TATGTTTTTTGAAGCAACTT 390 CTTTATTATTTATAAATTgcggcc CATTTAACCAAGATATATCA

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

391- TATGACATATCAGTTACATTTG GTTGATTTTTTAGTATTTTCA 400 AAACATTTCATTTACCAAgcggc GCAACTATCATCTTATCAAgc

cgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

401- TCAACTAAAATCTTTTCAAAA TTATAAATAAAAATTCGATT 410 AAGATTTTGTGTTTTTTTTgcggc TCTCAAAATGTTCAAATTGA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

411- AACTCTTTGCTAAATCTTCTTT AGTGGTTTTTTGTTTAAATC

420 TTCTTTAGCTTTTTGTTTgcggccg TGGTTGATTTGGTGGTGTTG

cgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

421- AGATCCAACTGAAAGAAGAGA TCCAATTTGATATGATAAGA 430 TCAAAACTCAGTTGAATATgcg AATTTCCTTTTTCTAATTCCg

gccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

431- TATAGATCATTTATTGATAAAC CCGATTCTATGAACTGCTAA 440 CTGGATTAACTGATGGATgcggc AAATGCATCAGTTAGTCCTG

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

441- TAATGATTTATACACACTTTAT TGAATTTAATTGTTCTGATT

450W GATAAAAATAAAAAAGAAgcgg TCATTTCACACATTACACTTg

M2 ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

451- CATAATAAAAAGAAAAATAGT AATTCAAAAGACAAAAATT 460 GATCATTATAAAAAATTAGgcg TAGGTAATTTTGATAATATT

gccgcgatcctctagagtcgacctg Ggcggccgccgggtaccgagctcgaattc

461- AAGAACTTGATCAACATTAGT CCTTTTAAATGAGGTAATAC 470 TTTTCTGAAGCTAATTTCTgcgg TAAGCTAACTGCTTTAGCAG

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

471- TAAATTAGATGGATATGCATT TAGTATCTTTATTAATTTGA

480 ACGTGTGCCAACTATTACTgcgg GTATTTGGTAAAGAGTTTAA

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

481- AAGTAATTGATGCTTTAATTG GTTTTTACATCTAATATTAC 490 AAGTAAAAGCTGCTAGTTCgcg ATTAACTGCAATAGTTCCAA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

491- TTTAGATGTTTCTAATGGTATT AAAATCAGATAGTTTTATAG 500 ATTCAAACAATTGAAAAAgcgg TAAATAAATTCTTAAGATTT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

501- ATTAAATTAGAAAATAAACCA AAATAATTAATCCATTTGTT 510 AATTTTGGTTCTGATTATTgcgg AATTGGATCATTGTTGATTT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

511- CTGAAACTGGTCAAATTATAG TGGGAAAATAATTTGTTCTT 520 TTGGTGATTATGCTATTCCgcgg TAATTCCAGTTGTAAAATTT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

521- GAAGTAGATTATGATAAAGTT TGAATCATTACAGCATTATA 530 ATTAGATTACGTGGTATGGgcg CATTGTATGTAATCCAGTAA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

531- AAACACAGCAACAATTGGTGG TCTAAACTAGTTAAAATAAT 540 TTCATTTATTTTCCCAATTgcggc ATTAGCATCTTCACTAGTTA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

541- AATGACTAATTTTTTTGAAAA AAAAATGCCATAGCATCTTT 550 AACTATTAAATCAACTACTgcgg AATTACTTTTCTTTCTCTAAg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

551- AAAAATGATTTCAATTAAAGA TTAACAAATTGTACTAGTTG 560 TGACTTGTCATCTCAAAGAgcgg TTCATTAAAATCGTGTTTTTg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

561- TAAAGATTCACATAACTATAT ATATTAAACAATTTTATTTA 570 AACTTTAGATAGTTTAATGgcgg TTAGATGATTATGATAATTT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

571- TATCTTTACATCATCTTCTTTC AGGATATGTTGATGATTTAA 580 ATGAGTTTTTGATCTATTgcggcc AAACTGTAATAACTAATAA

gcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

581- CAAATTTTAATATCACTATTTT GTATTCAATCCAATGTTTAA 590 TATATTTATCACTAGTTAgcggcc AACCTGCTTAAAATTTTCAA

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

591- TAATGAATTTGAAAATATAGA AAAATATCTCTAATTACTAA 600 TGATCTTGATTTTTTAACTgcggc ATCTTTATCTAATTCATTTAg

cgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

601- AAAATTTATGTAATTTATTAAT TAAACGCATCATAATGTCCA 610 TTTTATCTTTATAATATAgcggcc GTAGTATGAGCTATTTTATC

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

611- TTAAAAAACAAATTCCAGCTA ACCAAATACTAATGCAGTTT 620 AAAAAATAAAACTTTTATTgcg TATTAAATGGCCCTCCTAAA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

621- ACTGTTGTGTTTTATCAATCAT GGTTCAATATAGTTTTTTAA 630 TAGCTCAAGTGTTATCAAgcggc ATATAATTCAGCTGCTTTAA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

631- TAGAATGAAAAAATTTTCTAG TTTCTTCCTTCAACTAATTG

640 TCTAAAAGAAAGATTAGATgcg ATATTATGGATTAAGTTTAG

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

641- TAATAAATCAACCTTACTTAA TTAAAGGAGTAGGTAGCTCT 650 CTCATCACATAATTGCTCTgcgg CTATCTTGTTTATCTACTAAg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

651- AACTAGCATAATAAAATAAAA ATCCAGATGAACCTCCATCT 660 ACCTATACTAGTTCTAAATgcgg AAAGCTTTATGATCTTCATT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

661- CAATGGCTATTGATTCTTCATT TCTTTTTTAACTCATTTATAA 670 TAATTTAATTGGTATTAAgcggc ATACAGCTTGCATGATTGTgc

cgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

671- TAAAAAAAGGTTGTTTATATTT TACAAATGGTTTGTTAATTC

680W GAAGATGATCTTAGTTTTgcggc ACTCTGATCAGGGATTTCAT

M4 cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

681- TTTTTAACCTTTTTAAGTGCTT AATATAGTAATAATCACATA 690 TGTCTAGCATTGAATTTGgcggc AAATTCTAAATTTTTGTCATg

cgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

691- GATCTAAACACTCCTTTAAAA ATGCTTTAGCTGACATTGTT 700 GATTTGACTCAAAAACAAAgcg TCAGTTTTAAAAGTTGATGA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

701- TAGAAAAACTCATAGCTACAC ATTTTGCTAAAAAAGATAAA 710 CTAAAACAAAACGTTCAGCgcg AACGGTTCTATAAGTTTTGA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

711- TAAAAGTAGCATATTCTCCAT ATTTATGATGGAGAGGTTCT 720 AATCTTTAATTGCACCAAAgcgg AGGTTTAGTTGGTGAGTCAG

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

721- ATTTAAATTTAGATCTTTAATA AAATTCATCTTGGAGTCACT 730 GCAGTAAACTCTTTTGCAgcggc GATGATGGTCATATTGACAA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

731- CTCCACCTTTAGTATTTAAAAA CGTTTTTTCTAGCATAAATA 740 AGCTACAATTTCTCTTTTgcggcc ATATCTCTAGATCTAGAGTT

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

741- CTAATGACATTAACACTAATTT TCTTCATAGTTCATATTATTT 750 TGTTGAAGATGAAAACGAgcgg ACTCTCTTTTAAAATTTGTgc

ccgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

751- ACTTGAAATTGGAGATATTAT GAAATTCATGGAAATAATA

760 TGAATTAAAAAAACCTCATgcg ATAAGCTTAATGATGTTGGA

gccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

761- TGGTTTAGAATCTAATACTTTA ATAGTTTCTAAGTTATAACC 770 GCTAATGAGATAAGAATAgcgg ATAAACATAAAAACTGTTGT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

771- GTTGGCTGAAAAAATTCATGC AATTTCACCATTAAAAAAAG 780 AATCAAAGAATTAAGCTTGgcg TATGATTTGCATCATTTTTAg

gccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

781- AGAAAACTTCAAGATAAGTTA TAATAACCTCTAAATTAACG 790 GTTTTATCAAATACTAAACgcgg TCACATTCTAATTTAATTTTg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

791- TGAAAAAATTAGTGGCATTAC TACTCTTCCCATTTCTCTTAG 795 TTGCTGCTATTAGTGTGTTgcgg ATCATTACTATTAGTTCTAgc

ccgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

796- ATTTCAACAGTTTTACAATGCC TTTTAACAAGTGTTTAACTA 799 TAGATAATTTAAATAAAAgcggc TAATATTTTTGGAGACAAAT

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

811- ATGTGGAAAACGTGGAAAAAA CTCTTGATGTCTTACTAAAT 820 TCCTTATAACATAGATATAgcgg GCAACCATAGCTAGTATTGT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

821- CACCAGCTGCAGTTGGTGTAC TTACAGTAATAAGAGTGAA

830 CTTTTGATAAAGCAAAAAGgcg GAAAATAATACAATTATAG

gccgcgatcctctagagtcgacctg CGgcggccgccgggtaccgagctcgaattc

831- TCTAATTTTAGTGACTGTGTAT TGATTACGAATAAATTTTAT 840 CTCTATATATATGATTCTgcggcc TCATCAACACATCGAGGTCC

gcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

841- CTTCTATAAGGTTATCAATCCC TTCATCAGTGATTTTGAATC 850 TATATTGTTTTTTGCACTgcggcc CTTGGTTTGATTCAGATTGTg

gcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

853- TATTAAAAAAATTGTTGTTTGT AATTGATAATTCATAGTTTG 860 TGTGAAGCAGGAGTAGGAgcgg GATCACTTGATGATAATCCA

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

861- GAAAATAAAAAAGATGCAGTT ACTAAATGAGAAGATCAAC 870 TCTATTTTAAATGTCTTTAgcggc CAATTCAAATTATTAATAAT

cgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

871- ATGTTTATTTACATATTCAGTT AAATACATAAAAAAGTGCC 880 TTTAAATAATCTGAATCAgcggc TTGTATTTGTAGTCAAACTA

cgcgatcctctagagtcgacctg Tgcggccgccgggtaccgagctcgaattc

881- GTTCAAAAACAACATCTGCTT AGTATTTAGAATTCCAATTA 890 GTTGGTATCAAGATTTATTgcgg CATTAAATGATGAATCAATA

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

891- GAAGTTCAAGATGTTCCTGGA TATGCCAATTATTAAATTTA 900 AGTAAATATATTTCAATTCgcgg GTGGACTAGATAAAGAACA

ccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

901- ATATTATTCTTCCTTTTTTCTAT TTTATTAGACCAAACAATAG 910 GTAATTTTATTACAAAAgcggccg AAATATCTGGTGTGTTTAAC

cgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

911- . AACTTATTGTTAAAGTCATTAA AATTGGAATCAAATTATCAT 920 CATAAAACTTAATATTTTgcggc TGATTTTAAATTCTAGTTCTg

cgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

921- AAATTTAAAACTAGTGACAAT ATCTCTTTTCTTCTTTTTCAA 930 ATAACAATTTCAGCACTTAgcgg TTTGTTCTTTAGTTGGATTgc

ccgcgatcctctagagtcgacctg ggccgccgggtaccgagctcgaattc

931- TAGAAGATTGAGTTAAGGAAT AGATTTTGTTATTTCTGATA

940 ACCTAGATAAAAATAAAAGgcg TTTCAGCTTGTATTTTTGTAg

(94D) gccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

941- TTAGAACCACTTAATGCAGAA TGTTGGAAATGTTGATTTTA 950 AAAAACAAAATTGACAAACgcg ATAAAAATGTATATCAAGC

gccgcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

951- GGAAGATTAAATTTTCCTTGTT TAACACTTCCGACTAAATAA 960 GATTAAATCTAATCATATgcggc TTATTTTGTTTATTCATACTg

cgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

961- ATGAAGCTATTAGTTATAAAG AAAATCTGAGCTTATGTTAA 970 CAAATACTTTTATGATCTTgcgg ATCCGATGAGTGATTTATCT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

971- ATTCCAAATCTTGAAAGTGTT TTTTAGTGATATAGATTTGT 980 GCTCTAATTTCAGGATCTAgcgg TGTAATTTAAAAAAAAACTT

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

981- ACAAAATAAAAGTTCAGATTT CAACTAAAGAAAATAAATT 990 AATCTGAACTTTATAATTAgcgg TCCCTTTATTGCAAAACTTA

ccgcgatcctctagagtcgacctg Cgcggccgccgggtaccgagctcgaattc

991- GAACTGGTAAGTTGAAATTAT ATTTCTTTACAAAATATTAC 1000 ATGTATAATAAGCTTTTGTgcgg TTTTTTTGAATATGAAAAAA

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1001- ACTTGTAACAAACATTAAAAA TTATAATAAATATTACAATT 1010 GATTTGTACAAAAATAATTgcg TTAATAAATTACCACAAGCA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1011- ATTGTTGCACCAACAAATCCC GAAAACTTTGAAATGCCAG

1020 ATTATAATTCCACCAATGGgcgg CATTTATGATCAACAATGCA

ccgcgatcctctagagtcgacctg Tgcggccgccgggtaccgagctcgaattc SEQ SEQ

AssemID ID bly Forward Primer Sequence NO. Reverse Primer Sequence NO.

1021- TTCGTTTTTTTCTGCGTTTTTTC GTACATATCTTTAGAAATGC

1030 AAACCTAGTAGTATTTAgcggcc TGGAGTAAGAATTATAAGA

gcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

1031- ATAATAAGTTTTATTTGAACTA ATATCTTTTATGACCTAAAT

1040 GTTCCTTTAGCTAAAGCAgcggc TAGCAACAAAATCAACTTCA

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1041- TACATTCAATATGCAGATAAT CGAAATTTCAGGATTCCCAT

1050 ATTAATACTAAAGAAAAAAgcg TAGCAAATCTTTCTGGAAAA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1051- CCAAAAAATGTTTTAGCTTGA AATTACTATTAGATAATCAA

1060 AATTCAGAAGCTCCAGCTGgcg AGAGACTGAACAATGGCTA

gccgcgatcctctagagtcgacctg Cgcggccgccgggtaccgagctcgaattc

1061- GTGGTAATAAAACATCACCAA TCAATATTAAAAAGCTTTTT

1070 ATGGTCCTATAAATGATCAgcg AATTATTTAAAATAGATTCA

gccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1071- TTTTAACAATAATATTAAACTT AGCACGTGCTTCTTTCTTAA

1080 TATAATACTGATTAAATTgcggc ACGTTAATATTATATATATT

cgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1081- CACCATTAGCTATTAGTGAAA CAACAGTTAACCAATTAGTA

1090 TGGTAATAACTTTTTTTATgcgg GTTGGATTTGTTATATTAATg

ccgcgatcctctagagtcgacctg cggccgccgggtaccgagctcgaattc

1091- GTTTTAGACCAATTATTAAAA GTTTTAGGACATATTCAACG

1100 ACGGTGAAATAATTTTTTCgcgg TGGTGGTAGACCAACTGCTA

ccgcgatcctctagagtcgacctg gcggccgccgggtaccgagctcgaattc

1101- AGTTGCTTTAGTTTCATAACCA CAAATCTGTAATTGTATTTA

1104 CTAATTTTTTGAATTTTTgcggcc AAAACTCTTAAAAAACTAG

gcgatcctctagagtcgacctg Agcggccgccgggtaccgagctcgaattc

[0642] Table 20. Primers used to produce unique synthetic second-stage assembly vectors. Overlaps to the ends of the 10-kb assembly sequences are shown in upper case.

SEQ

Assembly Primer Name Primer Sequence ID NO.

2-100 pRS-2aF GTTTTTAATTTAACTAATATTTATTACAAATAAAAAA

CTTgcggccgcgcaaggcgattaagttggg

pRS-lOOR TAACATTTATCTTTTAATTTTTCATTAACATTAGCAA

TTTgcggccgcacatccccccttcgccagc

101- pRS-lOlF TCAAACAGCAAAGCAAATGTATGGAGAAATGCTTCC

200WM3 AGAAgcggccgcgcaaggcgattaagttggg

pRS-200R CTGCTGTTAAACTTGGTATAGGAATTGATTATAAAT

ACCCgcggccgcacatccccccttcgccagc

201- pRS-201F ATTTATAATGATTATCCTTTAGATGTTTTGGTACATT

300WM1 ATAgcggccgcgcaaggcgattaagttggg pRS-300R CAAATGAAGATTGAGAAGATTTTATTGCTTTAGATG

CTCTgcggccgcacatccccccttcgccagc

301-400 pRS-301F CTTTTCTACTAATTTCATCAAATTTATGATTATGTCTT

TCgcggccgcgcaaggcgattaagttggg

pRS-400R GTTGATTTTTTAGTATTTTCAGCAACTATCATCTTAT

CAAgcggccgcacatccccccttcgccagc

401- pRS-401F TCAACTAAAATCTTTTCAAAAAAGATTTTGTGTTTTT

500WM2 TTTgcggccgcgcaaggcgattaagttggg

pRS-500R AAAATCAGATAGTTTTATAGTAAATAAATTCTTAAG

ATTTgcggccgcacatccccccttcgccagc

501-600 pRS-501F ATTAAATTAGAAAATAAACCAAATTTTGGTTCTGAT

TATTgcggecgcgcaaggcgattaagttggg

pRS-600R AAAATATCTCTAATTACTAAATCTTTATCTAATTCAT

TTAgcggccgcacatccccccttcgccagc

601- pRS-601F AAAATTTATGTAATTTATTAATTTTTATCTTTATAAT

700WM4 ATAgcggccgcgcaaggcgattaagttggg

pRS-700R ATGCTTTAGCTGACATTGTTTCAGTTTTAAAAGTTGA

TGAgcggccgcacatccccccttcgccagc

701-799 pRS-701F TAGAAAAACTCATAGCTACACCTAAAACAAAACGTT

CAGCgcggccgcgcaaggcgattaagttggg

PRS-799aR TTTTAACAAGTGTTTAACTATAATATTTTTGGAGACA

AATgcggccgcacatccccccttcgccagc

811-900 Mmyc811aF ATGTGGAAAACGTGGAAAAAATCCTTATAACATAGA

TATAgcggccgcgatcctctagagtcgacctg

Mmyc900R TATGCCAATTATTAAATTTAGTGGACTAGATAAAGA

ACAAgcggccgccgggtaccgagctcgaattc

901- pRS-901F ATATTATTCTTCCTTTTTTCTATGTAATTTTATTACAA

1000(94 AAgcggccgcgcaaggcgattaagttggg

D) pRS-lOOOR ATTTCTTTACAAAATATTACTTTTTTTGAATATGAAA

AAAgcggccgcacatccccccttcgccagc

1001- pRS-lOOlF ACTTGTAACAAACATTAAAAAGATTTGTACAAAAAT 1104 AATTgcggccgcgcaaggcgattaagttggg

pRS-1104R CAAATCTGTAATTGTATTTAAAAACTCTTAAAAAAC

TAGAgcggccgcacatccccccttcgccagc

[0643] Table 21. Primers used to produce unique vectors for cloning 100-kb natural M. mycoides fragments. Overlaps to the ends of the 100 kb natural sequences are shown in upper case.

200WM3 CAGAAgcggccgcgatcctctagagtcgacctg

101- Mmyc200R CTGCTGTTAAACTTGGTATAGGAATTGATTATAAAT

200WM3 ACCCgcggccgccgggtaccgagctcgaattc

201- Mmyc201F ATTTATAATGATTATCCTTTAGATGTTTTGGTACATT

300WM1 ATAgcggccgcgatcctctagagtcgacctg

201- Mmyc300R CAAATGAAGATTGAGAAGATTTTATTGCTTTAGATG

300WM1 CTCTgcggccgccgggtaccgagctcgaattc

301-400 Mmyc301F CTTTTCTACTAATTTCATCAAATTTATGATTATGTCT

TTCgcggccgcgatcctctagagtcgacctg

301-400 Mmyc400R GTTGATTTTTTAGTATTTTCAGCAACTATCATCTTAT

CAAgcggccgccgggtaccgagctcgaattc

401- Mmyc401F TCAACTAAAATCTTTTCAAAAAAGATTTTGTGTTTT

500WM2 TTTTgcggccgcgatcctctagagtcgacctg

401- Mmyc500R AAAATCAGATAGTTTTATAGTAAATAAATTCTTAAG

500WM2 ATTTgcggecgccgggtaccgagctcgaattc

501-600 Mmyc501F ATTAAATTAGAAAATAAACCAAATTTTGGTTCTGAT

TATTgcggccgcgatcctctagagtcgacctg

501-600 Mmyc600R AAAATATCTCTAATTACTAAATCTTTATCTAATTCA

TTTAgcggccgccgggtaccgagctcgaattc

601- Mmyc601F AAAATTTATGTAATTTATTAATTTTTATCTTTATAAT

700WM4 ATAgcggccgcgatcctctagagtcgacctg

601- Mmyc700R ATGCTTTAGCTGACATTGTTTCAGTTTTAAAAGTTG

700WM4 ATGAgcggccgccgggtaccgagctcgaattc

701-799 Mmyc701F TAGAAAAACTCATAGCTACACCTAAAACAAAACGT

TCAGCgcggccgcgatcctctagagtcgacctg

701-799 Mmyc799a TTTTAACAAGTGTTTAACTATAATATTTTTGGAGAC

R AAATgcggccgccgggtaccgagctcgaattc

811-900 Mmyc811a ATGTGGAAAACGTGGAAAAAATCCTTATAACATAG

F ATATAgcggccgcgatcctctagagtcgacctg

811-900 Mmyc900R TATGCCAATTATTAAATTTAGTGGACTAGATAAAGA

ACAAgcggccgccgggtaccgagctcgaattc

901-1000 Mmyc901F ATATTATTCTTCCTTTTTTCTATGTAATTTTATTACA (94D) AAAgcggccgcgatcctctagagtcgacctg

901-1000 MmyclOOO ATTTCTTTACAAAATATTACTTTTTTTGAATATGAAA (94D) R AAAgcggccgccgggtaccgagctcgaattc

1001- MmyclOOl ACTTGTAACAAACATTAAAAAGATTTGTACAAAAA 1104 F TAATTgcggccgcgatcctctagagtcgacctg

1001- Mmycl l04 CAAATCTGTAATTGTATTTAAAAACTCTTAAAAAAC 1104 R TAGAgcggccgccgggtaccgagctcgaattc ii. Assembly of 10 kb synthetic intermediates

[0644] Fragments of the donor genome were supplied as DNA cassettes at about equal concentrations and contained in an E. coli cloning vector. Equal amounts of these cassettes were pooled in sets of 10, digested with Notl to release the inserts, gel-purified, and then mixed with the host vector, a unique yeast/E. coli shuttle vector. a. Preparation of cassette DNA

[0645] Approximately 500 ng uncut cassette DNA was pooled in sets of 10, digested with Notl, and electrophoresed on a 1% low-melting point agarose gel for 90 min at 96 V. One kb DNA fragments were cut from the gels and the masses of the gel slices were measured. A 1:10 solution of 1 OX TAE buffer containing 3M sodium acetate was added to each gel slice, and the agarose gel was melted at 65 °C for 10 min. After the gel slices are melted, they are incubated at 42 °C for 15 min, β-agarase (NEB) was added 1 :50 and the incubation was continued for 1 h longer. Following a phenol extraction and ethanol precipitation (in the presence of 1 μΐ glycoblue), DNA was resuspended in 40 μΐ TE (pH 8.0). Ten microliters was used in transformation experiments. b. Host vector

[0646] This host vector is a bacterial artificial chromosome (BAC; pCClBAC

[Epicentre]) with an inserted histidine auxotrophic marker, centromere, and origin of replication for selection and propagation in yeast. Yeast propagation elements were already designed into assembly 831-840. For this reason, the cloning vector for this assembly only included the BAC elements (pCClBAC). Unique first-stage assembly vectors were produced by PCR-amplification with primers that contained 40 bp overlapping sequence to the ends of the cassettes that were to be assembled (Gibson et ah, Science 319, 1215 (Feb 29, 2008)). c. Yeast transformation

[0647] Also included in these primers were Notl restriction sites, which allowed the assembled cassettes to be released intact from the vector. The host vector/cassette mix was then transformed into yeast and incubated on selective plates for several days.

[0648] In the yeast spheroplast transformation procedure, cells are treated with zymolyase to remove the cell wall and then made competent to take up foreign DNA by treatment with PEG and CaCl2. This procedure was carried out using a previously published protocol with the VL6-48N yeast strain (<5) with one modification: cells were grown to an OD600 of 0.5 (-10 cells/ml) prior to the preparation of yeast spheroplasts. We have found this optical density to be optimal for the assembly of multiple overlapping fragments in yeast. The Notl digested fragments were pooled, mixed with 40 ng unique PCR-amplified assembly vector (except for the final stage of assembly), and then added to ~2 X 108 yeast spheroplasts. After transformation, yeast spheroplasts were regenerated and selected on complete supplemental medium without histidine (CSM-His; 10 kb assemblies, 811-900, and complete genome) or without tryptophan (CSM-Trp; 100 kb assemblies with the exception of 811-900) and 1M sorbitol agar plates for 3 days at 30 °C. Primary transformants were then transferred onto selective plates as small patches and incubated overnight at 30 °C. d. Screening and preparation for second stage assembly

[0649] Plasmid DNA was extracted from individual yeast clones and transformed into E. coli, a more suitable host for propagation of the assembled cassettes. Plasmid DNA was then isolated from individual E. coli clones and digested with NotI to screen for cells containing a vector with an assembled lOkb insert (gel data showing successful 10 kb assembly: data not shown).

[0650] DNA was extracted from ~107 yeast cells (from patches) using a QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer's instructions with one modification: buffer PI was supplemented with 1:1000 β-mercaptoethanol and 1:100 20mg/ml Zymolyase- 100T (USB), and cells were incubated at 37 °C for 30-60 min prior to the addition of buffer P2. Samples (up to 3 μΐ) of the yeast-extracted DNA were transformed into 30 μΐ EPI300™ (Epicentre) electrocompetent E. coli cells in a 1-mm cuvette (BioRad) at 1,200 V, 25 μΡ and 200 Ω using a Gene Pulser Xcell Electroporation system (BioRad). Cells were allowed to recover at 37 °C for 1.5 h in 1 ml SOC medium then plated onto LB medium containing 12.5 μg/ml chloramphenicol. After incubation at 37 °C for 16-24 h, individual colonies were selected and grown in 3 ml LB medium with 12.5 μg ml chloramphenicol overnight at 37 °C.

[0651] DNA was prepared from these cells by alkaline lysis using the PI, P2 and P3 buffers (Qiagen), followed by isopropanol precipitation. DNA pellets were dissolved in TE buffer (pH 8.0) containing RNase A and RNase Tl (Ambion). Alternatively, DNA was prepared from the QIAprep Spin Miniprep Kit (Qiagen) according to the instruction provided.

[0652] Following purification, DNA was digested with NotI (and occasionally Sbfl) to release the insert from the vector and sized by gel electrophoresis on 0.8% E-gels

(Invitrogen) for 30-60 min. Bands were visualized using an Amersham Typhoon 9410 Fluorescence Imager. [0653] Positive clones were propagated in 10 ml LB medium containing 12.5 μg/ml chloramphenicol and 1 :1000 induction solution (Epicentre) and incubated overnight at 37 °C. The cultures were collected and the DNA molecules were purified using the QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer's instructions. Assembly 211-220 was unstable in the Epi300™ strain, so it was transferred to the Stbl4 strain (Invitrogen), where it could be stably maintained. This assembly cannot be induced to higher copy levels in this strain and was not column-purified as above. Instead, this clone was propagated in 50 ml LB medium containing 12.5 μg/ml chloramphenicol. After neutralization of the lysed cells, these DNA molecules were centrifuged then precipitated with isopropanol. DNA pellets were dissolved in TE buffer (pH 8.0) then RNase treated, phenolchloroform extracted and ethanol precipitated. DNA pellets were dissolved in TE buffer. For each 10 kb assembly, Notl- digested DNA was quantified by gel electrophoresis alongside known DNA standards.

[0654] In general, at least one 10 kb assembled fragment could be obtained by screening 10 yeast clones. However, the rate of success varied from 10-100%. One assembly, 791-799, could not be produced by homologous recombination in yeast. This fragment was divided into two parts, 791-795 and 796-799, which were individually assembled by in vitro recombination (Gibson et al , Nat Methods 6, 343 (May, 2009)). With the exception of 211 - 220, all first stage assemblies were propagated in Epi300 E. coli cells (Epicentre). This cell line allows for induction of the cloning vector from single-copy to high-copy numbers.

Assembly 211-220 was unstable in Epi300 cells and so was transferred to Stbl4 cells, where it could be stably maintained.

[0655] All of the first-stage intermediates were sequenced. Nineteen out of 111 assemblies contained errors. Our sequencing analysis revealed that assemblies 81-90 and 811-820 each contained a single error originating from cassettes 82 and 812, respectively. Cassette 82 was corrected at the 1-kb level and reassembled to produce an error-free clone of 81-90. The mutation in cassette 812 occurred in the 811 overlap, which does not contain an error.

Therefore, when additional 811-820 clones were sequenced, some of these did not contain errors. One sequence-verified 811-820 clone was used in subsequent assembly reactions. We opted not to correct an error that was present in 121-130 since it was a synonymous mutation in a non-essential gene. This mutation served as an additional variation to further distinguish the synthetic genome from a natural one (Table 18). One mutation could be avoided by maintaining the assembled fragments at single-copy number during propagation in E. coli. One error was produced by incomplete removal of the Notl restriction site at one of the cassette junctions. Four errors likely originated from the primers used to PCR-amplify the cloning vectors. The remaining errors were produced during propagation in yeast. Alternate clones of 15 assemblies were selected and sequence- verified. iii. Assembly of 100 kb synthetic intermediates

a. Preparation of DNA

[0656] Equal amounts of the 10 kb assembly intermediates were pooled in sets of 10, digested with Notl to release the inserts, and then gel-purified. Approximately 125 ng uncut DNA was pooled in sets of 10, digested with Notl (and usually also with Sbfi to provide better separation between the vector bands and insert) and electrophoresed on a 1% low- melting point agarose gel for 90 min at 96 V. Ten kb DNA fragments were cut from the gels and extracted following β-agarase treatment as described above. DNA was resuspended in 20 μΐ TE (pH 8.0). Ten microliters was used in transformation experiments with 40 ng vector. b. Host vector

[0657] These gel-purified assemblies were mixed with a unique second-stage host vector, which were prepared as above except pRS414 (Sikorski and Hieter, Genetics 122, 19 (May, 1989)) was used as PCR template. Since the selectable marker in yeast would be changed from histidine to tryptophan, we reasoned that the background of undesired clones would be reduced. Yeast propagation elements would already be present in assembly 811-900.

Therefore, as with assembly 831-840, the cloning vector for assembly 811-900 only consisted of BAC elements. c. Yeast transformation

[0658] The pooled 10-kb assemblies and their respective cloning vectors were

transformed into yeast as above to produce 100 kb assembly intermediates. This resulted in several hundred yeast clones. d. Screening and preparation for final donor genome assembly

[0659] To demonstrate the expected PCR patterns for each of the 100-kb assemblies, the multiplex PCR primers listed in Table 22 were used to screen YCpMmycl .1, which was extracted from yeast. PCR amplicons are spaced 100 bp apart. Table 22

[0660] With the exception of amplicon 1 Od (underlined; the region corresponding to 931 - 940), and assembly 796-799, all first-stage assemblies can be accounted for by this PCR analysis. Downstream analyses were used to further confirm the 701-799 and 901-100 intermediates. The results indicated that M. mycoides 100 kb assembly intermediates cannot be stably maintained in E. coli, so the method used to screen the 10 kb assemblies could not be employed. Instead, one hundred ten primer pairs, producing amplicons ranging in size from 100 bp to 1150 bp, were designed such that they can produce 9-11 amplicons in each of 11 individual multiplex PCR reactions; one for each 100 kb assembly intermediate (Table 23 and Table 24).

Table 23: Amplicons

[0661] Table 24: Multiplex PCR primers used to identify 100-kb intermediates containing all first-stage assemblies.

Primer name Primer sequence Amplicon SEQ size (bp) ID

NO.

C5aFSetl(l) ACTTATCTCGTAGACAAGATATTTATCAAAAC 100

C5aRSetl(l) GCAACCTCACAAGCTTCTTGT

C16FSetl(2) ATCAATATAATGTTAATTTTTCTTCATTATATTATG 200

C16RSet 1(2) ATAAGCATAAATAACATTATCTCCAACTTTTATA

C25 F Set 1(3) AAAACTATTACAGTATCTGATAATGACTTTTTTAC 300

C25RSet 1(3) TAATAATTCAACTTTTCCAAGTGTTTTACT

C35 F Set 1(4) TAAGGTTAAACAAACTATTAGAGTAAAAACAATAAT 400

C35RSetl(4) ATTTTGTTTTTGAGTCTTTTTGAAATC

C45 F Set 1(5) TAAAATTAGTTTGCTCTAGTTTTAAAAAAAGC 500

C45 R Set 1(5) AAATGATATTTTATTACAAGTTATTAAATTTTATGAT

TATC

C55 F Set 1(6) ACATCAACATTAATATCAATATTTTTTTTAATATC 600

C55RSet 1(6) TTTACAGGACAAACTGGAGCTG

C65 F Set 1(7) CCAATCAGTTAATCTTGGTCTTG 700

C65RSetl(7) AACAATTGATCAAATTATTGGTGATC

C75 F Set 1(8) TGCTTCAAGATATTTTAAAAATCCTTTAG 800

C75 R Set 1(8) TTAAAAAACCAGCTGTATTTGTTTTAAA

C85 F Set 1(9) AAGTATGTGTTCTTTTCATATATCTCCTTATTT 900

C85RSetl(9) CACCAATTAGGGATCGAAGTT

C95 F Set 1(10) TTACATTAGCACCCCTACTTCTCAT 1000

C95R Set 1(10) ATTTAAATAGTTTAAATATAGCAAGACAAAAAAATT

C105FSet2(l) TATTTTCTTTTAAAACTTCACTACCAGTTG 125

C105RSet2(l) TGATTTTATAGATAAAAAAGGGTATGGAA

[0662] Because every 10 kb assembly intermediate was represented by a primer pair, the presence of all amplicons would suggest an assembled 100-kb intermediate. DNA was extracted from 10 or more yeast clones and analyzed by multiplex PCR with the respective sets of primer pairs. DNA was extracted from patches as above.

[0663] Multiplex PCR was performed using a Qiagen Multiplex PCR Kit using primers identified in Table 24. A 1/50 volume (1 μΐ) of the DNA extract and 1 μΐ of a 10X primer stock containing 20 oligos at 2.5 - 5.0 μΜ each were included in each 10 μΐ reaction. Cycling parameters were 94 °C for 15 min, then 35 cycles of 94 °C for 30 s, 57-60 °C for 90 s, and 72 °C for 90s, followed by a single, 3-min incubation at 72 °C. Then, 2 μΐ of each reaction was loaded onto a 2% E-gel® (Invitrogen), and 72 V was applied for 30 min. Bands were visualized using a Typhoon 9410 Fluorescence Imager.

[0664] For a small-scale isolation of 100 kb supercoiled circular assemblies from yeast, a 5 ml saturated yeast culture was grown in selective medium. The procedure is based on a previously described method (Leem et al. (2008) Genome, 51: 155) but scaled down and without emphasis on removing yeast chromosomal DNA.

[0665] Briefly, harvested yeast cells were transferred to a microfuge tube with 1 ml water, and resuspended in 1 ml Pretreatment Buffer (1.2 M sorbitol, 200 mM Tris-Cl, 100 mM EDTA, pH to 9.1) with 8 μΐ 14 M β-mercaptoethanol. Following a 10 min incubation at room temperature, cells were harvested, washed twice with 1 ml SCE (1M sorbitol, 60 mM

EDTA,100 mM sodium citrate, pH 5.75), and resuspended in 1 ml SCE plus 10 μΐ

Zymolyase-IOOT solution (20 mg/ml Zymolyase-IOOT [USB], 50% glycerol, 2.5% glucose, 50 mM Tris-Cl, pH 8.0). Following a 1 hour incubation at 37 °C, spheroplasts were harvested and then resuspended in 25 μΐ Tris/sucrose buffer (50mM Tris-Cl pH 8.0, 25% Sucrose) and 20 μΐ proteinase K solution (lOmg/ml proteinase K [Sigma], 1 mM calcium chloride, 50 mM Tris-Cl pH 8.0). Next, 475 μΐ Lysis Buffer (20mM EDTA, 50mM Tris-Cl, 1% SDS, pH 12.45) was added and mixed by pipetting up and down. Following a 30-min incubation at 37 °C, 100 μΐ 2M Tris-Cl pH 7.0 was added and mixed. Next, 100 μΐ 4M NaCl was added and mixed. Following a 30-min incubation at room temperature, 70 μΐ 3M sodium acetate was added and mixed. A standard phenol-chloroform extraction, isopropanol precipitation, and 70% ethanol wash was carried out and DNA pellets were resuspended in 100 μΐ TE pH 8.0 containing RNase A. Following a one-hour incubation at 37 °C, 10 μΐ DNA was loaded onto a 1% Agarose gel in IX TAE buffer and electrophoresis was carried out for 3 hours at 4.5V/cm. After electrophoresis, the gel was stained with SYBR® Gold and scanned with a GE Typhoon 9410 imager.

[0666] In general, 25% or more of the clones screened contained all of the amplicons expected for a complete assembly. One of these clones was selected for further screening. Circular plasmid DNA was extracted and sized on an agarose gel alongside a supercoil marker. Successful second-stage assemblies with the vector sequence are approximately 105 kb in length (data not shown). When all amplicons were produced following multiplex PCR, a second-stage assembly intermediate of the correct size was usually produced. In some cases, however, small deletions occurred. In other instances, multiple lOkb fragments were assembled, which produced a larger second-stage assembly intermediate. Fortunately, these differences could easily be detected on an agarose gel prior to complete genome assembly. iv. Final assembly of synthetic donor genome

a. Preparation of DNA

[0667] In preparation for the final stage of assembly, microgram quantities of each of the 11 second-stage assemblies were isolated; this was not trivial since these assemblies had to be purified out of yeast. As previously reported (Devenish and Newlon, Gene 18, 277 (Jun, 1982)), we found that circular plasmids the size of our second-stage assemblies could be isolated from yeast spheroplasts following an alkaline-lysis procedure. To further purify the 11 assembly intermediates, they were exonuclease-treated and passed through an anion- exchange column. A small fraction of the total plasmid DNA (1/100th) was digested with Notl and analyzed by field-inversion gel electrophoresis (FIGE) (data not shown). This method produced ~1 μg of each assembly per 400 ml yeast culture (~10n cells).

[0668] For a large-scale isolation of 100 kb assemblies from yeast, a pre-culture (5 to 10 ml) of each VL6-48N strain harboring one of the eleven 100 kb assemblies was grown overnight to saturation in selective medium and then inoculated into 400 ml of selective medium. Once the culture reached an OD600 of 1.5, cells were harvested (2,205 rcf, 3 min). Pellets were resuspended in 100 ml water and transferred to two 50 ml conical tubes and harvested as above. Cell pellets were resuspended in 40 ml SPE (1 M Sorbitol, 10 mM Na2EDTA, 0.01 M Na phosphate, pH 7.5) containing 0.4 ml Zymolyase-20T (10 mg/ml) and 40 μΐ 14 M β-mercaptoethanol. The cell suspension was incubated at 37 °C for 60 min.

Spheroplasts were harvested (1,125 rcf for 5 min) and resuspended in 1 ml 1 M Sorbitol, and then 20 ml of Lysis Buffer (0.05 M Tris-HCl, 0.02 M EDTA, 1% SDS, pH 12.8) was added and the tubes were inverted 10 times. Cell lysates were incubated at 37 °C for 30 min and then extracted with 20 ml phenol/chloroform/isoamyl-alcohol (Invitrogen) following 20 gentle inversions and centrifugation at 3,645 rcf for 20 min.

[0669] The aqueous phase was transferred to a new 50 ml conical tube. DNA precipitation was carried out by adding 2 ml 3M NaAc (pH 5.2) and 20 ml of isopropanol, followed by centrifugation at 3,645 rcf for 30 min at 4 °C. The pellets were resuspended in 1 ml TE (pH 8.0) containing RNase A (30 μg/ml) and incubated at 37 °C for 30 min. At this point, the two DNA samples were combined. The circular DNA was further purified by the Qiagen Large- Construct Kit. The purification was performed according to the manufacturer's instructions with some minor modifications. Ten ml of EX Buffer was mixed with the DNA solution, followed by the addition of 200 μΐ Exonuclease and 300 μΐ 100 mM ATP. After a 45-min incubation at 37 °C, the reaction was stopped by adding 12 ml of QS buffer. This solution was then applied to the Qiagen-tip 500 column. The column was washed with 30 ml of QF buffer, and DNA was eluted with 12 ml QF buffer, pre- warmed at 55 °C. DNA was then precipitated overnight at -20 °C by the addition of 2 volumes of ethanol, in the presence of 1.2 ml 3M NaAc (pH 5.2), 15 μΐ of GlycoBlue (Ambion), and 15 μΐ of yeast total tRNA (Sigma).

[0670] Alternatively, D A was precipitated by the addition of 1 volume isopropanol. The precipitated DNA was recovered by centrifugation at 3,645 rcf for 1 hr at 4 °C. DNA pellets were washed with 70% ethanol and resususpended in 150 μΐ TE (pH 8.0). A sample (0.75 μΐ) of each was digested with NotI and analyzed by U-2 FIGE. The FIGE analysis was performed on a 1% agarose gel (BioRad, catalog # 161-3016) in IX TAE buffer without circulation and the parameters are forward 90 V, initial switch 5.0 sec, final switch 30 sec, with linear ramp, and reverse 60 V, initial switch 5.0 sec, final switch 30 sec, with linear ramp. After electrophoresis, the gel was stained with SYBR® Gold and scanned with a GE Typhoon 9410 imager. b. Yeast transformation

[0671] The method above does not completely remove all of the linear yeast chromosomal DNA, which we found could significantly decrease the yeast transformation and assembly efficiency. In order to further enrich for the eleven circular assembly intermediates, ~200 ng samples of each assembly were pooled and mixed with molten agarose. As the agarose solidifies, the fibers thread through and topologically "trap" circular DNA (Dean et al., Anal Biochem 56, 417 (Dec, 1973)). Untrapped linear DNA can then be electrophoresed out of the agarose plug, thus enriching for the trapped circular molecules. The eleven circular assembly intermediates were digested with NotI so that the inserts could be released. Subsequently, the fragments were extracted from the agarose plug, analyzed by FIGE (data not shown), and transformed into yeast spheroplasts. In this third and final stage of assembly, an additional vector sequence was not required since the yeast propagation elements were already present in assembly 811-900. Following incubation on selective plates, approximately 100 colonies appeared.

Topological trapping and analysis

[0672] Twenty microliters of each uncut 100 kb assembly were pooled and equilibrated to 50 °C. One volume (220 μΐ) of 2% low melting point agarose, also equilibrated to 50 °C, was mixed with the pooled DNA. Approximately 85 μΐ of this mixture was added to agarose plug molds (Bio-Rad), which were kept cold on ice. Following a 30 min incubation on ice, agarose plugs were added to the wells of a 1% agarose gel (I TAE buffer) and electrophoresis was carried out at 4.5 V/cm for 2 hours. Plugs were removed from the agarose gel and washed by inverting in 5 ml 0.1X Wash Buffer (Bio-Rad CHEF Genomic DNA Plug Kit) for 1 hour at room temperature. This buffer was removed and 5 ml IX Buffer 3 (NEB) was added.

Following a 1 hour incubation/inversion at room temperature, the buffer was removed and fresh IX Buffer 3 (2.5 ml) with 250 units Notl was added. Notl digestion was carried out by incubating the agarose plugs overnight at 37 °C.

[0673] Agarose plugs were inverted in 5 ml IX TAE/0.3M sodium acetate solution for 1 hour. Agarose plugs were then moved to a microfuge tube. A solution of 10X TAE buffer containing 3M sodium acetate was added 1:10 (-40 μΐ) to the gel slice, and the agarose gel was melted at 68 °C for 7 min after an initial incubation at 50 °C for 15 min. Following melting of the gel slices, they were incubated for 15 minutes at 42 °C, β-agarase (New England Biolabs) was added 1:50 (~8 μΐ) and the incubation was continued for 1 h longer. Following a gentle phenol extraction (by slowly inverting the tube for 10 min), and a standard ethanol precipitation (in the presence of 1 μΐ glycoblue), DNA was resuspended in 20 μΐ TE (pH 8.0). All but 0.5 μΐ was used to transform yeast. This 0.5 μΐ sample was analyzed U-2 FIGE as above.

Yeast Agarose Plugs

[0674] Yeast cultures (50 ml) were grown in CSM-His plus adenine medium (Teknova) to an OD600 of 1.0. Cultures were harvested and then washed with 50 ml water. Next, the cultures were harvested and then washed with 10 ml EDTA pH 8.0. The cultures were harvested and then transferred to microfuge tubes with 750 μΐ cell resuspension buffer. Cell pellets were then resuspended in 150 μΐ cell resuspension buffer. This mixture was equilibrated to 50 °C and then mixed with 85 μΐ Zymolyase-IOOT solution (20 mg/ml Zymolyase-IOOT [USB], 50% glycerol, 2.5% glucose, 50 mM Tris-Cl, pH 8.0) and 225 μΐ 2% low melting point agarose. Approximately 85 μΐ of this mixture was added to agarose plug molds (Bio-Rad), which were kept cold on ice. Following a 30 min incubation on ice, plugs were added to 5 ml Lyticase buffer (lOmM Tris-Cl pH 7.5, 50 mM EDTA pH 8.0) containing 500 μΐ Zymolyase-IOOT solution. Following incubation at 37°C for 2 hours, plugs were washed with 25 ml water. The Bio-Rad CHEF Genomic DNA Plug Kit was used to carry out the Proteinase K incubation and wash steps and is described in the manual that is provided with the kit. c. Screening and analysis of synthetic donor genome

[0675] In order to screen for a complete genome, multiplex PCR was carried out with 11 primer pairs that produce 11 amplicons ranging in size from 337 bp to 1149 bp, in one reaction (Table 25).

[0676] Table 25. Multiplex PCR primers used to identify complete assembled genomes. This primer set is referred to as TSS2; each primer set crosses one of the eleven 100-kb junctions.

[0677] Yeast clones containing a completely assembled synthetic genome were screened by multiplex PCR with a primer set that produces 11 amplicons; one at each of the 11 assembly junctions. Primer pairs were designed to span each of the eleven 100-kb assembly junctions. Of 48 colonies screened, DNA extracted from one clone (sMmYCp235) produced all 11 amplicons. PCR of the WT positive control (YCpMmycl.l) produced an

indistinguishable set of 11 amplicons (data not shown). To further demonstrate the complete assembly of a synthetic M. mycoides genome, intact DNA was isolated from yeast in agarose plugs and subjected to two restriction analyses; AscI and BssHII. Since these restriction sites are present in three of the four watermark sequences, this choice of digestion produces restriction patterns that are distinct from the natural M. mycoides genome (Figure 20 and Table 26). Natural (WT) and synthetic (235) M. mycoides genomes were isolated from yeast in agarose plugs. In addition, DNA was purified from the host strain alone. Agarose plugs were digested with AscI or BssHII and fragments were separated by clamped homogeneous electrical field (CHEF) gel electrophoresis.

Restriction analysis of M. mycoides genomes propagated in yeast

[0678] Yeast agarose plugs were washed two times for 1 hr in 1ml of 0.1 X Wash Buffer (Bio-Rad) and equilibrated for 1 hr in 1 ml of IX Buffer 2 supplemented with BSA (NEB). The yeast chromosomal DNA was digested overnight with 50 units each of the restriction enzymes AsiSI and RsrII (these enzymes do not digest the M. mycoides genome). Plugs were then loaded onto a 1% TAE agarose gel to run digested yeast genomic DNA fragments out of the plugs (the circular M. mycoides genomes remain in the plug). The agarose gel was electrophoresed for 3 hours at 6V/cm. After electrophoresis, the agarose plugs were removed from the wells and were washed two times for 1 hr in 1 ml of 0.1 X Wash Buffer and equilibrated for 1 hr in 1 ml of IX Buffer 3 (NEB; for BssHII digests) or IX Buffer 4 (NEB; for AscI digests). The M. mycoides genomic DNA was digested overnight with 50 units of the restriction enzyme BssHII or 50 units of AscI. Following incubation, all plugs were washed for 1 hour with 1 ml 0.1 X Wash Buffer at room temperature and loaded on an agarose gel and subjected to pulsed-field gel electrophoresis. All restriction enzymes were purchased from NEB.

Pulsed-field gel electrophoresis

[0679] Yeast agarose plugs (Figure 4c) and M. mycoides agarose plugs (Figure 5b) were subjected to pulsed-field electrophoresis in a 1% agarose gel in IX TAE with 0.5 μg/ml ethidium bromide with circulation at 14 °C, with a contour-clamped homogeneous electric field (CHEF DR III; Bio-Rad). Pulse times were ramped from 60 to 120 s for 20-24 hr at 4.0 V/cm. Sequence analysis of M. mycoides JCVI-synl genome isolated from M. mycoides JCVI- synl cells.

[0680] Cells were grown in SP4 medium containing 10 mg/1 tetracycline and genomic DNA was extracted using a Promega Genomic DNA Extraction Kit. DNA was sequenced using a combination of 454 and Sanger technologies. Gaps were closed using a combination of sequencing PCR amplicons covering the gap and direct genomic walks. The genome was assembled using the Celera Assembler. The sMmYCp235 clone produced the restriction pattern expected for a completely assembled synthetic genome (data not shown).

Table 26

[0681] The sizes of the expected Asc I and BssH Π restriction fragments for natural (WT) and synthetic (Syn235) M. mycoides are shown. v. Transplantation of synthetic donor genome into recipient cells

[0682] Additional agarose plugs used in the gel analysis above were also used in genome transplantation experiments. Intact synthetic M. mycoides genomes from the sMmYCp235 yeast clone were transplanted into restriction-minus M. capricolum recipient cells, as previously described (Lartigue et a/., Science 325, 1693 (Sep 25, 2009)). Results were scored by selecting for growth of blue colonies on SP4 medium containing tetracycline and X-gal at 37 °C. Genomes isolated from this yeast clone produced 5-15 tetracycline-resistant blue colonies per agarose plug. This was comparable to the YCpMmycl.l control. Recovery of colonies in all transplantation experiments was observed when both M. capricolum recipient cells and an M. mycoides genome were present.

[0683] To rapidly distinguish the synthetic transplants from M. capricolum or natural M. mycoides, two analyses were performed. First, four primer pairs that are specific to each of the four watermarks were designed such that they produce four amplicons in a single multiplex PCR reaction (Table 27). Table 27

[0684] Transplants containing a synthetic genome were screened by multiplex PCR with a primer set that produces 4 amplicons; one internal to each of the four watermarks. One transplant (synl) originating from yeast clone sMmYCp235 was analyzed alongside a natural, non-synthetic genome (WT) transplanted out of yeast.

[0685] All four amplicons were produced by transplants generated from sMmYCp235, but not YCpMmycl.l (data not shown).

[0686] Second, the gel analysis with AscI and BssHII, described above, was performed. Briefly, natural (WT) and synthetic (synl) M. mycoides genomes were isolated from M. mycoides transplants in agarose plugs. Agarose plugs were digested with AscI or BssHII and fragments were separated by CHEF gel electrophoresis. Restriction fragments corresponding to the correct sizes are indicated by the fragment numbers shown in Table 25. The restriction pattern obtained was consistent with a transplant produced from a synthetic M. mycoides genome (data not shown).

[0687] A single transplant originating from the sMmYCp235 synthetic genome was sequenced. With the exception of the known polymorphisms that occurred during the synthesis process, and 8 new polymorphisms and an unexpected E. coli transposon insertion, the sequence matched the intended design. This strain is referred to as M. mycoides JCVI- synl. Colonies were grown on SP4 agar containing Xgal to make the cells expressing beta- galactosidase blue. Both the JCVIsynl and wild type colonies were 0.5 mm in diameter. In a test of the hemolytic capacity of both the JCVI-synl and wild type organisms, colonies were overlaid with agar containing 5% sheep red blood cells. The wild type M. mycoides lysed the cells directly beneath the colonies. This pattern and slight green tint of the agar is

characteristic of alpha hemolysis. The M. mycoides JCVI-synl colonies did not lyse the red blood cells.

[0688] The transplants are outwardly no different from wild type M. mycoides subspecies capri. Colony morphology and growth rates were indistinguishable (data not shown);

however we did program the synthetic genome to be phenotypically distinct from wild type M. mycoides capri. This mycoplasma species is an opportunistic pathogen of goats (DaMassa et al., Am J Vet Res 44, 322 (Feb, 1983)), but not humans. The virulence mechanism is thought to be bacterial production of hydrogen peroxide, which damages the tissues of infected animals. In M. mycoides, hydrogen peroxide is a byproduct of glycerol metabolism. To ameliorate the pathogenic potential of our synthetic genome, we omitted the genes encoding the M. mycoides ABC glycerol transporter (gtsA, gtsB, gtsC, and gtsD) (P. Pilo et al., JBacteriol 187, 6824 (Oct, 2005); E. M. Vilei, J. Frey, Clin Diagn Lab Immunol 8, 85 (Jan, 2001)). As a result of this omission, M. mycoides JCVI-synl did not lyse sheep red blood cells, while wild type organisms demonstrated alpha hemolysis characteristic of hydrogen peroxide damage of red blood cells (data not shown). Hemolysis is a standard assay for mycoplasma virulence.

Example 6C

Semi-synthetic Donor Genome Assembly and Transplantation

[0689] A method was developed to independently validate the viability of individual 100- kb synthetic assemblies, since any errors in the genome may not produce transplants. To aid in testing the functionality of each 100-kb synthetic segment, semi-synthetic genomes were constructed and transplanted. By mixing natural pieces with synthetic ones, the successful construction of each synthetic 100-kb assembly could be verified without having to sequence these intermediates. We cloned 11 overlapping natural 100-kb assemblies in yeast by using a previously described method (Leem et al, Nucleic Acids Res 31, e29 (Mar 15, 2003)). In 11 parallel reactions, yeast cells were co-transformed with fragmented M. mycoides genomic DNA (YCpMmyc 1.1) that averaged -100 kb in length and a PCR-amplified vector designed to overlap the ends of the 100 kb inserts. To maintain the appropriate overlaps so that natural and synthetic fragments could be recombined, the PCR-amplified vectors were produced using primers with the same 40-bp overlaps used to clone the 100-kb synthetic assemblies. The semi-synthetic genomes that were constructed contained between two and ten of the eleven 100-kb synthetic subassemblies. Once viable colonies were produced following transplantation, the synthetic fraction of each genome was determined to contain no lethal mutations. It became apparent that only one of the 100-kb sub-assemblies, 811-900, was not viable.

[0690] Initially, the error-containing 811-820 clone, described above, was used to produce a synthetic genome that did not transplant. This was expected since the single base pair deletion created a frameshift in dnaA, an essential gene for chromosomal replication. We were previously unaware of this mutation. By using a semi-synthetic genome construction strategy, we were able to rapidly identify 811-900 as the source for failed synthetic transplantation experiments. Thus, we began to reassemble an error-free 811-900 assembly, which was used to produce the sMmYCp235 yeast strain. The dnaA -mutated genome only differs by one nucleotide from the synthetic genome in sMmYCp235. This genome served as a negative control in our transplantation experiments. The dnaA mutation was also repaired at the 811-900 level by genome engineering in yeast (Noskov, Segall-Shapiro, and Chuang, Nucleic Acids Res, (Mar 12, 2010)). A repaired 811-900 assembly was used in a final stage assembly to produce a yeast clone with a repaired genome. This yeast clone is named sMmYCP142 and could be transplanted. A complete list of genomes that have been assembled from 11 pieces and successfully transplanted is provided in Table 28. Table 28

Genomes that have been assembled from 11 pieces and successfully transplanted

Example 6D

Verification of cassettes, assembly intermediates and M. mycoides JCVI-svnl

[0691] Just as the construction scheme for the synthetic cell genome followed a tiered hierarchy (1-kb cassettes, 10-kb subassemblies, 100-kb subassemblies, and the completed synthetic genome), so did the quality-control efforts to ensure that the DNA being assembled had the sequence that it was designed to have. Because of variable cost constraints, variable time constraints, and the intrinsic differences in sequencing, many small regions of DNA with overlapping sequence from sequencing one large region of largely non-repetitious DNA, different strategies of sequencing were applied to each tier. The easiest, most economical, and fastest methods of sequence validation were substantially different at each of the different tiers of the construction effort. Also, the variable limitations of these methods caused a minority of mutations introduced at the cassette level to persist all the way to the 100-kb tier. Also, every tier of assembly was associated with the creation of some mutations in a minority of cases. This demonstrates the need for a quality control effort at all levels of synthetic biology efforts that endeavor to construct large regions of DNA. 1-kb cassette verification.

[0692] Cassettes were purchased from Blue Heron. Blue Heron also provided sequence trace files confirming the sequences of the delivered DNA; these trace files were processed in a semi-automated manner. In-house base-calling software was used to extract sequence from the trace files into fasta format. The resulting sequence files were aligned to the target reference sequence using ClustalW (Larkin et al., Bioinformatics 23: 2947 (2007)) with default settings. The resulting pair-wise alignments were parsed with PERL scripts written for the purpose and sequence positions which did not match the target reference sequence were identified. Because each 1-kb cassette was covered by two or more Blue Heron provided trace files, which in turn gave rise to as many pairwise alignments, the list of mismatched positions from all pair- wise alignments covering a particular 1-kb cassette were reconciled with each other. This was done by another custom PERL script, and cassette- positions that differed from the target sequence when all reads were taken into account were then manually analyzed.

[0693] Of 1031 cassettes, 578 passed wholly automated screening. Of the remaining 453 cassettes, 370 had discrepancies that fit into categories that were judged not to require direct manual analysis of the trace files. There were two such categories: 1) The apparent sequence deviation was in the Notl site flanking the cassette. This was common due to the poor performance of Sanger sequencing immediately following the sequencing primer, but was not of any concern because the intactness of the Notl site was immediately testable in the normal course of the processing of the cassette which involved cutting the cassette out of the cloning vector with Notl, and gel purifying it. 2) Some of the Blue Heron trace files contained unusually broad C peaks as is sometimes associated with the oxidation of the C-big-dye terminator reagent. As a result, some of the trace files gave rise to incorrect base calls of C. Eighty-three (83) of the 453 cassettes that did not pass automated verification had their trace files inspected by eye; 62 were deemed to not require in-house re-sequencing, and 21 were re-sequenced. Three of the 1-kb cassettes were, in the final analysis, determined to have mutations (two single nucleotide deletions and one single nucleotide substitution), but only one of those was found during the screening of Blue Heron provided trace files. The failure to detect the other two errors at the 1-kb tier was largely due to the poor quality of a minority of reads (those with unusually broad C peaks) and in one case, the incorrect clone having been delivered. All 1-kb cassettes that passed this screen were used to create 10-kb subassemblies. 10-kb assembly intermediate verification.

[0694] The 10-kb subassemblies were pooled and verified via 454 sequencing using non- paired-end reads. Initially, 116 10-kb assemblies were screened. These 116 assemblies include some 10-kb subassemblies that were duplicates or near-duplicates. This was the case because alternate clones of certain 10-kb subassemblies were tested in parallel. Also, alternate versions of certain 10-kb subassemblies that were identical except for certain designed changes such as the presence of the watermarks were tested in parallel. Because of the presence of duplicate or near-duplicate sequences that needed to be read independently, as well as the existence of duplicate regions in contiguous 10-kb subassemblies due to the 80 base pair overlaps, the 116 10-kb subassemblies were pooled into 4 separate pools that prevented any 10-kb subassembly from being in the same pool as either of the two 10-kb sub assemblies that shared 80 base pairs with its two ends. All alternate clones and alternate versions of specific 10-kb segments were separated from each other. Also, certain 10-kb subassemblies which had highly similar sequence to one another such as those that contained IS 1296 insertion sequences were separated as much as possible from one another between the four pools. The four pools were bar-coded and then pooled into one pool which was sequenced by 454. The reads from the four bar-coded pools were then separated and analyzed with the use of the CLC Workbench software package using the high-throughput reference assembly tool set at default settings. The reads from each pool were assembled against an artificially constructed "reference sequence" which consisted of the 29 10-kb target sequences for that pool separated by runs of 500 N's. After assembly to this reference sequence, mutations were detected with a mixture of manual observation, the CLC SNP detection tool, and the CLC DIP detection tool. CLC does not have an automated way of detecting differences between the reference and consensus sequences. To bypass this defect, the following non-default settings on the SNP and DIP tools were used: Minimum

Coverage=l, Maximum Coverage=999999, Minimum Variant Frequency=50% or count=999999. All other settings were at their defaults. Initially 18 of the 116 10-kb subassemblies were found to contain variations from their target sequences. Eventually, three of these variations were determined to be caused by sequence similarity between the markers in the synthetic genome and the markers in the plasmid backbone of the 10-kb subassembly clones with backbone sequence contaminating the 10-kb sequences. Several of the remaining variations were found to be associated with the plasmid induction of the 10-kb clones in E. coli after targeted PCR and sequencing of mutation regions of selected clones isolated directly from yeast, from E. coli before induction, and E. coli after induction. One class of mutation that was observed 3 times was the introduction of a "GC" at the sight of an overlap. It is postulated that this might be a remnant of the Notl site flanking the cassette overlap sequences. Alternate assemblies of the 10-kb segments that were mutated in the first attempt to make them were then sequenced as before, except this time, in only two bar-coded pools. One of the three mutations in the 1-kb cassettes was detected at the 10-kb level. All the other mutations that were not caused by the induction E. coli, originated in construction.

100-kb assembly intermediate verification.

[0695] Rather than sequence each of the 100-kb subassemblies, semi-synthetic genomes were constructed. These semi-synthetic genomes contained between two and ten of the eleven 100-kb subassemblies, and the rest of the genome was derived from natural M.

mycoides genome sequences. These semi-synthetic genomes were successfully transplanted, validating that no lethal mutations were in the synthetic fraction of the genome. It rapidly became apparent that only one of the 100-kb subassemblies was not viable: the one corresponding to cassettes 81 la-900. Because this 89-kb segment was not available conveniently from yeast in quantities that would make direct genomic walking or 454 sequencing easy or cost effective, overlapping PCR amplicons were generated and sequenced with a sequencing primer every 200 base pairs along each amplicon alternating between strands.

[0696] This process was done for both the synthetic 81 la-900 and the corresponding region of the natural M. mycoides genome that had been shown to be viable in the semisynthetic experiments. Re-sequencing of the natural fragment was to guard against the possibility that the 81 la-900 region had been designed with a deviation that would prevent viability upon transplantation. Whereas the sequencing of the synthetic 81 la-900 was to guard against mutations away from the designed sequence, one such mutation away from the design was detected in the 81 la-900 sequence. It was a one base pair deletion that was eventually determined to have existed in the 812a 1-kb cassette. This mutation was not captured at the 1-kb level. It was not detected at the 10KB level because, coincidentally, many of the 454 reads happened to end or start in its immediate vicinity causing mutation to seem to be poorly supported across the population of read, and thus ignored by the automated SNP and DIP detection tools. Discussion

[0697] In this current study, we constructed the 1.08 million base pair M. mycoides genome. However, obtaining an error-free genome that could be activated in a recipient cell to create a new cell controlled only by the synthetic genome was complicated and required many quality control steps. Success was thwarted for many weeks by a single base pair deletion in the essential gene dnaA. One wrong base in an essential gene in over one million bases rendered the genome inactive, while major genome insertions and deletions in nonessential parts of the genome had no impact on viability.

[0698] During this study we developed a number of methods to facilitate testing and error correction of synthetic genome segments. These methods include the combination of synthetic and non-synthetic genome segments followed by genome transplantation and DNA sequencing to find sequence errors and to test the viability of synthetic designs.

[0699] Our first successful genome transplants used native genomes isolated from intact cells. These studies proved that genomes could be successfully transplanted into related species replacing the existing genetic material and in the process converting the cell into the phenotype dictated by the new genome. These experiments proved that naked DNA could be transplanted. What we did not know at the time was that the DNA in M. mycoides cells was methylated and, therefore, protected from restriction when inserted into M. capricolum cells.

[0700] Because the final synthetic genome assembly was accomplished by yeast recombination, we developed new methods for cloning native bacterial chromosomes in yeast (Benders et al. , Nucleic Acids Res, (Mar 7, 2010)) and to isolate intact native and synthetic bacterial genomes from yeast (Lartigue et al., Science 325, 1693 (Sep 25, 2009)). Initial transplants involving native M. mycoides genomes cloned as yeast centromeric plasmids failed. Subsequent extensive studies demonstrated that site specific DNA methylation was needed for genome transplantation unless restriction system genes were removed from the genome of the recipient M. capricolum cells (Lartigue et al, Science 325, 1693 (Sep 25, 2009)).

[0701] These studies resulted in powerful new methods that allow bacterial genomes from species lacking genetic systems to be grown in yeast by the addition of a yeast centromeric sequence. Furthermore, a bacterial genome cloned in yeast could be readily modified with yeast genetic tools including homologous recombination. The modified bacterial chromosome could then be isolated from yeast, optionally methylated, and transplanted back into a recipient cell to create a modified version of the donor cell (Lartigue et al, Science 325, 1693 (Sep 25, 2009)).

[0702] Though below-average size for a bacterial genome, the 1,077,947-bp double- stranded DNA molecule that we synthesized is the largest synthetic molecule of defined structure reported, and is almost twice the size of the M. genitalium genome that we synthesized previously (Gibson et al, Science 319, 1215 (Feb 29, 2008)). Synthesis of a synthetic or semi-synthetic molecule, and the demonstration that it has the same properties as a naturally-occurring compound, has long been used as evidence to support a proposed molecular structure. The demonstration that our synthetic genome and semi-synthetic genome confers the phenotypic properties of M. mycoides implies that the DNA sequence upon which it is based is accurate enough to specify a living cell.

[0703] A cell controlled by an introduced genome (a natural genome, a synthetic genome, or a semi-synthetic genome" is referred to as a "synthetic cell", even though the cytoplasm of the recipient cell is not synthetic. Phenotypic effects of the recipient cytoplasm are diluted with protein turnover and as cells carrying only the transplanted genome replicate. Following transplantation and replication on a plate to form a colony (>30 divisions or >109 fold dilution), progeny will not contain any protein molecules that were present in the original recipient cell. The properties of the cells controlled by the assembled genome are expected to be the same as if the whole cell had been produced synthetically (the DNA software builds its own hardware).

[0704] From the foregoing description, one skilled in the art can ascertain the essential characteristics of the disclosed embodiments, and without departing from the spirit and scope thereof, can make changes and modifications to adapt it to various usage and conditions and to utilize the present systems and methods to their fullest extent. The preceding specific embodiments are to be construed as merely illustrative, and not limiting of the scope of the application in any way whatsoever. The entire disclosure of all applications, patents, publications (including reference manuals) cited above and in the figures, are hereby incorporated in their entirety by reference.

WHAT IS CLAIMED:

1. A method for creating a synthetic cell, said method comprising:

(i) assembling a synthetic or semi-synthetic donor genome as one or more fragments;

(ii) introducing the donor genome and a host vector into a heterologous host cell, wherein the donor genome and the host vector are optionally joined prior to introduction into the host cell;

(iii) recovering the donor genome from the host cell; and

(iv) introducing the recovered donor genome into a recipient cell;

thereby generating a synthetic cell comprising the donor genome, wherein the donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length.

2. The method of claim 1, wherein the donor genome is an essentially whole cellular, viral or organelle genome.

3. The method of claim 1, wherein the donor genome and the host vector are introduced into the host cell simultaneously or sequentially.

4. The method of claim 1 , wherein the host vector is joined with the donor genome prior to introduction into the host cell by transforming the host vector into a donor cell containing the donor genome.

5. The method of claim 1, wherein the host cell is a bacterial cell, a fungal cell, an insect cell, a plant cell, or an algal cell.

6. The method of claim 1 , wherein the host cell is a yeast cell.

7. The method of claim 4, wherein the host vector is a centromeric plasmid.

8. The method of claim 7, wherein the host vector is a yeast centromeric plasmid and the host cell is a yeast cell.

9. The method of claim 1 , wherein the host vector is a vector useful for homologous recombination.

10. The method of claim 1, wherein the donor genome is linearized or fragmented prior to introduction into the host cell.

11. The method of claim 1 , wherein the donor genome is a bacterial genome, a fungal genome, a yeast genome, an archeal genome, a cyanobacterial genome, an algal genome, a bacteriophage genome, a mitochondrial genome, a chloroplast genome, viral genome or an organelle genome.

12. The method of claim 1, wherein host cell is a eukaryotic cell or a prokaryotic cell.

13. The method of claim 1 , further comprising modifying the donor genome within the host cell.

14. The method of claim 1, further comprising degrading or removing the endogenous genome of the recipient cell.

15. The method of claim 1 , wherein the recovered donor genome is methylated prior to introduction into the recipient cell.

16. The method of claim 1 , wherein the recipient cell's restriction endonulease function is absent, removed or inactivated.

17. The method of claim 1, wherein the recipient cell is a bacterial cell, a yeast cell, a fungal cell, an insect cell, a plant cell, or an algal cell.

18. The method of claim 1 , further comprising introducing a second donor genome into the host cell, wherein the second donor genome is different from the first donor genome, thereby producing a host cell containing two different donor genomes.

19. The method of claim 18, wherein introducing the second donor genome comprises mating the host cell containing the first donor genome with a second host cell containing the second donor genome.

20. The method of claim 1 , wherein the synthetic cell exhibits a phenotype corresponding to the donor genome incorporating any modifications thereto.

21. The method of claim 1 , wherein said donor genome is a synthetic genome.

22. The method of claim 1, wherein said donor genome is a semi-synthetic genome.

23. A synthetic cell produced by the method of claim 1.

24. A process for making a synthetic cell which exhibits a phenotype encoded by a synthetic or a semi-synthetic donor genome, said process comprising:

(i) introducing into a host cell, the donor genome and a host vector suitable for cloning the donor genome in the host cell such that a product comprising the donor genome comprising the host vector is obtained;

(ii) recovering the product comprising the donor genome obtained in step (i) from the host cell;

(iii) introducing the product of (ii) into a recipient cell under conditions such that the recipient cell exhibits a phenotype encoded by the product; and

(iv) recovering the synthetic cell resulting from step (iii); wherein the donor genome is an essentially intact cellular, viral, or organelle genome that is at least a minimal genome, and is greater than about 300 kb in length and comprises the minimal components of nucleic acid material necessary for the synthetic cell to exhibit the phenotype encoded by the donor genome.

25. The process of claim 24, further comprising modifying the donor genome within the host cell.

26. The process of claim 24, further comprising degrading or removing an endogenous genome of the recipient cell.

27. A synthetic cell which exhibits a desired phenotype encoded by a donor genome and not otherwise exhibited by the cell, wherein the synthetic cell is produced by the process of claim 24.

28. A synthetic cell which comprises a synthetic or a semi-synthetic donor genome and exhibits a desired phenotype encoded by the donor genome and not otherwise exhibited by the cell, wherein the donor genome comprises greater than 300 kb of foreign genomic nucleic acid material and the minimal components of a genome necessary for the synthetic cell to exhibit the desired phenotype.

Download Citation


Sign in to the Lens

Feedback