Compositions And Methods For Diagnosis And Therapy Of Disorders Related To Alterations Of Myh9

  *US20150148411A1*
  US20150148411A1                                 
(19)United States 
(12)Patent Application Publication(10)Pub. No.: US 2015/0148411 A1
 (43)Pub. Date:May  28, 2015

(54)COMPOSITIONS AND METHODS FOR DIAGNOSIS AND THERAPY OF DISORDERS RELATED TO ALTERATIONS OF MYH9 
    
(76)Inventor: THE ROCKEFELLER UNIVERSITY,  NEW YORK, NY (US) 
(21)Appl. No.: 14/553,256 
(22)Filed: Nov.  25, 2014 
 Related U.S. Application Data 
(60)Provisional application No. 61/908,498, filed on Nov.  25, 2013.
 
 Publication Classification 
(51)Int. Cl. C12Q 001/68 (20060101); G01N 033/574 (20060101)
(52)U.S. Cl. 514/460; 435/6.14; 435/6.11; 435/7.4; 435/6.12
CPC C12Q 001/6886 (20130101); G01N 033/5748 (20130101); G01N 033/57415 (20130101); G01N 033/57407 (20130101); C12Q 2600/106 (20130101); C12Q 2600/156 (20130101); G01N 2333/82 (20130101); G01N 2333/4712 (20130101)

        

(57)

Abstract

Provided are compositions and methods related to mutations in the Myh9 gene for aiding in diagnosing a subject as having an aggressive form of a cancer, for identifying an individual as a candidate for treatment with a nuclear export inhibitor, for determining whether tumor cells have defective p53 nuclear transportation, and for treating an individual diagnosed with an aggressive cancer.
 Claim(s),  Drawing Sheet(s), and Figure(s)
 
 


CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional application No. 61/908,498, filed on Nov. 25, 2013, the disclosure of which is incorporated herein by reference.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant No. RD3-AR 27883 awarded by the National Institutes of Health. The government has certain rights in the invention.

COLOR DRAWINGS

[0003] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

BACKGROUND

[0004] Head and neck squamous cell carcinomas (HNSCCs) are the 6th most common human cancer worldwide, with frequent, often aggressive recurrence and poor prognosis. While there are some established genetic/epigenetic alterations that are positively correlated with HNSCCs, there is an ongoing and unmet need for improved methods of diagnosing and staging HNSCCs, as well as for improved approaches to prophylaxis and therapy of such cancers. The present disclosure is related to these needs.

SUMMARY OF THE DISCLOSURE

[0005] In one embodiment the present disclosure comprises a method diagnosing or aiding in the diagnosis of whether a subject has an aggressive form of a cancer. The method generally comprises testing a sample of a tumor obtained or derived from the subject to determine a mutation in the Myh9 gene (encodes myosin-IIA) or low expression of the Myh9 gene relative to a reference. The low expression can be determined from mRNA and/or protein. In embodiments, 5% or less expression of the Myh9 gene at the mRNA and/or protein level relative to a reference is considered to be low expression. The presence of the mutation and/or the low expression is a diagnosis, or aids in the diagnosis that the individual has an aggressive form of cancer. In embodiments, the mutation is any mutation that disrupts the ATPase function of the myosin-IIA. In embodiments, the mutation is selected from the group consisting of A454V, E457K, E465Q, N470S, E530K, T538K, D567N, G696S, L812X, E1131M, S1163X, K1249E, F1261L, A1351P, L1411P, L1485P, and combinations thereof. Testing the sample in certain embodiments comprises determining a polynucleotide sequence of the Myh9 gene by use of any of a variety of amplification reactions that include use of synthetic DNA primers and/or the formation of cDNA and amplification reactions that comprise cDNA segments. In embodiments, testing the sample comprises detecting a complex of a detectably labeled agent, such as an antibody, which is specifically hybridized to a MYH9 protein comprising one or more of the mutations. In embodiments, the aggressive cancer determined by the method is a squamous cell carcinoma of the head and neck or a skin cancer or a breast cancer.
[0006] In another aspect the disclosure includes a method for identifying an individual as a candidate for treatment with a nuclear export inhibitor comprising testing a sample of a tumor from the subject to determine a mutation in the Myh9 gene and/or low expression of the Myh9 gene relative to a reference, wherein the presence of the mutation in the Myh9 and/or the low expression of the Myh9 gene relative to a reference indicates that the individual is a candidate for therapy with a nuclear export inhibitor.
[0007] In another aspect the disclosure includes a method for determining whether tumor cells have defective p53 nuclear transportation comprising testing tumor cells for a mutation in the Myh9 gene, wherein the presence of the mutation in the Myh9 gene determines that the cells have defective p53 nuclear transportation.
[0008] In another aspect the disclosure includes a method for treating an individual diagnosed with an aggressive cancer, wherein the aggressive cancer comprises cancer cells which comprise a mutation in the Myh9 gene. The method of treating comprises administering to the individual a composition comprising an effective amount of a nuclear export inhibitor.

BRIEF DESCRIPTION OF THE FIGURES

[0009] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0010] FIG. 1 shows an example of direct in vivo shRNA screen for HNSCC tumor suppressors (A) Schematic of the pooled shRNA screen. (B) Tumor-free survival for mice of the indicated genotype transduced at E9.5 with shRNA library targeting putative HNSCC genes. (n=number per group; p<0.0001, log-rank test) (C) Representative pie charts compiling DNA-sequencing analyses of individual tumors compared to surrounding healthy skin. Charts show % representation of a particular shRNA relative to the total. (D) The nine top-scoring tumor-suppressor candidates and corresponding tumor numbers in which their shRNAs were found to be significantly enriched.
[0011] FIG. 2 shows an example of functional validation of Myh9 as a bona fide tumor suppressor and regulator of migration/invasion. (A) Quantitative RT-PCR of Myh9 mRNA in cultured primary murine keratinocytes infected with various Myh9-shRNA lentiviruses. Values are normalized to scrambled-control shRNAs. (n=3±SEM *p<0.005) (B) Immunoblot analysis of protein lysates from epidermal keratinocytes of newborn mice transduced in utero with indicated Myh9-shRNAs. (C) Tumor-free survival of mice of the indicated genotype and shRNA transduction. (n=6 for each genotype, p<0.0001, log-rank test between scrambled- and each Myh9 shRNA-infected cohort). Insert shows numerous skin lesions (arrows) on 4 month-old Myh9-shRNA transduced TβRII-cKO mouse. Scale bars, 30 μm. (D) Myh9-knockdown results in widespread pulmonary SCC metastases in and around blood vessels in the lungs of TβRII-cKO mice. Of note, metastasic lesions are immunoreactive for epithelial keratin 14 and negative for myosin-IIa. (E) Tumor-free survival of Myh9/TβRII inducible knockout (iKO) as well as Myh9 heterozygous/TβRII iKO and control mice (n=6,p<0.001, log-rank test). (F and G) Transwell migration assays through Boyden chambers coated with (F) fibronectin (migration assay) or with (G) Matrigel ECM (invasion assay). Myh9-deficiency markedly increases migration and invasion towards fibroblast-conditioned medium (bottom chamber), irrespective of TβRII-cKO status. (n=3±SEM *p<0.05 and **p<0.005, two-tailed t test between scrambled and each Myh9-knockdown construct).
[0012] FIG. 3 demonstrates a representative non-canonical role for myosin-IIa in nuclear retention of activated p53. (A) Myh9-shRNA knockdown (kd) but not scrambled-shRNA shRNA control (c) diminishes p53 activation and target p21 expression in response to DNA-damage-response inducer doxorubicin (1 μM). Myosin-IIa and GAPDH levels are shown as controls. (B and C) Lack of nuclear p53 in Myh9-cKO versus control (Ctrl) littermate skins 6 hours after γ-irradiation (5Gy). (B) Immunofluorescence; (C) immunoblot analysis. Myosin-IIa and GAPDH levels are shown as controls. (D) qPCR of p53 target gene transcripts illustrate the relative magnitude of the effects of Myh9-knockdown on the p53 pathway. (E) p53 immunoblot of lysates from DDR-induced keratinocytes treated with vehicle (V), blebbistatin (B), Rock inhibitor Y27632 (Y) or latrunculinB (L). GAPDH levels are shown as controls. (F) Nuclear p53 is not retained when DDR-induced Myh9-knockdown primary keratinocytes are exposed to blebbistatin (B). Lamin A/C, IκBα and H2AXγ are controls for nuclear, cytoplasmic fractions and DDR, respectively. Nuclear export inhibitor Leptomycin B rescues the ability of Myh9-deficient cells to retain p53 in the nucleus.
[0013] FIG. 4 shows MYH9 is a bona fide tumor suppressor in human HNSCC. (A) p53 induction in primary human keratinocytes treated with myosin ATPase inhibitor blebbistatin (4μM) and with DDR-inducer doxorubicin (Dox; 1 μM). GAPDH, loading control. (B) Representative images of myosinIIa-immunostained human HNSCCs displaying negative, weak, moderate or strong staining patterns. (C) Myosin-IIa quantifications on human healthy skins, skin SCCs and HNSCCs (n=362 patient samples analyzed). Note that a substantial fraction of cases show absent or reduced myosin-IIa. (D) Decreased MYH9 expression correlates with shortened survival. Kaplan-Meier analysis comparing overall survival of TCGA HNSCC patients partitioned according to the lowest (<5th percentile) MYH9 expression versus the rest (≧5th percentile) (n=166, p=0.0044, log-rank test). (E) Schematic of human myosin-IIa delineating the N-terminal SH3-like domain, the myosin head domain with the ATPase function, the ATP binding pockets P-loop (P) and switch region I and II (I and II), the IQ-calmodulin binding domain and the myosin tail. Missense mutations as well as deletions are given with their respective functional impact score overhead. Note that most of the mutations are within the ATPase domain clustering in and around the switch-II region (p=0.0015; Fisher test corrected for false discovery rate). Of note, mutations of the conserved A454 (blue) residue have been shown in Dictyostelium myosin to abrogate ATPase function. E457K (red) was tested and shown to have an effect on DDR-induced p53 activation (FIG. 26). (F) List delineating various cancer types with their respective percentage of MYH9 hemizygous loss as well as the percentage of Myh9 heterozygous and inducible knock-out mice that develop skin and/or head and neck SCCs on a TGFβRII-cKO backround (Myh9-dependent).
[0014] FIG. 5 shows an example of a strategy for using lentiviral-mediated in utero delivery of shRNAs to screen and study the effects of tumor suppressors on squamous cell carcinoma formation in vivo (A) Schematic to develop chimeric mice whose epidermis, glandular and oral epithelia are specifically, stably and clonally transduced with lentiviral construct harboring a fluorescently-tagged histone reporter gene and a desired shRNA driven by a U6 promoter. Non-invasive lentiviral infection of single-layered surface ectoderm is achieved by ultrasound-guided in utero injections into the amniotic sac of an E9.5 embryo (Beronja et al., 2010). (B) Kaplan-Meier analysis of tumor-free survival of mice of the indicated genotype transduced with an shRNA that efficiently targets Brcal-knockdown. (n=6 for each genotype, p<0.0062, log-rank test between TβRII-cKO vs. TβRII fl/fl mice infected with shRNA targeting Brcal). Note that on a TβRII-cKO background, Brcal shRNA-mediated initiation of tumor growth is greatly accelerated. (C) Representative images of Brcal shRNA transduced TβRII fl/fl and TβRII-cKO mice showing lesions on backskin as well as in oral cavity, respectively. (D) Representative section of a Brcal knockdown tumor isolated from a TβRII fl/fl animal showing a well-differentiated SCC. (E) In vivo knockdown efficiency of Brcal shRNA #560 in skin and in SCC tumors as measured by quantitative RT-PCR. (n=3±SEM *p<0.05).
[0015] FIG. 6 shows an example of determining suitable viral titer and measuring lentiviral shRNA library representation. (A) Control lentivirus (pLKO), harboring an H2B-GFP reporter transgene and a U6-driven scrambled shRNA control (Scr) expression vector was used in a dilution series to determine the appropriate dilution/titer required to selectively and stably transduce about 15-20% of surface ectoderm keratinocytes in vivo by ultrasound-guided in utero delivery to the amniotic sacs of living E9.5 embryos. Fluorescence activated cell sorting (FACS) analyses of epidermal keratinocytes isolated from transduced pups at E18.5 were used for quantifications. Comparative quantitative RT-PCR was then used to estimate the required dilution of the test lentiviral shRNA library needed to give rise to 15-20% of infection (not shown). Control lentivirus as well as the test lentiviral shRNA library had an initial titer of ˜6×109 cfu/ml and were diluted 40× for all subsequent infections. (B) Scatter plot of Illumina sequencing data, illustrating good correlation between the number of reads per shRNA in DNA isolated from the lentiviral plasmid library versus the actual shRNA representation in DNA isolated from transduced epidermal keratinocytes of mouse embryos 3 days after infection with the lentiviral library (R=non-parametric (Spearman) correlation coefficient).
[0016] FIG. 7 shows an example of SCC formation in TβRII-cKO mice infected with the shRNA library (A) Histological sections of invasive SCC from oral cavity/lip of a transduced TβRII-cKO mouse. Different magnifications accentuate tumor heterogeneity, with well-differentiated areas (typified by keratin pearls) adjacent to poorly-differentiated areas. Note invasion into subcutaneous muscle (arrowheads) as well as moderate atypia characterized by anisokaryosis and anisocytosis, hyperchromasia, and frequent large and prominent nucleoli. Mitoses were on average 10× more frequent than the surrounding WT tissue (arrows). (B) Representative immunofluorescence analyses for basal markers Keratin 5 and β4-integrin, differentiation marker Loricin, and proliferation marker Ki67 on tumor sections from adult TβRII-cKO mice that had been infected with the lentiviral shRNA library at E9.5 in utero.
[0017] FIG. 8 shows an example of SCC formation in adult TβRII-cKO mice derived from embryos whose surface ectoderm was infected with the shRNA library (A to D) Representative H&E images of tumor sections showing invasive SCC arising from various transduced epithelial tissues as indicated. (A) At the mucocutaneous junction, a poorly demarcated neoplasm has invaded the dermis. The SCC is composed of nests and cords of basal cells exhibiting signs of squamous differentiation, notably eosinophilic keratin pearls. Some nests show evidence of stroma invasion associated with a desmoplastic stroma. Cellular atypia are minimal and mitoses are not observed within well-differentiated areas. The overlying epidermis is moderately hyperplastic and hyperkeratotic. The tumor is infiltrated by numerous neutrophils. (B) Backskin squamous cell carcinoma invading the underlying dermis and subcutaneous tissue. The SCC is well-demarcated, but in several areas, cells have detached from the main tumor and invaded into subcutaneous tissues. Invasive regions are characterized by small nests and cords of basal cells that have broken through the basement membrane and invaded adjacent stroma and muscle. This contrasts with nests of well-differentiated stratified squamous epithelium in the infundibular regions that are replete with keratinization. Throughout the tumor are scattered moderate to marked atypia characterized by fourfold anisokaryosis and anisocytosis, hyperchromasia, and variation in nucleolar size with frequent large and prominent nucleoli. Mitoses are prevalent at ˜38/ten 400× fields. (C) In this example, both cornea and eyelid are enlarged and their architecture is distorted by a poorly demarcated neoplasm composed of nests and cord of basal cells showing squamous differentiation and formation of keratin pearls. Some nests show evidence of stromal invasion associated with a desmoplastic stroma. Cellular atypia are minimal and mitoses are not observed. The overlying epidermis is moderately hyperplastic and hyperkeratotic. The tumor is infiltrated by numerous neutrophils. The cornea and conjunctiva are infiltrated by numerous neutrophils. In one eye, the lens is present in the section and shows swelling and liquefaction of lens fibers and posterior migration of lens epithelium. These tumors were often large, with involvement of both cornea and eyelids. The conjunctivitis and keratitis are ocular changes that appear to be secondary to expansion of the eyelid. (D) An SCC that has invaded subcutaneous tissues and the salivary gland. The tumor is a poorly demarcated and infiltrative neoplasm, composed of basal-like cells forming nests and cords supported by desmoplastic stroma. Cells are polygonal, have indistinct borders, and display a moderate amount of eosinophilic cytoplasm. They have ovoid nuclei with finely stippled chromatin and small nucleoli. There is threefold anisokaryosis, and an average of 12 mitoses per 400× fields. The skin shows a focally extensive area of epidermal hyperplasia, with focal epidermal ulceration with serocellular crusting. The dermis is infiltrated by moderate numbers of neutrophils and macrophages, and fewer lymphocytes.
[0018] FIG. 9 shows an example of formation of benign lesions in TβRII-cKO mice derived from embryos whose surface ectoderm was infected with the shRNA library (A to C) Representative H&E images of sections from affected TβRII-cKO epithelial tissues of mice that were transduced as embryos with the lentiviral shRNA library. (A) Neoplasm of basal cell tumor that appeared to be benign based on histologic features. Note the well-demarcated epidermal neoplasm that extends deep into the underlying dermis. It is composed of thin cords and nests of basaloid cells surrounded by fibrous stroma. Epithelial cells display indistinct borders, a small amount of amphophilic cytoplasm, and oval nuclei with finely stippled chromatin and multiple small nucleoli. An average of 3 mitoses were seen for every ten 400× fields. Overlying epidermis and infundibular epithelium show moderate hyperplasia and orthokeratotic hyperkeratosis. A few mm from this tumor is a well-demarcated region of deep dermal and subcutaneous fibrosis. (B) This squamous papilloma displays an exophytic, well demarcated neoplasm, composed of a branching papillary structure and markedly proliferative, but well differentiated, epidermis. Note marked orthokeratotic hyperkeratosis supported by thin stalks of fibrovascular stroma. The proliferative epidermis shows occasional mild dysplasia. The stroma is focally infiltrated by moderate numbers of melanophages and/or melanocytes, and moderate numbers of lymphocytes. (C) Some lesions showed no signs of malignancy. In this example, only ulceration are seen, with moderate neutrophilic and histiocytic dermatitis and weak signs of epidermal hyperplasia, indicating that these lesions are likely to be preneoplastic. Note focally extensive areas of mild epidermal hyperplasia, with multifocal epidermal ulceration associated and serocellular crusting and dermal necrosis. The superficial, mid and deep dermis is multifocally infiltrated by small to moderate numbers of neutrophils and macrophages, and fewer lymphocytes.
[0019] FIG. 10 shows an example of how Myh9 knockdown delays hair follicle downgrowth and impedes eyelid closure. Mice were transduced at E9.5 with scrambled-control or Myh9 #504 shRNAs, and examined at birth. (A) Myosin-IIa immunohistochemistry of skin sections from these mice. Note loss of myosin-IIa and impaired hair follicle down-growth in Myh9 knockdown animals. (B) Newborn mice reveal “Open Eyes at Birth” phenotype indicative of an impediment to eyelid closure during embryonic development. Inset shows that mice were efficiently transduced with the lentivirus, as judged by expression of the reporter H2B-RFP fusion protein. (C) 8 day-old Myh9 shRNA-transduced mice show sparse and delayed hair growth compared to scrambled infected littermate controls.
[0020] FIG. 11 shows an example of how Myh9 knockdown does not interfere with tissue homeostasis in skin in young animals (A to D) Fluorescence microscopy of frozen skin sections from Myh9 knockdown, TβRII-cKO and TβRII fl/fl mice at one (A and B) or three (C and D) months of age. Mice had been transduced in utero at E9.5 with lentivirus expressing an H2B-RFP reporter and either Myh9 #504 or scrambled shRNAs. Note that transduced regions (RFP+) show grossly normal immunolabeling for (A) Keratin 14 in the basal cells of interfollicular epidermis and hair follicles, and (B) K10, specific for terminally differentiating epidermis. In older animals, sparse areas of epithelial thickening were noted, concomitant with expanded K14 expression (C) and induction of K6, associated with a hyperproliferative state (D).
[0021] FIG. 12 shows a representative validation of Myh9 as a tumor suppressor (A) Sections of tumors from TβRII-cKO mice, transduced with shRNAs targeting Brcal or Myh9, respectively, and immunolabeled for myosin-IIa (absent in the epithelium of Myh9 #504 shRNA-targeted SCCs). (B to D) Immunofluorescence microscopy of frozen tissue sections from tumors arising spontaneously in TβRII-cKO mice that had been transduced as embryos with Myh9 shRNAs. Note architecture of poorly differentiated SCCs with (B) β4-integrin and K5-expressing nodules, (C) high proliferation rates in the basal layer as indicated by nuclear Ki67 and (D) reduced expression of differentiation markers such as Loricin. (E to H) H&E of paraffin sections of these tumors confirmed their identity as poorly differentiated squamous cell carcinomas that invade into (E) subcutaneous fat, (F) skeletal muscle, (G) salivary gland and (H) locally draining lymph node.
[0022] FIG. 13 shows an example of genetic ablation of Myh9 phenocopies Myh9 shRNA knock-down (A) Western Blot analysis of keratinocytes purified from Myh9 fl/fl K14-Cre (Myh9-cKO) mice and control littermates show target-specific reduced expression of myosin-IIa. (B) Anti-myosin-IIa immunolabeling of skin sections of wild-type and K14-Cre conditionally targeted Myh9-cKO animals. Note the antibody specificity and the recapitulation of the impediment to hair follicle down-growth, also seen with Myh9 knock-down. (C) Histology of skin sections of double mutant (Myh9/TβRII iKO) mice inducing K14-driven with topical application of tamoxifen (D) Representative Myh9/TβRII iKO animal as well as H&E section showing a poorly differentiated skin SCC that has invaded through the skeletal muscle into the deep subcutaneous structures and lymph nodes. (E) Representative Myh9/TβRII iKO animal as well as H&E section showing a moderately differentiated invasive anogenital squamous cell carcinoma that has invaded the colonic epithelium. The colonic epithelium is not neoplastic, but is ulcerated and inflamed with some reactive changes.
[0023] FIG. 14 shows an example of TβRII-cKO mice transduced with Myh9 shRNA develop multiple SCCs in the mammary gland (A to C) In utero infections of E9.5 surface ectoderm results in appreciable transduction of mammary epithelial tissues. Epifluorescence and immunolabeling of frozen tissue sections of transduced mammary epithelium. Transduced areas (H2B-RFP+) include (A) luminal epithelium (K18+) and (B and C) myoepithelium (positive for K14 and smooth muscle actin). (D) Whole-mount of 12-week-old scrambled and Myh9 shRNA-transduced TβRII-cKO mammary gland. LN, lymph node. Arrows denote neoplastic regions that were subjected to immunolabelings at right. Mammary SCCs were positive for K14, K6 and K10 as well as H2BRFP (denoting transduced cells, negative for myosin-IIa). (E to G) Immunofluorescence of SCC lesion from mammary tissue of TβRII-cKO mice transduced with Myh9 shRNA #504. Note co-localization of lentiviral reporter H2B-RFP and luminal markers (E) keratin 18 (K18) and basal keratins (F) K14 and (G) K5.
[0024] FIG. 15 shows an example of how Myh9 regulates epidermal outgrowth from skin explants (A and B) Representative phase-contrast and epifluorescence images of (A) TβRII fl/fl and (B) TβRII-cKO skin explants from E18.5 embryos infected at E9.5 with scrambled-control or shRNAs construct targeting Myh9. Viral constructs harbored reporter genes encoding either membranous GFP (mGFP) or H2B-RFP. Epidermal outgrowth was monitored for 48 hr and was significantly increased in Myh9 shRNA-transduced keratinocytes compared to scrambled control transduced explants of TβRII-proficient and deficient cells. White dotted lines mark leading edges; red arrows denote distance between explant and its leading edge. (C and D) Quantifications of epidermal outgrowth from skin explants of (C) TβRII fl/fl and (D) TβRII-cKO mice transduced with indicated knock-down constructs. (n=3±SEM *p<0.05, two-tailed t test between scrambled and each Myh9 knock-down construct)
[0025] FIG. 16 shows an example of how Myh9 knockdown enhances keratinocyte migration in a scratch wound assay in vitro. (A) Shown are representative temporal phase-contrast and RFP epifluorescence images of scratch wound assays on keratinocytes infected in vitro with scrambled-control or Myh9 shRNAs #504. Yellow arrows indicate the extent of wound closure. H2B-RFP marks transduced keratinocytes as shown in the last panel.
[0026] FIG. 17 shows an example of how Myh9 regulates Ha-Ras-driven tumorigenesis (A) Kaplan-Meier analysis of tumor-free survival of DMBA/TPA treated (Ha-Ras-induced) syngenic CD1 mice transduced with the indicated shRNA. (n=6 for each genotype, p<0.0005, log-rank test between scrambled control and each Myh9 shRNA infected mice). (B) Representative images of CD1 mice, transduced in utero with either scrambled control or Myh9 shRNAs #504, and 12-weeks after DMBA-treatment. (C) Tumor multiplicity of DMBA/TPA treated CD1 mice transduced with the indicated shRNA. (n=6 for each genotype). (D) SCC conversion frequency in syngenic CD1 mice transduced with the indicated shRNA 20-weeks after DMBA-treatment. (E) Representative H&E as well as MyoIIa IHC images of tumors from CD1 mice transduced in utero with either scrambled control or Myh9 shRNAs #504 and 20-weeks after DMBA-treatment.
[0027] FIG. 18 shows an example of how Myh9 regulates p53. (A) p53 and p21 expression after treatment with DNA damage response drug doxorubicin (Dox; 1 μM). Primary mouse epidermal keratinocytes were transduced with the Myh9 shRNAs indicated. Myosin-IIa and GAPDH levels are indicated as control. (B) p53 and p21 expression after treatment with DNA-damage-response inducer doxorubicin (1 μM) Myh9fl/fl keratinocytes after adenoviral-Cre-mediated Myh9 ablation (KO). Myosin-IIa and GAPDH levels are shown as controls. (C) Quantification of p53 in nuclei of the skin of Myh9 cKO and control mice 6 hours after treatment g-irradiation (5Gy) as shown in FIG. 3B. Plotted is the corrected total cell fluorescence (CTCF) per cell and the median with interquartile range. (p<0.0001; Mann Whitney test). (D) p53 expression 6 hours after treatment g-irradiation (5Gy) in the skin of Myh9 knock-down (H2B-RFP labeled) mice. Note that p53 staining is only observed in basal keratin 5 positive cells. Note also that H2B-RFP labeled Myh9 shRNA #507-infected cells do not show efficient nuclear p53 staining Mosaic analysis shows that the mechanism involved is cell-intrinsic.
[0028] FIG. 19 shows an example of how Myh9 ablation does not affect EGF signaling. (A) Myh9 knockdown epidermal keratinocytes efficiently respond to EGF. Western Blot of phosphorylated (activated) Erk after EGF (20 ng/ml) stimulation of keratinocytes infected in vitro with various Myh9 knockdown constructs.
[0029] FIG. 20 shows an example of how Myh9 regulates p53 in TβRII-cKO keratinocytes and this effect is specific to Myh9. (A) p53 and p21 expression after doxorubicin (Dox; 1 μM) treatment of primary mammary epithelial cells. (B) p53 and p21 expression after doxorubicin (Dox; 1 μM) treatment of TβRII fl/fl keratinocytes transduced by lentiviral delivery of Myh9 shRNAs and Cre recombinase. Myosin-IIa and GAPDH levels are indicated as control. (C) Western Blot of phosphorylated (activated) P-SMAD2 in TβRII fl/fl keratinocytes transduced with indicated lentiviral constructs. Note that as expected, LV-Cre mediated targeting of TβRII resulted in loss of P-SMAD2 activity, which is downstream of TGFβ-signaling. Myosin-IIa, total SMAD2, activated phosphorylated P-ERK and total ERK are shown as controls. (D) qPCR analysis of TβRII to verify LV-Cre mediated ablation of TβRII gene expression. (E) p53 and p21 expression after treatment with DNA-damage-response inducer doxorubicin (1 μM) in wt keratinocytes after Myh9, Myh10 and Myh14 shRNA-mediated knockdown (kd). GAPDH levels are shown as controls. (F) qRT-PCR analysis of Myh9, Myh10 and Myh14 shRNA-mediated knockdown.
[0030] FIG. 21 shows representative optimal p53 activity following DNA damage depends upon myosin-IIa's ATPase activity and its role in p53 nuclear retention (A) p53 expression in mouse keratinocytes treated with myosin ATPase inhibitor blebbistatin (4 μM) and with doxorubicin (Dox; 1 μM). GAPDH levels are indicated as control. (B) Western Blot of p53 in keratinocytes treated with vehicle, blebbistatin, Rock inhibitor Y27632 or latrunculin B. Activated phosphorylated H2AX (γH2AX) as well as activated phosphorylated Chk1 and Chk2 shown normal DDR activation. Note activation-dependent mobility shift of Chk2. Total Chk1 and GAPDH are shown as controls. (C) MG132 rescues Myh9 phenotype (D) Nuclear export inhibitor Leptomycin B rescues the Myh9 knockdown phenotype and restores p53 accumulation after DNA damage.
[0031] FIG. 22 shows a representative expression of myosin-IIa in human HNSCC and skin SCCs (A) Myosin-IIa Western Blot of primary Myh9-cKO keratinocytes to validate the efficacy of the myosin-IIa antibody. (B) Representative images of myosin-IIa immunohistochemistry of human HNSCCs. (C) Quantification of myosin-IIa staining in human skin, hyperblastic and HNSCC samples show variability in myosin-IIa staining ranging from negative to weak, moderate and strong. (D) Analysis of human skin SCCs with respect to tumor grading and then classified according to presence or absence of myosin-IIa expression. (E) Analysis of human skin SCCs with respect to absence or presence of TGFβ signaling as assessed by immunolabeling for TβRII and active P-SMAD2 and classified according to presence or absence of myosin-IIa expression.
[0032] FIG. 23 demonstrates increased MYH9 expression does not impinge on human HNSCC survival (A) Raw RNAseq data of HNSCC samples in the TCGA database showing the spread of MYH9 RNA expression in all samples across the cohort. Graph delineates the z-score of MYH9 mRNA expression defined as the relative expression of an individual gene and tumor to the gene's expression distribution in a reference population, which is all tumors that are diploid for the gene in question. The returned value indicates the number of standard deviations away from the mean of expression in the reference population (z-score). This measure is useful to determine whether a gene is up- or down-regulated relative to the normal samples or all other tumor samples. In FIG. 4D and FIG. 23A we used the bottom 5th percentile, which equaled samples with a z-score of −1.6 or less (all samples below the red line) to perform the Kaplan-Meier survival analysis. Interestingly, this analysis also shows quite some HNSCC cases significant upregulation of MYH9 mRNA expression—top 33 patients (or top 11%) out of our cohort of 303 HNSCCs. (B) Kaplan-Meier survival analysis of of HNSCC cases with MYH9 mRNA upregulation (above 1.6 standart deviations or more indicated by the red line in FIG. 23A). In contrast to the data for the low MYH9 expression, these patients do not show any survival disadvantage/advantage when compared to the rest of the cohort. (C) Kaplan-Meier survival analysis of of HNSCC cases with MYH9 mRNA upregulation, MYH9 amplifications or gains. Of note, amplifications are defined as larger chromosomal amplifications while gains are defined as local amplifications.
[0033] FIG. 24 shows an example of mutations in myosin-IIa in human HNSCCs (A) List of MYH9 mutations found in HNSCC and their computed functional impact score (www.mutationassessor.org). (B) Multiple sequence alignment of human, dog, mouse, rat, chicken MYH9 and Dyctyostelium discoideum (DICD) myosin-2 heavy chain from, top to bottom respectively. Multiple sequence alignment by MAFFT v7.058b (E-INSi strategy, Blosum 62, Offset value 0.123) and visualization using Jalview 2.8. The human sequence is SEQ ID NO:22; dog is SEQ ID NO:23; mouse is SEQ ID NO:24, rat is SEQ ID NO:25, chicken is SEQ ID NO:26, and Dyctyostelium discoideum is SEQ ID NO:27.
[0034] FIG. 25 shows a representative reduced MYH9 mRNA levels and presence of MYH9 somatic mutations correlate with HNSCC patients that show poor survival characteristics. Statistics shown were mined from the TCGA databases of 310 human HNSCC samples and their normal surrounding tissue controls. (A) Number of human HNSCC samples showing reduced MYH9 gene expression (˜5%) or somatic mutations within MYH9 (˜4%). Within 310 samples, 29 show alterations in MYH9 transcript levels. (B) Decreased MYH9 gene expression and MYH9 mutations together correlate with shortened survival. Kaplan-Meier analysis comparing overall survival of patients suffering from HNSCCs stratified by the lowest (<5th percentile) MYH9 expression and mutations in MYH9 versus the rest (>5th percentile and MYH9 wt). (n=166, p<0.0156, log-rank test) (C) Mutational spectrum of MYH9 across 19 human tumor types and 1000 human cancer cell lines (midified from cBioPortal: www.cbioportal.org/public-portal/).
[0035] FIG. 26 shows an example of mutations within the ATPase domain of MYH9 impair p53 activation. (A) Representative immunofluorescence images of phalloidin and anti-GFP stainined mouse keratinocytes expressing either wildtype human EGFP-MYH9 or mutant human EGFP-MYH9 (E457K). (B) p53 expression in primary mouse keratinocytes infectd with either vector control lentivirus or lentivirus harboring wildtype human EGFP-MYH9 (wt) or mutant human EGFP-MYH9 (E457K) or (S1261L) and treated with with doxorubicin (Dox; 1 μM). GAPDH levels are indicated as control.

DETAILED DESCRIPTION

[0036] The present disclosure provides compositions and methods for making or for aiding in making a diagnosis of cancer, and for prophylaxis and/or therapy of certain types of cancer as described further below. In embodiments the disclosure provides methods for staging cancer, for making a prognosis for a subject diagnosed with cancer, for developing a personalized treatment protocol for an individual diagnosed with cancer, for making a diagnosis of an aggressive form of cancer, and therapeutic and/or prophylactic interventions for individuals diagnosed with or at risk for certain cancers, such as a risk of cancer recurrence. The disclosure relates to disruptions in the function of non-muscle myosin-IIA heavy chain. The non-muscle myosin-IIA heavy chain described herein is also referred to as “NMHCIIA” and “myosin-IIA.”
[0037] In general the disclosure is based at least in part on the present finding that mutations in the Myh9 gene in cancer cells affect the function of the non-muscle myosin-IIA heavy chain protein encoded by it and as a result, the cancer cells have a defect in the ability of p53 to accumulate in the nucleus, such as in the case of DNA damage-induced, post-transcriptional p53 activation. As a consequence, subjects who have mutations which affect the function and/or expression of mysosin-IIA have a worse prognosis and survival than those who do not have the mutations. Thus, the present disclosure reveals for the first time that mysosin-IIA has a tumor suppressor function which is pertinent to the etiology, diagnosis and therapy of a number of distinct cancer types.
[0038] In this disclosure we provide data demonstrating that chemical inhibition of nuclear export can rescue Myh9 mutations by enabling the cells which comprise defective mysosin-IIA to retain p53 in the nucleus. Accordingly, it is reasonable to expect that inhibition of nuclear export will provide a therapeutic and/or prophylactic benefit to individuals who harbor the Myh9 mutations described herein, and/or who otherwise have low levels of mysosin-IIA protein.
[0039] Without intending to be bound by any particular theory it is expected that the present disclosure will be pertinent to any cancer(s) that are correlated with and/or caused by defective mysosin-IIA activity such that the capability of p53 to accumulate in the nucleus is decreased. In embodiments, the cancer is a cancer of the oral cavity, a skin cancer, a mammary gland cancer, or a squamous cell carcinoma. In embodiments, the squamous cell carcinoma is a head and neck cancer. A significant enrichment for functional and truncating mutations has also be found in lung squamous cell carcinoma; colorectal carcinoma; cervical SCC & endocervical carcinoma; head and neck SCC; breast carcinoma; lung adenocarcinoma (see Table 3), thus in embodiments the disclosure is pertinent to any of these cancer types.
[0040] In one aspect, the method comprises testing a biological sample obtained from a subject for the presence or absence of a mutation that affects the function of mysosin-IIA. In embodiments, the mutation is any mutation that disrupts the ATPase function of the myosin-IIA. In embodiments, the mutation is selected from the group consisting of A454V, E457K, E465Q, N470S, E530K, T538K, D567N, G696S, L812X, E1131M, S1163X, K1249E, F1261L, A1351P, L1411P, L1485P, and combinations thereof. The nucleotide sequence of the Myh9 gene and the protein that encodes it are known in the art, as are the gene and protein sequences from a variety of non-human animals. The human cDNA and protein sequences can be found under GenBank accession no. CR456526.1, Oct. 21, 2008, and those cDNA and amino acid sequences are incorporated herein by reference. The human Myh9 protein sequence is provided under SEQ ID NO:28.
[0041] Any one or any combination of the mutations can be detected. The disclosure includes detecting the mutation(s) at the DNA, RNA and protein levels as further described below. The method includes determining homozygosity for the presence or absence of a mutation, as well as for determining hemizygosity for the mutations. The method also comprises determining whether or not the cancer cells exhibit low expression of mysosin-IIA relative to a suitable control. In embodiments, the presence of any one or any combination of the mutations, and/or low expression of mysosin-IIA, aids in a diagnosis that the individual has an aggressive form of cancer. In embodiments, the presence of any one or any combination of the mutations, and/or low expression of mysosin-IIA, aids in the development of a worse prognosis for the individual relative to an individual with cancer that does not have the mutations or the low expression of mysosin-IIA.
[0042] The method is suitable for testing samples from any human individual. Thus, in various embodiments, the disclosure provides compositions and methods that can be used for convenient and rapid determination of the presence of the Myh9 mutations in genomic DNA, in Myh9 mRNA, and/or protein in a sample comprising cancer cells.
[0043] Any biological sample can be used. In embodiments, the sample is a sample of a tumor, such as a tumor biopsy. In certain approaches, the sample is obtained from the individual and tested directly. In other embodiments, the sample is obtained and subjected to a processing step before being tested for the Myh9 mutations, and/or amount of Myh9 mRNA and/or protein. In some examples, the processing step can be carried out to isolate, and/or purify and/or amplify the Myh9 genomic DNA, mRNA, cDNA, or to isolate the myosin-IIA protein.
[0044] Detection of the Myh9 mutations at the nucleic acid level can be performed using any method. The nucleic acids may be detected directly, or they may be manipulated to facilitate detection. The method is amenable to being performed as part of a multiplexed assay, and can be performed using commercially available components adapted to detect the Myh9 nucleic acids. As such, the nucleic acids can be detected using a chip or an array. In various embodiments, a low level of Myh9 mRNA, or the mutations in DNA or RNA, are detected using a polymerase chain reaction (PCR)-based approach. Thus, Myh9 polynucleotides can be amplified enzymatically in vitro. For amplification reactions, primers can be designed which hybridize to the Myh9 gene or its RNA, and used to obtain nucleic acid amplification products (i.e., amplicons). Those skilled in the art will recognize how to design suitable primers and perform amplification and/or hybridization reactions in order to carry out various embodiments of the method of this disclosure. Generally, the sequence of amplified polynucleotides will be determined using any of a number of techniques so that the presence or absence of the mutations can be determined The disclosure includes forming and detecting complexes of synthetic oligonucleotide probes, such as PCR primers, with genomic DNA, RNA, and/or cDNA. The disclosure includes detecting cDNA, RNA, and genomic DNA by testing a synthetically created plurality of amplicons for the presence or absence of the mutations. The method comprises detecting nucleic acids using probes that are fixed to a solid substrate, wherein a complex of the nucleic acid and the probe is detected.
[0045] The method in certain embodiments includes Real-Time (RT) PCR, including quantitative real-time (QT-RT or qRT-PCR) PCR analysis, or any other in vitro amplification methods. For amplification reactions, primers can be designed which hybridize to mRNA transcribed from the Myh9 gene, and used to obtain nucleic acid amplification products (i.e., amplicons). Those skilled in the art will recognize how to design suitable RT=PCR primers and perform amplification and/or hybridization reactions in order to carry out various embodiments of the method of the invention. In general, suitable primers are at least 12 bases in length, but primers as short as 8 bases can be used depending on reaction conditions. The primers/probes used for detecting Myh9 gene RNA can comprise modifications, such as being conjugated to one or more detectable labels, such as fluorophores in the form of a reporter dye and/or a quenching moiety for use in reactions such as real time (RT)-PCR, including qRT-PCR, which allow quantitation of DNA amplified from RNA, wherein the quantitation can be performed over time concurrent with the amplification. In one embodiment, the amplification reaction comprises at least one polynucleotide probe specific for Myh9 encoded mRNA, wherein the probe includes one terminal nucleotide modified to include a fluorescent tag, and the other terminal nucleotide modified to comprise a moiety that quenches fluorescence from the fluorescent tag. For instance, for use in RT-PCR, such a probe can be designed so that it binds with specificity to a portion of Myh9 encoded mRNA, or its complement that is between and does not overlap sequences to which two RT-PCR primers hybridize. Using this design, signal from the fluorescent tag will be quenched until the probe is degraded via exonuclease activity of the polymerase during amplification, at which point the fluorescent nucleotide will be separated from the quenching moiety and its signal will be detectable.
[0046] It will be recognized by those skilled in the art that while particular sequences of primers are provided herein, other primer sequences can be designed to detect the Myh9 encoded mRNA. In certain embodiments, at least two synthetic oligonucleotide primers are used in an amplification reaction. The primers in different embodiments can be from 8 to 100 nucleotides in length, inclusive, and including all integers there between. The primers are of sufficient length and nucleotide composition to specifically hybridize under stringent conditions to Myh9 encoded mRNA, mRNA, and to cDNA equivalents thereof. In non-limiting examples, a first synthetic primer for use in an amplification reaction comprises or consists of a polynucleotide sequence that is identical to at least 8 contiguous nucleotides in the Myh9 encoded mRNA sequence, and a second primer comprises or consists of a polynucleotide sequence that is complementary to at least 8 contiguous nucleotides in the Myh9 encoded mRNA sequence. Longer primers can tolerate a certain number of mismatched nucleotides that will be apparent to one skilled in the art, and are dictated by such well known parameters as melting temperature and stringency. The primers can be designed such that they do not have complementarity to one another.
[0047] In alternative embodiments, mutant myosin-IIA protein can be detected. Detection of the presence or absence of mutant protein can be performed using, for example, any immunological-based detection mechanism that can distinguish mutant from non-mutant protein, including but not necessarily limited to ELISA assays and immunohistochemistry approaches.
[0048] In embodiments, a metabolic-based assay, such as an assay for myosin-IIA ATPase activity can be performed and compared to a suitable control to determine whether or not the myosin-IIA in the sample exhibits normal or defective ATPase function.
[0049] The determination of the amount of mysosin-IIA expression to ascertain whether its expression is low can be performed at the mRNA and/or protein level using any suitable techniques for quantitating mRNA or protein. In embodiments, the amount of mysosin-IIA protein and/or mRNA can be compared to a reference. The reference can be any suitable reference, examples of which include but are not limited to samples obtained from tumors which have normal mysosin-IIA expression and function, or a standardized curve(s), and/or experimentally designed controls such as known input RNA or protein used to normalize experimental data for qualitative or quantitative determination of the mysosin-IIA expression from the sample for mass, molarity, concentration and the like. The reference level may also be depicted as an area on a graph. In certain embodiments, determining the presence of one or more of the mutations, and/or lower mysosin-IIA expression in a sample is a diagnosis of an aggressive form of cancer, such as a squamous cell carcinoma, or aids in a diagnosis of an aggressive form of a cancer. In embodiments, a determination that the amount of mysosin-IIA is low means the myosin-IIA expression is 5% or less than that of a suitable reference. In embodiments, the reference is a sample of a non-aggressive form of the cancer, or a matched cell type that is non-malignant. In this regard, and as will be more fully appreciated from the examples and figures presented herein, we have determined by univariant Kaplan Meier Survival that low Myh9 expression (bottom 5%) is significantly correlated with reduced survival of HNSCC patients, with a median survival of 13.6 months compared to 28.3 months i.e., FIG. 4D). Likewise, we have observed low myosin-IIa protein expression and even loss of myosin-IIa protein expression in HNSCC and skin SCC (i.e., FIGS. 4B and C). When MYH9 mRNA is analyzed, we observed a distribution of expression (see FIG. 23A), where the lowest 5% corrletates with redced survival but higher mRNA levels did not. In addition, we demonstrate that cells lacking Myh9 or expressing mutant Myh9 are unable to properly respond to DNA damaging agents and consequently cannot activate p53 and p53 target genes, including but not necessarily limited to the pro-apotopic Fas and Bax genes, and the cell senescence gene referred to as p21. Thus, since it is known in the art that the present standard of care for HNSCC patients involves treatment with DNA damaging agents, including but not necessarily limited to radiation or cisplatin-treatment, results presented in this disclosure can be used to predict that Myh9-defective tumor cells will not response to DNA damaging treatments unless a nuclear export inhibitor is used in combination with it, thereby counteracting the effect of mutant or defective myosin-IIa on p53 activation.
[0050] In another aspect, the disclosure provides a method for selecting an individual as a candidate for therapy with a nuclear export inhibitor. This aspect involves testing a sample for the Myh9 mutations and/or a low amount of Myh9 expression as described herein, and subsequent to determining the presence of the mutations and/or the low amount of Myh9 expression, designating the individual as a candidate for the therapy with a nuclear export inhibitor. Likewise, the absence of the mutations or a normal level of Myh9 expression indicates the individual is not a candidate for therapy with a nuclear export inhibitor. In certain embodiments, the method involves treating the individual with a nuclear export inhibitor subsequent to detecting one or more of the mutations and/or low Myh9 expression.
[0051] In embodiments, a result based on a determination of the presence or absence of the mutations, and/or the amount of the Myh9 expression, can be fixed in a tangible medium of expression, such as a digital file saved on a portable memory device, or on a hard drive. The determination can be communicated to a health care provider for aiding in the diagnosis of a disorder associated with the mutations and/or low expression of the Myh9 gene.
[0052] In another aspect the disclosure includes a method for determining whether cancer cells have defective p53 nuclear transport. In embodiments, “defective nuclear transport” means that p53 does not accumulate in the nucleus in response to DNA damage to the same degree that p53 accumulates in the nucleus of a control cell that does not have the mutations in the Myh9 gene.
[0053] The method comprises testing cancer cells for a mutation in the Myh9 gene or low expression of mysosin-IIA, wherein the presence of the mutation in the Myh9 gene or low expression of mysosin-IIA determines that the cells have defective p53 nuclear transport.
[0054] In embodiments, any of the approaches described herein can be performed in vitro.
[0055] In an embodiment, the disclosure includes a method for prophylaxis and/or therapy of a subject who has been diagnosed with, is suspected of having, or is at risk for developing an aggressive form of cancer. Such individuals include those who have cancer or are at risk for recurrence of a cancer, wherein the genome of the cancer cells comprise a mutation that affects the function of mysosin-IIA, and/or the cancer cells exhibit low myosin-IIA expression as further described above. The method comprises administering to the individual a composition comprising an effective amount of a nuclear export inhibitor such that the growth of a tumor comprising the cancer cells is inhibited, and/or such that the survival of the individual is extended, and/or such that the cancer cells are sensitized to chemotherapeutic agents relative to cancer cells that are not exposed to the nuclear export inhibitor, and/or such that the cancer cells are characterized as being capable of having p53 accumulate in the nucleus in response to DNA-induced damage.
[0056] In embodiments, the individual to which the nuclear export inhibitor is administered has a cancer of the oral cavity, a skin cancer, a mammary gland cancer, or a squamous cell carcinoma. In embodiments, the squamous cell carcinoma is a head and neck cancer.
[0057] It is expected that any nuclear export inhibitor can be used. In embodiments, the nuclear export inhibitor is leptomycinB (LeptB), which is an inhibitor of the Crml nuclear export receptor. Other nuclear export inhibitor can be used, and other export receptors can be inhibited in performing the method of the disclosure. The nuclear export inhibitors can be used in combinations with other chemotherapeutic agents. In embodiments, the other chemotherapeutic agents can comprise MDM2, p53 pathway inhibitors such as Nutlin-3a, protease inhibitors, or combinations thereof.
[0058] Administration of a pharmaceutical composition comprising the inhibitor can be performed using any acceptable route and form of delivery. Some non-limiting examples include oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, topical and intranasal. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, and subcutaneous administration. Administration of the compositions can be performed in conjunction with conventional therapies that are intended to treat the particular cancer in question. For example, the composition could be administered prior to, concurrently, or subsequent to conventional anti-cancer therapies. Such therapies can include but are not limited to chemotherapies, surgical interventions, and radiation therapy.
[0059] Routes and frequency of administration of pharmaceutical compositions comprising the nuclear export inhibitor, as well as dosage, will vary from individual to individual, and may be readily established using standard techniques, such as the age of the individual, the type and stage of the cancer.
[0060] The following examples are presented to illustrate embodiments of the present disclosure. They are not intended to limiting in any manner

EXAMPLE 1

[0061] This example identifies Myh9 as a new tumor suppressor that regulates p53 activation and is often mutated in cancers with poor survival.
[0062] Modern genomics is revealing hundreds of genetic alterations associated with cancer. Mining this information for cancer therapies is now predicated on weeding out ‘bystander’ alterations, identifying the ‘driver’ mutations responsible for initiating tumorigenesis and/or metastasis, and elucidating how these mutations alter the fundamental molecular pathways governing tissue growth. Here, we devise and employ a direct in vivo RNAi screening methodology in mice that allows us to simultaneously test candidates whose alterations are associated with head and neck squamous cell carcinomas (HNSCCs) in humans. We identified nine tumor suppressors, seven of which have not been directly linked to tumor development. Our top hit, Myh9, encodes the non-muscle myosin-IIa heavy chain (NMHCIIa). We show that Myh9 functions as a potent tumor suppressor not only in the oral cavity, but also skin and mammary gland. On tumor-susceptible backgrounds, tissue-specific Myh9 RNAi and knockout trigger formation of multiple invasive SCCs and even distant lung metastasis. Surprisingly, myosin-IIa's function is manifested not only in conventional actin-related processes, but also in regulating DNA damage-induced, post-transcriptional p53 activation. Moreover, ˜20% of human HNSCCs have lost myosin-IIa protein expression, ˜5% harbor evolutionarily conserved domain-specific MYH9 mutations, and clinically, low MYH9 expression in HNSCCs correlates with poor survival. These findings establish MYH9 as a major SCC suppressor with prognostic and therapeutic relevance, and also highlight the utility of direct in vivo RNAi to integrate cancer genomics and mouse modeling to rapidly discover and validate potent but low penetrance cancer driver mutations.
[0063] To functionally test putative ‘driver mutations’, researchers have used RNA interference (RNAi) followed by allografting of transduced cultured cancer cells. However, orthotopic transplantations necessitate immunocompromised animals and generate wound-responses, which can confound physiological relevance. To circumvent these caveats, we used non-invasive, ultrasound-guided in utero lentiviral-mediated delivery of RNAi, which selectively transduces single-layered surface ectoderm of living E9.5 mouse embryos (FIG. 5A). When an H2B-RFP transgene is inserted into the vector, stable integration/RNAi expression can be monitored by epifluorescence, which is restricted to adult tissues derived from embryonic ectoderm, including skin, oral cavity and mammary gland epithelia. This approach was recently used to identify regulators of oncogenic H-RasG12V-induced growth in embryos.
[0064] To screen genetic/epigenetic alterations in SCCs for tumor-suppressor activities, we modified this strategy for adult mice. We first showed that adult mice transduced at E9.5 with Brcal but not control shRNAs recapitulate the Brcal-knockout phenotype and develop spontaneous skin and oral SCCs with long latency (FIG. 5, B to E). To accelerate tumor growth, we tested our hairpins in K14-Cre;TGFβ-ReceptorIIfloxed/floxed mice (epithelial-specific, conditional TβRII-knockout), which lose TGFβ signaling in epidermis, oral, anogenital and mammary epithelia and display enhanced SCC susceptibility. Indeed, on this TβRII-cKO background, Brcal-knockdown generated SCCs with increased frequency and <4× latency (FIG. 5B). Having validated our sensitized approach, we devised a pooled shRNA format to carry out our in vivo screen to functionally distinguish driver and bystander mutations and dissect the physiological relevance of epigenetic changes in gene expression that occur in the development of SCC tumor-initiating (stem) cells (FIG. 1A).
[0065] We selected 1763 shRNA lentiviruses that targeted 347 mouse genes (˜5 shRNAs/gene) which either a) had human orthologs carrying recurring HNSCC somatic mutations, or b) were deregulated ≧2× in tumor-initiating stem cells purified from TβRII-cKO SCCs, whose cancers were initiated by oncogenic HRas-inducing carcinogens (Table 1). We also included positive (Brcal-shRNA#560) and negative (scramble non-targeting shRNA) controls. We titered our pool such that ˜15-20% of the ˜450,000 surface ectoderm progenitors were infected (FIG. 6A). Based upon library size, ≧20 cells/embryo should be transduced with each shRNA, which if inconsequential should expand clonally 40× by adulthood. To control for coverage, we infected E9.5 epidermis, isolated E12.5 genomic DNA and verified by Illumina sequencing that shRNA representations correlated nicely with their individual abundance within our initial pool (FIG. 6B).
[0066] To ensure a coverage of >500 individual clones/shRNA, we infected 74 genotypically matched TβRII-cKO or TβRIIfl/fl-control embryos with our pooled (or scrambled-shRNA) lentiviruses and monitored pups into adulthood. As expected, ˜5% of TβRII-cKO mice developed SCCs confined to anogenital epithelia. Scramble-shRNA expression did not affect these statistics nor did transduction with a “control pool” of 1000 random shRNAs.
[0067] In striking contrast, two otherwise wild-type mice transduced with our candidate tumor-suppressor shRNA pool developed skin tumors and all 28 transduced TβRII-cKO mice developed lesions within skin, oral cavity and/or mucocutaneous junctions at eyelids (FIG. 1B and FIG. 7A). All TβRII-cKO and other control animals remained tumor-free at these sites. These findings underscored the efficacy of our approach and documented the enrichment of our test-shRNA library for SCC tumor suppressors.
[0068] 87 lesions were chosen for further analyses. Most displayed histopathological features of SCCs with varying degrees of differentiation and local invasion; a few were squamous papillomas or epidermal hyperplastic lesions, with one benign basal cell tumor (FIG. 7 to 9). Deep sequencing revealed that most lesions harbored one or two transduced shRNAs that were highly enriched relative to initial pool representation and to healthy skin surrounding the tumor; gratifyingly this included Brcal-shRNA#560, our positive-control (FIG. 1C). Nine candidate tumor suppressors were identified that displayed highly enriched multiple independent shRNAs in ≧3 tumors (FIG. 1D).
[0069] Strikingly, 40% of tumors were enriched for shRNAs against Myh9, encoding non-muscle myosin-IIa heavy chain (NMHCIIa). These included nearly all tumors emerging by 4 months of age. Importantly, four Myh9-shRNAs in the library were enriched in different tumors of multiple mice (example in FIG. 1 C). Knockdown efficiency of our five Myh9-shRNAs correlated strongly with multiplicity/aggressiveness of tumor growth (FIG. 2A). Tested individually in vivo, the three top Myh9-shRNAs markedly reduced myosin-IIa protein (FIG. 2B and FIG. 10A).
[0070] Myh9-knockdown animals showed an ‘open eye at birth’ phenotype. From postnatal day 8 onward, hair coats were visibly sparse (FIGS. 10, B and C). Histology and immunofluorescence showed normal epidermal differentiation, without major changes in either proliferation or apoptosis (FIGS. 11, A and B). Mosaic transductions recapitulated these findings. As Myh9 shRNA-transduced TβRII-cKO mice aged, sparse areas of epidermal thickening appeared, accompanied by expanded immunolabelings for basal keratin K14, and for K6, a suprabasal marker associated with hyperproliferative epidermal disorders (FIGS. 11, C and D).
[0071] TβRII-cKO mice transduced with Myh9-shRNA #507, #504 or #503 also developed multiple, highly proliferative and poorly differentiated skin SCCs and HNSCCs with 3-7 month median latencies (FIG. 2C). Tumors were myosin-IIa-deficient, displayed hallmarks of human SCCs, and invaded subcutaneous fat, underlying muscle and salivary glands (FIG. 12, A to G). They colonized draining lymph nodes (FIG. 12F) and even formed distant lung metastases (FIG. 2D). In location, morphology and invasiveness, they differed from the spontaneous anogenital TβRII-cKO tumors that formed at the interface between colonic and squamous epithelia. Finally, ˜25% of TβRIIfl/fl (no-Cre) mice transduced with Myh9-shRNAs but not scrambled-shRNAs developed skin SCCs after 1 year, indicating that Myh9 loss alone is sufficient to promote spontaneous tumor development.
[0072] To further define MYH9 as an SCC tumor suppressor, we crossed Myh9fl/fl mice to our epithelial-specific K14-Cre and tamoxifen-regulated K14CreER deleter strains. Embryologically, Myh9-cKO mice recapitulated open eye at birth and hair phenotypes (FIG. 13, A and B). In adult mice, inducible deletion of even one Myh9 allele concomitantly with TβRII ablation resulted in multiple invasive SCCs on the back, ears and anal region (FIG. 2E FIG. 13, C to E). Littermate controls remained tumor-free during this time.
[0073] Our knockout/knockdown strategies targeted not only skin and oral epithelium but also mammary epithelium. Myh9-shRNA transduced wild-type animals underwent seemingly normal mammary gland formation and/or branching morphogenesis (FIG. 14, A to D). By contrast, TβRII-cKO mice transduced with Myh9-shRNAs frequently displayed multiple mammary lesions by ˜10-12 weeks of age (FIG. 14D). Thus, amidst glands positive for luminal (K8/K18) and myoepithelial (K5/K14) markers, K5/K14, K6 and K10-positive lesions were seen that resembled SCCs. They were H2BRFP-positive and stained poorly for myosin-IIa, reflective of their expression of Myh9-shRNA (FIG. 14, D to G). Their early occurrence suggested that they were primary breast tumors, rather than metastatic lesions from primary skin-SCCs or HNSCCs. Although abrogation of TGFβ signaling sensitizes mammary epithelium to SCC formation, these tumors were not observed with scrambled-shRNAs, underscoring their added dependency on Myh9-knockown.
[0074] The pronounced invasion and distant metastases was linked to Myh9-knockdown. Indeed, epithelial outgrowth from skin explants was markedly enhanced when TβRII-cKO embryos were transduced with Myh9 but not control shRNAs (FIG. 15). Similar results were obtained in vitro with scratch-wound (FIG. 16A) and trans-well migration assays (FIG. 2F). This increase was independent of TGFβ signaling status but as substantial as that seen with TβRII ablation. Moreover, reducing Myh9 levels had profound effects on cells challenged to invade and migrate through a Matrigel-coated filter (FIG. 2G).
[0075] Our results thus far were consistent with the well-established role for actin-myosin networks in regulating cellular movements. More puzzling was our discovery that Myh9-knockdown showed no tumorigenic effects in mice whose epithelium carried a Trp53 gain-of-function mutation analogous to that found in human HNSCCs. By contrast, under conditions favoring HRas mutations, Myh9-shRNAs greatly accelerated the latency, multiplicity and SCC conversion rate, analogous to our findings with TβRII-ablation (FIG. 17, A to E). This context-dependency raised the possibility that myosin-IIa deficiency and Trp53 mutations may be functionally redundant.
[0076] To test for an epistatic interaction of these two pathways, we treated primary keratinocytes with doxorubicin, which introduces double-stand DNA breaks, thereby triggering the DNA damage response (DDR) pathway. In control keratinocytes, this led to p53 activation (FIG. 3A). Notably, however, Myh9 suppression with multiple shRNAs resulted in significantly delayed and less-sustained p53 activity in doxorubicin-treated cultures (FIG. 3A and FIG. 18A). This was also true for Myh9fl/fl keratinocytes transduced in vitro with lentiviral Cre compared to empty control-lentivirus, as well as epidermis of γ-irradiated Myh9-cKO and Myh9-knockdown mice (FIG. 3, B to C and FIG. 18, B to D). Moreover, relative to controls, Myh9-deficient keratinocytes failed to induce p53-responsive genes such as p21, Fas, Bax, Mdm2 and 14-3-3σ (FIG. 3A, C, D and FIG. 18, A to B). Importantly, these effects were specific to the p53 pathway, since control and Myh9-knockdown keratinocytes responded equally well to other stimuli such as EGF (FIG. 19A).
[0077] The suppressive effects of myosin-IIa deficiency on p53 activation were also observed with primary mammary epithelial cultures (FIG. 20A). Moreover, these effects were not dependent upon TGFβ signaling, and conversely, TβRII-ablation did not impair the ability of doxorubicin to induce p53 (FIG. 20, B to D). Additionally, such effects were not observed with shRNAs against the other non-muscle myosin-II family members, Myh10 (myosin-IIb) and Myh14 (myosin-IIc) (FIG. 20, E to F).
[0078] Together, our findings indicated that the effects on the DDR/p53 pathway are not simply a general phenomenon of SCC tumorigenesis, but rather a specific consequence of myosin-IIa deficiency. Probing deeper, we discovered that the myosin-II kinase inhibitor, blebbistatin, phenocopied Myh9 loss of function effects on DDR-induced p53 activation (FIG. 3E and FIG. 21A). Consistent with a role for myosin-IIa's ATPase function, inhibition of Rho-kinase (Rock), an upstream regulator of myosin-II's ATPase activity, similarly dampened the DNA damage-induced p53 response (FIG. 3E and FIG. 21B). Surprisingly, however, latrunculin-mediated inhibition of F-actin polymerization did not display these effects, raising the tantalizing possibility that these effects may be independent of myosin-IIa's role in the actomyosin cytoskeleton (FIG. 3E and FIG. 21B).
[0079] The initial steps of the DDR response appeared to be unperturbed, as judged by stress-induced phosphorylation of the histone variant MAX and activation of DNA checkpoint kinases Chk1 and Chk2 (FIG. 21B). Additionally, Myh9-ablation did not affect Trp53 gene expression as Trp53 mRNA levels were normal (FIG. 2D). However, in the presence of proteasome inhibitor MG132, p53 protein levels were comparably induced in both Myh9-knockdown and control keratinocytes (FIG. 21C).
[0080] Seeking how myosin-IIa deficiency might affect p53 stability, we first discovered that p53's nuclear accumulation following DNA damage did not occur when myosin-II ATPase was inhibited (FIG. 3F). We next learned that when DDR-induced myosin-IIa-deficient keratinocytes were treated with leptomycinB (LeptB), an inhibitor of the Crml nuclear export receptor, nuclear p53 accumulation as well as transactivation of the p53 target genes such as CDKN2 (p21) were restored to normal levels (FIG. 3F and FIG. 21D). This shows that the p53 pathway can be induced in response to DNA damage even when myosin-IIa is defective but it fails to do so owing to a specific inability to remain in the nucleus.
[0081] Our initial screen included MYH9 because of its mutations in exome-sequenced HNSCCs. Given the possible clinical relevance of LeptB as a means to overcome p53 effects in myosin-IIa-defective tumors, we first confirmed that p53 activation is similarly compromised in MYH9-deficient primary human keratinocytes (FIG. 4A). Moreover, upon surveying myosin-IIa's status in >350 human skin, head and neck SCCs and control tissues, we found that in contrast to normal and hyperplastic skin, which consistently displayed strong immunolabeling, 24% of skin SCCs and 31% of HNSCCs showed weak or no immunolabeling (FIGS. 4, B and C and FIG. 22, A to C). K14 immunohistochemistry internally controlled for tissue quality. Interestingly, myosin-IIa was diminished in a number of early stage, i.e. grade I, SCCs, indicating that its loss may constitute an early event in tumor progression (FIG. 22D). Additionally, when skin SCCs were analyzed according to TβRII and P-Smad2 status, a substantial fraction (˜83%) of myosinIIa-negative tumors showed signs of concomitant loss of TGFβ signaling (FIG. 22E).
[0082] Finally, we exploited The Cancer Genome Atlas (TCGA) in order to determine whether MYH9-mRNA expression correlates with HNSCC patient survival. Remarkably, univariate analysis revealed a significant correlation between the lowest MYH9-mRNA expression (bottom 5%) and reduced time to death in HNSCC patients (30.0 vs. 13.6 months; n=166 patients; p=0.0044, log rank test; for detailed analysis, visit: http://bit.ly/13xxPuh) (FIG. 4D). By contrast, even though some patients showed either increased MYH9-mRNA levels or MYH9 amplifications, Kaplan-Maier Analysis revealed no survival advantage or disadvantage in this cohort (FIG. 23, A to C).
[0083] The TCGA database contained 13 missense or truncating MYH9 mutations in their cohort of 302 sequenced HNSCCs (FIG. 4E) in addition to others that were previously identified. Notably, patients harboring these mutations or reduced MYH9 expression associate with significantly shorter survival than other HNSCCs (15.2 vs. 26.4 month; n=166 patients p=0.0156, log rank test) (FIGS. 25 A and B).
[0084] Computational analyses of evolutionary conservation patterns yields a functional impact score (FIS), which predicts the putative impact of an amino acid residue change on a protein and assigns a probability that such a mutation will result in functional consequences at the level of the organism. Interestingly, all 15/16 of these MYH9 mutations thus far found in human HNSCCs had a high or medium FIS score, indicative of positive selection for these mutations (FIG. 4E and FIGS. 24, A and B). Indeed, statistical analysis of the TCGA data set revealed that high-scoring functional MYH9 mutations are significantly overrepresented in HNSCCs (p=0.000026), but also in a number of other cancers, including lung SCCs and breast cancer (Table 2 and 3; FIG. 25C).
[0085] These cancer-associated MYH9 mutations were not randomly distributed across the gene, as would be expected for mutations, which accumulate randomly over time. Rather, they showed a clear signature of selection, with a preferential clustering to the Myosin Head domain and especially the highly-conserved ATPase SwitchII region (FIG. 4E; p=0.0015). Notably, a point mutation in this region of Dictyostelium myosin II compromises ATPase activity—in fact, mutations of the exact same conserved amino acid (A454) are found in human HNSCCs (FIG. 4E and FIG. 24B). Site-directed point mutagenesis of human MYH9 further corroborated these bioinformatic predictions. Thus, while the MYH9-E475K and also MYH9-F1261L mutants retained its ability to localize to stress fibers, it exerted dominant negative effects on p53 activation (FIG. 4E and FIGS. 26, A and B).
[0086] Based upon this predicted functionality of mutations, MYH9 ranked 16th among all 15,086 genes altered in HNSCCs (p-value 0.000026) (Table 2). Based upon another algorithm for mutation calling (MutSig), Myh9 ranks 49th (Table 4). Additionally, ˜15% of all HNSCCs in the TCGA dataset show hemizygous loss of one MYH9 allele. This facet is particularly intriguing given our functional analyses showing that Myh9 heterozygosity predisposes mouse epithelia to SCC formation. Hemizygous MYH9 loss is also common in other epithelial cancers—1076 out of 3081 cases within the entire TCGA dataset show monoallelic loss of MYH9 (FIG. 4F and Table 3 and 5). Although homozygous deletion, amplifications or gains exist, they are not significantly overrepresented in these cancers, nor would severe alterations be expected given the essential role for myosin-IIa in actomyosin networks.
[0087] MYH9 had not previously been exposed functionally as a tumor suppressor, and hence it was remarkable that it not only surfaced as our top hit but in addition, its loss led to spontaneous, highly invasive and metastatic SCCs. The inverse relation was particularly puzzling, as dominant active Rho kinase and/or extracellular matrix (ECM) stiffness contribute and even promote transformation in some cell lines and animal models. That said, primary human cancers cells are considerably more pliable, and indeed our results indicate that a reduction in actin-myosin can confers transforming potential. The most striking link between myosin-IIa and cancer, however, seems to be independent of the conventional role for myosin-IIa in actomyosin dynamics. Given our new findings that myosin-IIa profoundly affects p53 activation, we view myosin-IIa as a multifaceted tumor suppressor at the crossroads between migration, invasion and survival.
[0088] The following provides a description of the materials and methods used to obtain the results presented and described herein.
[0089] Materials and Methods. Mice and lentiviral transductions: TβRII foxed mice were crossed to K14-Cre and/or Rosa26YFPlox/stop/lox mice and or K14-CreER mice. Myh9 floxed mice were purchased form EMMA (EM:02572). CD1 mice were from Charles River laboratories. Large-scale production and concentration of lentivirus (6−109 cfu/ml) as well as ultrasound-guided lentiviral injection were performed as previously described. As controls for knock-down mice, littermates were infected with a non-targeting scrambled-shRNA, which activates the endogenous microRNA processing pathway but is not known to target any gene. Myh9fl/fl K14CreER mice were injected i.p. with 2 mg tamoxifen (20 mg/ml stock solution in corn oil) for 5 consecutive days at 6-8 weeks of age. DMBA/TPA treatment was performed as previously described. Briefly, 7-8 week old CD1 mice in second telogen were shaved and treated with 400 nmol DMBA in 100 ul aceton one week later. Thereafter, mice were treated with 17 nM TPA in 100 ul aceton wice weekly for 20 weeks. All animals were maintained in an AAALAC-approved animal facility and procedures were performed with protocols approved by IACUC and in accordance with the National Institutes of Health.
[0090] Constructs and RNAi: shRNA constructs for the shRNA pool were obtained from The Broad Institute's Mission TRC-1 mouse library. We tested and used especially the following shRNAs targeting Brcal and Myh9:
[00001] [TABLE-US-00001]
    Brca1 #560 TRCN0000042560
    (SEQ ID NO: 1)
    5′-CCCATCATACTTTAATGTGTA-3′
   
    Myh9 #503 TRCN0000071503
    (SEQ ID NO: 2)
    5′-GCCCTGGAACTGTGTTTAGAA-3′
   
    Myh9 #504 TRCN0000071504
    (SEQ ID NO: 3)
    5′-CGGTAAATTCATTCGTATCAA-3′
   
    Myh9 #505 TRCN0000071505
    (SEQ ID NO: 4)
    5′-GCACACATTGACACAGCCAAT-3′
   
    Myh9 #506 TRCN0000071506
    (SEQ ID NO: 5)
    5′-GCCATACAACAAATACCGCTT-3′
   
    Myh9 #507 TRCN0000071507
    (SEQ ID NO: 6)
    5′-GCGATACTACTCAGGGCTTAT-3′
[0091] The scrambled shRNA 5′-CAACAAGATGAAGAGCACCAA-3′ (SEQ ID NO:7) was used for the control. These hairpin sequences were cloned from the library vectors into pLKO-H2B-RFP vector. All other hairpins were obtained from the TRC library and are listed in Table 1.
[0092] Tumor free survival: Control and TβRII-cKO animals were transduced at E9.5 with low-titer shRNA pool targeting orthologs of putative HNSCC genes, including Brcal or Myh9. Scrambled shRNA was used as control. Transductions and knockdowns were confirmed by real-time PCR of mRNAs isolated from newborn skin epidermis or by fluorescence microscopy of a lentiviral reporter fluor, H2B-RFP or H2B-GFP. Animals were assessed biweekly for signs of tumorigenesis, and were considered positive if lesions grew to be larger than 2 mm in diameter.
[0093] Deep Sequencing: Sample preparation, preamplification and sequence processing Epidermal and tumor cells were subjected to genomic DNA isolation with the DNeasy Blood & Tissue Kit (Qiagen), and each sample was analyzed for target transduction using real-time PCR. 6 μggenomic DNA of each tumor was used as template in a pre-amplification reaction with 25 cycles and Phusion High-Fidelity DNA Polymerase (NEB). PCR products were run on a 2% agarose gel, and a clean ˜200 bp band was isolated using QIAquick Gel Extraction Kit as recommended by the manufacturer (Qiagen). Final samples were then sent for Illumina HiSeq 2000 sequencing. Illumina reads were trimmed to the 21 nt hairpin sequence using the FASTX-Toolkit and aligned to the TRC 2.x library with BWA (v 0.6.2)44 using a maximum edit distance of 3. Hits were ranked based on (a) numbers of shRNAs that targeted the gene and scored positively in the screen, with 2 out of 5 shRNAs being considered meaningful; and (b) numbers of tumors enriched for a specific shRNA.
[0094] Immunofluorescence staining The following primary antibodies were used for immunofluorescence: chicken anti-GFP (1:2000; Abcam); guinea-pig anti-K5 (1:500; E. Fuchs); rat anti-K14 (1:500; E. Fuchs); rabbit anti-K6 (1:500; E. Fuchs); rabbit anti-K18 (1:500; E. Fuchs); rat anti-CD104 β4-integrin (346-11A, 1:300; BD); rabbit anti loricin (1:500; E. Fuchs); rabbit anti-Caspase 3 (AF835, 1:1000; R&D), rabbit anti-K10 (PRB-159P, 1:1000; Covance); rabbit anti-Myh9 (HPA001644, 1:500 Sigma); rabbit anti-SMA (ab5694 1:300; Abcam) and rabit anti-p53 (NCL-p53-CMSp, 1:300; Leica). Secondary antibodies were conjugated to Alexa-488, 546, or 647 (1:1000, Life Technologies). Cells and tissues were processed as previously reported, and mounted in Vectashield HardSet mounting medium with DAPI (Life Technologies). Confocal images were captured by a scanning laser confocal microscope (LSM510 and LSM780; Carl Zeiss, Inc.) using Plan-Apochromat 20×/0.8 oil and C Apochromat 40×/1.2 water lenses. Images were processed using ImageJ and Adobe Photoshop CS3. For quantifications of nuclear p53, images were captured using an inverted Zeiss LSM 780 laser scanning microscope, powered by Zen software. Quantitative image analysis was performed using ImageJ software. To quantify p53 nuclear staining, the following formula was used: CTCF (corrected total cell fluorescence)=whole nucleus signal−(mean background signal (measured in the suprabasal layer)×area of the nucleus measured).
[0095] Immunohistochemistry and histological analyses of mouse and human Tumors: Immunohistochemistry was performed as previously described. Briefly, 5-μm sections were cut, stained with H&E or processed for immunohistochemistry/immunofluorescence microscopy. Whole-mount staining of mammary glands was performed as described. For immunoperoxidase staining, paraffin-embedded sections were dehydrated and antigenic epitopes exposed using a 10-mM citrate buffer (pH 6.0) in a pressure cooker. Sections were incubated with the following primary antibodies at 4° C. overnight: rabbit anti-K14 (1:500; E. Fuchs) and rabbit anti-Myh9 (HPA001644, 1:500 Sigma). Primary antibody staining was visualized using peroxidase-conjugated anti-rabbit IgG followed by the DAB substrate kit for peroxidase visualization of secondary antibodies (Vector Laboratories). The following human tissue microarray comprising 48 healthy human skin samples, 30 hyperplastic skin lesions and 206 human skin SCCs as well as from 156 HNSCCs were obtained from US Biomax, Rockeville, Md.: SK244a, SK241, SK242, SK801, SK802, SK2081, SK801b and HN803a, HN811a, HN483.
[0096] Western Blot analysis:-Protein blotting was carried out using standard protocols. Briefly, total cell lysates were prepared using RIPA (20 mM Tris-HCl (pH 8.0), 150 mM NaCl 1 mM EDTA, 1mM EGTA, 1% Triton X-100, 0.5% Deoxycorate, 0.1% SDS, 25 mM β-glycerophosphate, 10 mM NaF, 1 mM Na3VO4) supplemented with protease inhibitors (Complete mini, Roche). Blots were blocked with 5% BSA in 1×TBS 0.1% Tween-20 (TBST) for 1 h and incubated with the primary antibody overnight at 4° C. (diluted in TBST according to the manufacturer's protocol). Primary antibodies were reactive to rabbit anti-Myh9 (1:500, HPA001644, Sigma); phosphorylated (P) Erk1/2 (1:1000, #9101, Cell Signaling), Erk1/2 (1:1000, #9102, Cell Signaling), mouse anti-p53 (1:500, #2524, Cell Signaling), mouse anti-p21(F5) (1:500; sc-6246, Santa Cruz), mouse anti-GAPDH (ab8245, 1:5000; Abcam), mouse anti-Chk2 (1:500, #611570, BD); rabbit anti-P-Chk1 (1:500, #12302P, Cell Signaling); mouse anti-Chk1 (1:1000, 2360S, Cell Signaling); rabbit anti-pSmad2 (Ser465/467) (1:1000, Cell Signaling) and mouse anti-Smad2/3 (610843, 1/500; BD). Blots were washed three times in TBST for 30 min, incubated with HRP-conjugated secondary antibodies (1:2,000; Promega) for lh at room temperature, washed 3 times in TBST for 30 min and visualized using enhanced chemiluminescence (ECL).
[0097] p53/DNA damage responses:_For measurement of DNA damage response and p53 activation primary mouse keratinocytes cells were seeded at a cell density of 100,000 cells per well in a 6-well plate and allowed to grow for 24 h at 3% O2 till importantly 100% confluency. Cells were then treated with doxorubicin (1 mM) as previously reported. For experiments using blebbistatin, cells were pretreated with blebbistatin (4 μM final concentration, Sigma B0560) 30 min prior to doxorubicin treatment. The Rock inhibitor Y27632 was used at 10 μM (Sigma Y0503), LatrunculinA was used at 2 μM (Sigma L5163), LeptomycinB was used at 20 nM (Sigma #9676) and the proteasome inhibitor MG132 was used at 3 μM (Sigma M7449).
[0098] mRNA quantifications: Newborn mouse epidermal keratinocytes were cultured in 0.05 mM Ca++ E-media supplemented with 15% serum. For lentiviral infections, cells were plated in 6-well dishes at 200,000 cells/well and incubated with lentivirus in the presence of polybrene (100 mg/ml) overnight. After 2 days, infected cells were positively selected with puromycin (1 mg/ml) for 3 days, and then processed for mRNA analysis. cDNAs were generated from 1 μg of total RNA using the SuperScript Vilo cDNA synthesis kit (Life Technologies). Real-Time PCR was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems) and gene-specific and Ppib as well as Hprt1 control primers as well as the following primers for p53 target genes:
[00002] [TABLE-US-00002]
    p21 (Cdkn1a) fwd primer
    (SEQ ID NO: 8)
    5′-GTGGCCTTGTCGCTGTCTT-3′
   
    p21 (Cdkn1a) rev primer
    (SEQ ID NO: 9)
    5′-GCGCTTGGAGTGATAGAAATCTG-3′
   
    Fas fwd primer
    (SEQ ID NO: 10)
    5′-CTGCGATGAAGAGCATGGTTT-3′
   
    Fas rev primer
    (SEQ ID NO: 11)
    5′-CCATAGGCGATTTCTGGGAC-3′
   
    Bax forward primer
    (SEQ ID NO: 12)
    5′-ATGCGTCCACCAAGAAGCTGA-3 ′
   
    Bax reverse primer
    (SEQ ID NO: 13)
    5′-AGCAATCATCCTCTGCAGCTCC-3′
   
    Mdm2 forward primer
    (SEQ ID NO: 14)
    5′-TTCGGCCTTCTCCTCGCTGTCGTC-3′
   
    Mdm2 reverse primer
    (SEQ ID NO: 15)
    5′-TGGCGTAAGTGAGCATTCTGGTGA-3′
   
    Bax forward primer
    (SEQ ID NO: 16)
    5′-TGTGTGCGACACTGTGCTC-3′
   
    Bax reverse primer
    (SEQ ID NO: 17)
    5′-TCGGCTAGGTAGCGGTAGTAG-3′
   
    Hprt1 for primer
    (SEQ ID NO: 18)
    GATCAGTCAACGGGGGACATAAA 
   
    Hprt1 rev primer
    (SEQ ID NO: 19)
    CTTGCGCTCATCTTAGGCTTTGT 
   
    Ppib for primer
    (SEQ ID NO: 20)
    GTGAGCGCTTCCCAGATGAGA 
   
    Ppib rev primer
    (SEQ ID NO: 21)
    TGCCGGAGTCGACAATGATG 
[0099] Explant and Migration/Invasion Assay:_Explant outgrowth migration assays were performed as described previously. Briefly, explants were cut using a 3-mm dermal biopsy punch (Miltex), placed on fibronectin-coated 35-mm, glass-bottomed plates (MatTek), and submerged in E-media containing 0.6 mM Ca++. Explant outgrowth was monitored daily.
[0100] Transwell migration assays were performed on 24-well plates. The underside of each Boyden chamber well was coated with 10 μg/ml fibronectin and placed atop fibroblast-conditioned E-media containing 0.05 mM Ca++. A total of 50,000 keratinocytes/well were plated in 100 μl E-medium containing 0.05 mM Ca++. Eight hours later, cells were washed off the top membrane and fixed on the bottom membrane. Cells were stained using H&E and counted under the microscope. Similarly, invasion assays were performed in precoated Matrigel invasion chamber (BD Biosciences).
[0101] Analysis of human HNSCC patient data: We analyzed the publicly available data sets of the The Cancer Genome Atlas (TCGA: http://cancergenome.nih.gov). The cBioPortal for Cancer Genomics developed and maintained by the Computational Biology Center at Memorial Sloan-Kettering Cancer Center was used to mine the publicly available TCGA dataset on HNSCC. To re-trace the exact Kaplan-Meyer analysis please visit http://bit.ly/13xxPuh for the analysis of HNSCC patients stratified by the lowest (<5th percentile) MYH9 expression versus the rest (≧5th percentile) and http://bit.ly/YK0dYy for the analysis of HNSCC patients stratified by the lowest (<5th percentile) MYH9 expression or/and harboring MYH9 mutations versus the rest (≧5th percentile).
[0102] Statistical Analysis: All data were collected from experiments performed at least three times, and expressed as mean ± standard deviation (s.d.) or standard error of the mean (s.e.m.). Differences between groups were assayed using two-tailed student t-test and Prism 5 (GraphPad Software). Differences were considered significant if P<0.05. Data were analyzed and statistics performed (unpaired two-tailed Student's t-test) in Prism5 (GraphPad). Significant differences between two groups are noted by asterisks or p-values.
[00003] [TABLE-US-00003]
  TABLE 1
 
  Genes and shRNA construct included in the shRNA library. The Clone
  column provides the name of the construct as given in the Public TRC
  Portal of The RNAi consortium. The construct name is indexed in the
  Public TRC Portal with NCBI accession numbers and other information
  about the shRNA constructs. All of the information and the
  constructs are publicly available.
  Gene #   Construct #   Clone   gene
 
  1   1   TRCN0000179370   1500026B10Rik
    2   TRCN0000179624   1500026B10Rik
    3   TRCN0000179770   1500026B10Rik
    4   TRCN0000184447   1500026B10Rik
    5   TRCN0000184474   1500026B10Rik
  2   6   TRCN0000126479   2010107G23Rik
    7   TRCN0000126480   2010107G23Rik
    8   TRCN0000126481   2010107G23Rik
    9   TRCN0000126482   2010107G23Rik
    10   TRCN0000126483   2010107G23Rik
  3   11   TRCN0000176661   2310057J16Rik
    12   TRCN0000177579   2310057J16Rik
    13   TRCN0000182145   2310057J16Rik
    14   TRCN0000182145   2310057J16Rik
    15   TRCN0000182753   2310057J16Rik
  4   16   TRCN0000113435   Abca6
    17   TRCN0000113436   Abca6
    18   TRCN0000113437   Abca6
    19   TRCN0000113438   Abca6
    20   TRCN0000113439   Abca6
  5   21   TRCN0000113440   Abca9
    22   TRCN0000113442   Abca9
    23   TRCN0000113443   Abca9
    24   TRCN0000113444   Abca9
  6   25   TRCN0000105260   Abcd4
    26   TRCN0000105261   Abcd4
    27   TRCN0000105262   Abcd4
    28   TRCN0000105263   Abcd4
    29   TRCN0000105264   Abcd4
  7   30   TRCN0000087968   Abi3
    31   TRCN0000087969   Abi3
    32   TRCN0000087970   Abi3
    33   TRCN0000087971   Abi3
    34   TRCN0000087972   Abi3
  8   35   TRCN0000022604   Acvr1c
    36   TRCN0000022605   Acvr1c
    37   TRCN0000022606   Acvr1c
    38   TRCN0000022607   Acvr1c
    39   TRCN0000022608   Acvr1c
  9   40   TRCN0000032274   Adamts12
    41   TRCN0000032275   Adamts12
    42   TRCN0000032276   Adamts12
    43   TRCN0000032277   Adamts12
    44   TRCN0000032278   Adamts12
  10   45   TRCN0000114956   Adcy8
    46   TRCN0000114957   Adcy8
    47   TRCN0000114958   Adcy8
    48   TRCN0000114959   Adcy8
    49   TRCN0000114960   Adcy8
  11   50   TRCN0000086608   Aff3
    51   TRCN0000086609   Aff3
    52   TRCN0000086610   Aff3
    53   TRCN0000086612   Aff3
  12   54   TRCN0000071348   Ahctf1
    55   TRCN0000071349   Ahctf1
    56   TRCN0000071350   Ahctf1
    57   TRCN0000071351   Ahctf1
    58   TRCN0000071352   Ahctf1
  13   59   TRCN0000101420   Allc
    60   TRCN0000101421   Allc
    61   TRCN0000101422   Allc
    62   TRCN0000101423   Allc
    63   TRCN0000101424   Allc
  14   64   TRCN0000022614   Amhr2
    65   TRCN0000022615   Amhr2
    66   TRCN0000022616   Amhr2
    67   TRCN0000022617   Amhr2
    68   TRCN0000022618   Amhr2
  15   69   TRCN0000090053   Ank3
    70   TRCN0000090054   Ank3
    71   TRCN0000090055   Ank3
    72   TRCN0000090056   Ank3
    73   TRCN0000090057   Ank3
  16   74   TRCN0000090263   Anln
    75   TRCN0000090264   Anln
    76   TRCN0000090265   Anln
    77   TRCN0000090266   Anln
  17   78   TRCN0000110725   Anxa3
    79   TRCN0000110726   Anxa3
    80   TRCN0000110727   Anxa3
    81   TRCN0000110728   Anxa3
    82   TRCN0000110729   Anxa3
  18   83   TRCN0000012278   Apaf1
    84   TRCN0000012280   Apaf1
    85   TRCN0000012281   Apaf1
    86   TRCN0000012282   Apaf1
  19   87   TRCN0000026148   Ar
    88   TRCN0000026177   Ar
    89   TRCN0000026189   Ar
    90   TRCN0000026195   Ar
    91   TRCN0000026211   Ar
  20   92   TRCN0000022609   Araf
    93   TRCN0000022610   Araf
    94   TRCN0000022611   Araf
    95   TRCN0000022612   Araf
    96   TRCN0000022613   Araf
  21   97   TRCN0000109960   Arhgef12
    98   TRCN0000109961   Arhgef12
    99   TRCN0000109962   Arhgef12
    100   TRCN0000109963   Arhgef12
    101   TRCN0000109964   Arhgef12
  22   102   TRCN0000075553   Atf5
    103   TRCN0000075554   Atf5
    104   TRCN0000075555   Atf5
    105   TRCN0000075556   Atf5
    106   TRCN0000075557   Atf5
  23   107   TRCN0000012643   Atm
    108   TRCN0000012644   Atm
    109   TRCN0000012645   Atm
    110   TRCN0000012646   Atm
    111   TRCN0000012647   Atm
  24   112   TRCN0000101520   Atp10d
    113   TRCN0000101521   Atp10d
    114   TRCN0000101522   Atp10d
    115   TRCN0000101523   Atp10d
  25   116   TRCN0000115396   Azin1
    117   TRCN0000115397   Azin1
    118   TRCN0000115398   Azin1
    119   TRCN0000115399   Azin1
    120   TRCN0000115400   Azin1
  26   121   TRCN0000070508   Barx2
    122   TRCN0000070509   Barx2
    123   TRCN0000070510   Barx2
    124   TRCN0000070511   Barx2
    125   TRCN0000070512   Barx2
  27   126   TRCN0000004678   Bcl2
    127   TRCN0000004679   Bcl2
    128   TRCN0000004680   Bcl2
    129   TRCN0000004681   Bcl2
  28   130   TRCN0000042553   Bcl3
    131   TRCN0000042554   Bcl3
    132   TRCN0000042555   Bcl3
    133   TRCN0000042556   Bcl3
    134   TRCN0000042557   Bcl3
  29   135   TRCN0000012563   Bmi1
    136   TRCN0000012564   Bmi1
    137   TRCN0000012565   Bmi1
    138   TRCN0000012566   Bmi1
    139   TRCN0000012567   Bmi1
  30   140   TRCN0000025877   Bmp2
    141   TRCN0000025878   Bmp2
    142   TRCN0000025923   Bmp2
    143   TRCN0000025939   Bmp2
    144   TRCN0000025949   Bmp2
  31   145   TRCN0000025875   Bmp4
    146   TRCN0000025905   Bmp4
    147   TRCN0000025922   Bmp4
    148   TRCN0000025936   Bmp4
    149   TRCN0000025957   Bmp4
  32   150   TRCN0000022619   Bmpr1a
    151   TRCN0000022620   Bmpr1a
    152   TRCN0000022621   Bmpr1a
    153   TRCN0000022622   Bmpr1a
    154   TRCN0000022623   Bmpr1a
  33   155   TRCN0000022529   Bmpr2
    156   TRCN0000022530   Bmpr2
    157   TRCN0000022531   Bmpr2
    158   TRCN0000022532   Bmpr2
    159   TRCN0000022533   Bmpr2
  34   160   TRCN0000009687   Bnip3
    161   TRCN0000009688   Bnip3
    162   TRCN0000009689   Bnip3
    163   TRCN0000009690   Bnip3
    164   TRCN0000009691   Bnip3
  35   165   TRCN0000022589   Braf
    166   TRCN0000022590   Braf
    167   TRCN0000022591   Braf
    168   TRCN0000022592   Braf
    169   TRCN0000022593   Braf
  36   170   TRCN0000042558   Brca1
    171   TRCN0000042559   Brca1
    172   TRCN0000042560   Brca1
    173   TRCN0000042561   Brca1
    174   TRCN0000042562   Brca1
  37   175   TRCN0000071008   Brca2
    176   TRCN0000071009   Brca2
    177   TRCN0000071010   Brca2
    178   TRCN0000071011   Brca2
    179   TRCN0000071012   Brca2
  38   180   TRCN0000103285   C130053K05Rik
    181   TRCN0000103286   C130053K05Rik
    182   TRCN0000103287   C130053K05Rik
    183   TRCN0000103288   C130053K05Rik
    184   TRCN0000103289   C130053K05Rik
  39   185   TRCN0000024114   Camk1d
    186   TRCN0000024115   Camk1d
    187   TRCN0000024116   Camk1d
    188   TRCN0000024117   Camk1d
    189   TRCN0000024118   Camk1d
  40   190   TRCN0000114461   Car2
    191   TRCN0000114462   Car2
    192   TRCN0000114463   Car2
    193   TRCN0000114464   Car2
    194   TRCN0000114465   Car2
  41   195   TRCN0000012243   Casp8
    196   TRCN0000012244   Casp8
    197   TRCN0000012245   Casp8
    198   TRCN0000012246   Casp8
    199   TRCN0000012247   Casp8
  42   200   TRCN0000042568   Cbl
    201   TRCN0000042569   Cbl
    202   TRCN0000042570   Cbl
    203   TRCN0000042571   Cbl
    204   TRCN0000042572   Cbl
  43   205   TRCN0000071028   Cbx1
    206   TRCN0000071029   Cbx1
    207   TRCN0000071030   Cbx1
    208   TRCN0000071031   Cbx1
    209   TRCN0000071032   Cbx1
  44   210   TRCN0000071048   Cbx5
    211   TRCN0000071049   Cbx5
    212   TRCN0000071050   Cbx5
    213   TRCN0000071051   Cbx5
    214   TRCN0000071052   Cbx5
  45   215   TRCN0000176503   Ccdc39
    216   TRCN0000176967   Ccdc39
    217   TRCN0000177337   Ccdc39
    218   TRCN0000182114   Ccdc39
    219   TRCN0000182268   Ccdc39
  46   220   TRCN0000011978   Ccnd3
    221   TRCN0000011979   Ccnd3
    222   TRCN0000011980   Ccnd3
    223   TRCN0000011981   Ccnd3
  47   224   TRCN0000119627   Cd320
    225   TRCN0000119629   Cd320
    226   TRCN0000119630   Cd320
    227   TRCN0000119631   Cd320
  48   228   TRCN0000065353   Cd44
    229   TRCN0000065354   Cd44
    230   TRCN0000065355   Cd44
    231   TRCN0000065356   Cd44
    232   TRCN0000065357   Cd44
  49   233   TRCN0000030109   Cdc14b
    234   TRCN0000030110   Cdc14b
    235   TRCN0000030111   Cdc14b
    236   TRCN0000030112   Cdc14b
    237   TRCN0000030113   Cdc14b
  50   238   TRCN0000042578   Cdh1
    239   TRCN0000042579   Cdh1
    240   TRCN0000042580   Cdh1
    241   TRCN0000042581   Cdh1
    242   TRCN0000042582   Cdh1
  51   243   TRCN0000094534   Cdh12
    244   TRCN0000094535   Cdh12
    245   TRCN0000094536   Cdh12
    246   TRCN0000094537   Cdh12
    247   TRCN0000094538   Cdh12
  52   248   TRCN0000094729   Cdh4
    249   TRCN0000094730   Cdh4
    250   TRCN0000094731   Cdh4
    251   TRCN0000094732   Cdh4
    252   TRCN0000094733   Cdh4
  53   253   TRCN0000094894   Cdh5
    254   TRCN0000094895   Cdh5
    255   TRCN0000094896   Cdh5
    256   TRCN0000094897   Cdh5
    257   TRCN0000094898   Cdh5
  54   258   TRCN0000094784   Cdh7
    259   TRCN0000094785   Cdh7
    260   TRCN0000094786   Cdh7
    261   TRCN0000094787   Cdh7
    262   TRCN0000094788   Cdh7
  55   263   TRCN0000023174   Cdk4
    264   TRCN0000023175   Cdk4
    265   TRCN0000023176   Cdk4
    266   TRCN0000023177   Cdk4
    267   TRCN0000023178   Cdk4
  56   268   TRCN0000042583   Cdkn1a
    269   TRCN0000042585   Cdkn1a
    270   TRCN0000042586   Cdkn1a
    271   TRCN0000042587   Cdkn1a
    272   TRCN0000054898   Cdkn1a
    273   TRCN0000054899   Cdkn1a
    274   TRCN0000054900   Cdkn1a
    275   TRCN0000054901   Cdkn1a
    276   TRCN0000054902   Cdkn1a
  57   277   TRCN0000071063   Cdkn1b
    278   TRCN0000071064   Cdkn1b
    279   TRCN0000071066   Cdkn1b
    280   TRCN0000071067   Cdkn1b
  58   281   TRCN0000042588   Cdkn1c
    282   TRCN0000042589   Cdkn1c
    283   TRCN0000042590   Cdkn1c
    284   TRCN0000042592   Cdkn1c
  59   285   TRCN0000077813   Cdkn2a
    286   TRCN0000077815   Cdkn2a
    287   TRCN0000077816   Cdkn2a
  60   288   TRCN0000042598   Cdkn2b
    289   TRCN0000042599   Cdkn2b
    290   TRCN0000042600   Cdkn2b
    291   TRCN0000042601   Cdkn2b
    292   TRCN0000042602   Cdkn2b
  61   293   TRCN0000085088   Cdkn2d
    294   TRCN0000085089   Cdkn2d
    295   TRCN0000085090   Cdkn2d
    296   TRCN0000085091   Cdkn2d
    297   TRCN0000085092   Cdkn2d
  62   298   TRCN0000071654   Cebpd
    299   TRCN0000071655   Cebpd
    300   TRCN0000071657   Cebpd
  63   301   TRCN0000094949   Celsr3
    302   TRCN0000094950   Celsr3
    303   TRCN0000094951   Celsr3
    304   TRCN0000094952   Celsr3
    305   TRCN0000094953   Celsr3
  64   306   TRCN0000179809   Cep55
    307   TRCN0000182908   Cep55
    308   TRCN0000183083   Cep55
    309   TRCN0000183560   Cep55
  65   310   TRCN0000012648   Chek1
    311   TRCN0000012649   Chek1
    312   TRCN0000012650   Chek1
    313   TRCN0000012651   Chek1
    314   TRCN0000012652   Chek1
  66   315   TRCN0000012653   Chek2
    316   TRCN0000012654   Chek2
    317   TRCN0000012655   Chek2
    318   TRCN0000012656   Chek2
    319   TRCN0000012657   Chek2
  67   320   TRCN0000103290   Chpt1
    321   TRCN0000103292   Chpt1
    322   TRCN0000103293   Chpt1
    323   TRCN0000103294   Chpt1
  68   324   TRCN0000025883   Chrd
    325   TRCN0000025906   Chrd
    326   TRCN0000025914   Chrd
    327   TRCN0000025932   Chrd
    328   TRCN0000025944   Chrd
  69   329   TRCN0000012348   Chuk
    330   TRCN0000012349   Chuk
    331   TRCN0000012350   Chuk
    332   TRCN0000012351   Chuk
    333   TRCN0000012352   Chuk
  70   334   TRCN0000069708   Clca2
    335   TRCN0000069709   Clca2
    336   TRCN0000069710   Clca2
    337   TRCN0000069711   Clca2
    338   TRCN0000069712   Clca2
  71   339   TRCN0000069738   Clic1
    340   TRCN0000069739   Clic1
    341   TRCN0000069740   Clic1
    342   TRCN0000069741   Clic1
  72   343   TRCN0000023189   Clk3
    344   TRCN0000023190   Clk3
    345   TRCN0000023191   Clk3
    346   TRCN0000023192   Clk3
    347   TRCN0000023193   Clk3
  73   348   TRCN0000023194   Clk4
    349   TRCN0000023195   Clk4
    350   TRCN0000023196   Clk4
    351   TRCN0000023197   Clk4
    352   TRCN0000023198   Clk4
  74   353   TRCN0000094734   Clstn2
    354   TRCN0000094735   Clstn2
    355   TRCN0000094736   Clstn2
    356   TRCN0000094737   Clstn2
    357   TRCN0000094738   Clstn2
  75   358   TRCN0000039014   Cntn1
    359   TRCN0000039015   Cntn1
    360   TRCN0000039016   Cntn1
    361   TRCN0000039017   Cntn1
    362   TRCN0000039018   Cntn1
  76   363   TRCN0000113645   Cntn3
    364   TRCN0000113646   Cntn3
    365   TRCN0000113647   Cntn3
    366   TRCN0000113648   Cntn3
    367   TRCN0000113649   Cntn3
  77   368   TRCN0000094359   Cntnap1
    369   TRCN0000094360   Cntnap1
    370   TRCN0000094361   Cntnap1
    371   TRCN0000094362   Cntnap1
    372   TRCN0000094363   Cntnap1
  78   373   TRCN0000094969   Cntnap2
    374   TRCN0000094970   Cntnap2
    375   TRCN0000094971   Cntnap2
    376   TRCN0000094972   Cntnap2
    377   TRCN0000094973   Cntnap2
  79   378   TRCN0000094539   Cntnap4
    379   TRCN0000094540   Cntnap4
  80   380   TRCN0000090503   Col1a1
    381   TRCN0000090504   Col1a1
    382   TRCN0000090505   Col1a1
    383   TRCN0000090506   Col1a1
    384   TRCN0000090507   Col1a1
  81   385   TRCN0000090043   Col1a2
    386   TRCN0000090044   Col1a2
    387   TRCN0000090045   Col1a2
    388   TRCN0000090046   Col1a2
    389   TRCN0000090047   Col1a2
  82   390   TRCN0000091163   Col22a1
    391   TRCN0000091164   Col22a1
    392   TRCN0000091165   Col22a1
    393   TRCN0000091166   Col22a1
    394   TRCN0000091167   Col22a1
  83   395   TRCN0000091483   Col3a1
    396   TRCN0000091484   Col3a1
    397   TRCN0000091485   Col3a1
    398   TRCN0000091486   Col3a1
    399   TRCN0000091487   Col3a1
  84   400   TRCN0000031319   Cpxm2
    401   TRCN0000031320   Cpxm2
    402   TRCN0000031321   Cpxm2
    403   TRCN0000031322   Cpxm2
    404   TRCN0000031323   Cpxm2
  85   405   TRCN0000105235   Crabp2
    406   TRCN0000105236   Crabp2
    407   TRCN0000105237   Crabp2
    408   TRCN0000105238   Crabp2
    409   TRCN0000105239   Crabp2
  86   410   TRCN0000042603   Crk
    411   TRCN0000042604   Crk
    412   TRCN0000042606   Crk
    413   TRCN0000042607   Crk
  87   414   TRCN0000023734   Csk
    415   TRCN0000023735   Csk
    416   TRCN0000023736   Csk
    417   TRCN0000023737   Csk
    418   TRCN0000023738   Csk
  88   419   TRCN0000087303   Csmd3
    420   TRCN0000087304   Csmd3
    421   TRCN0000087305   Csmd3
    422   TRCN0000087306   Csmd3
    423   TRCN0000087307   Csmd3
  89   424   TRCN0000080278   Cst6
    425   TRCN0000080279   Cst6
    426   TRCN0000080280   Cst6
    427   TRCN0000080281   Cst6
    428   TRCN0000080282   Cst6
  90   429   TRCN0000039019   Ctcf
    430   TRCN0000039020   Ctcf
    431   TRCN0000039021   Ctcf
    432   TRCN0000039022   Ctcf
    433   TRCN0000039023   Ctcf
  91   434   TRCN0000109665   Ctgf
    435   TRCN0000109666   Ctgf
    436   TRCN0000109667   Ctgf
    437   TRCN0000109668   Ctgf
    438   TRCN0000109669   Ctgf
  92   439   TRCN0000065368   Cxcl14
    440   TRCN0000065369   Cxcl14
    441   TRCN0000065370   Cxcl14
    442   TRCN0000065371   Cxcl14
    443   TRCN0000065372   Cxcl14
  93   444   TRCN0000067258   Cxcl2
    445   TRCN0000067259   Cxcl2
    446   TRCN0000067260   Cxcl2
    447   TRCN0000067261   Cxcl2
  94   448   TRCN0000028678   Cxcr4
    449   TRCN0000028704   Cxcr4
    450   TRCN0000028724   Cxcr4
    451   TRCN0000028749   Cxcr4
    452   TRCN0000028750   Cxcr4
  95   453   TRCN0000125700   Cyp4f16
    454   TRCN0000125701   Cyp4f16
    455   TRCN0000125702   Cyp4f16
    456   TRCN0000125703   Cyp4f16
  96   457   TRCN0000103750   Ddx3x
    458   TRCN0000103751   Ddx3x
    459   TRCN0000103752   Ddx3x
    460   TRCN0000103753   Ddx3x
    461   TRCN0000103754   Ddx3x
  97   462   TRCN0000099475   Defb6
    463   TRCN0000099476   Defb6
    464   TRCN0000099477   Defb6
    465   TRCN0000099478   Defb6
  98   466   TRCN0000028845   Dll1
    467   TRCN0000028864   Dll1
    468   TRCN0000028865   Dll1
    469   TRCN0000028890   Dll1
    470   TRCN0000028910   Dll1
  99   471   TRCN0000028875   Dll3
    472   TRCN0000028879   Dll3
    473   TRCN0000028896   Dll3
    474   TRCN0000028907   Dll3
    475   TRCN0000028924   Dll3
  100   476   TRCN0000028894   Dll4
    477   TRCN0000028916   Dll4
    478   TRCN0000028928   Dll4
  101   479   TRCN0000070598   Dlx2
    480   TRCN0000070599   Dlx2
    481   TRCN0000070600   Dlx2
    482   TRCN0000070601   Dlx2
    483   TRCN0000070602   Dlx2
  102   484   TRCN0000070608   Dlx3
    485   TRCN0000070609   Dlx3
    486   TRCN0000070610   Dlx3
    487   TRCN0000070611   Dlx3
    488   TRCN0000070612   Dlx3
  103   489   TRCN0000070628   Dlx5
    490   TRCN0000070629   Dlx5
    491   TRCN0000070630   Dlx5
    492   TRCN0000070632   Dlx5
  104   493   TRCN0000086488   Dmrta2
    494   TRCN0000086489   Dmrta2
    495   TRCN0000086490   Dmrta2
    496   TRCN0000086491   Dmrta2
  105   497   TRCN0000008562   Dnajb9
    498   TRCN0000008563   Dnajb9
    499   TRCN0000008564   Dnajb9
    500   TRCN0000008565   Dnajb9
    501   TRCN0000008566   Dnajb9
  106   502   TRCN0000039024   Dnmt1
    503   TRCN0000039025   Dnmt1
    504   TRCN0000039026   Dnmt1
    505   TRCN0000039027   Dnmt1
    506   TRCN0000039028   Dnmt1
  107   507   TRCN0000039029   Dnmt2
    508   TRCN0000039030   Dnmt2
    509   TRCN0000039031   Dnmt2
    510   TRCN0000039032   Dnmt2
    511   TRCN0000039033   Dnmt2
  108   512   TRCN0000039034   Dnmt3a
    513   TRCN0000039035   Dnmt3a
    514   TRCN0000039036   Dnmt3a
    515   TRCN0000039037   Dnmt3a
    516   TRCN0000039038   Dnmt3a
  109   517   TRCN0000039104   Dnmt31
    518   TRCN0000039105   Dnmt31
    519   TRCN0000039106   Dnmt31
    520   TRCN0000039107   Dnmt31
    521   TRCN0000039108   Dnmt31
  110   522   TRCN0000054348   Dusp4
    523   TRCN0000054349   Dusp4
    524   TRCN0000054350   Dusp4
    525   TRCN0000054351   Dusp4
    526   TRCN0000054352   Dusp4
  111   527   TRCN0000023479   Egfr
    528   TRCN0000023480   Egfr
    529   TRCN0000023481   Egfr
    530   TRCN0000023482   Egfr
    531   TRCN0000023483   Egfr
    532   TRCN0000055218   Egfr
    533   TRCN0000055219   Egfr
    534   TRCN0000055220   Egfr
    535   TRCN0000055221   Egfr
    536   TRCN0000055222   Egfr
  112   537   TRCN0000009749   Egln3
    538   TRCN0000009750   Egln3
    539   TRCN0000009751   Egln3
    540   TRCN0000009752   Egln3
    541   TRCN0000009753   Egln3
  113   542   TRCN0000081623   Egr1
    543   TRCN0000081624   Egr1
    544   TRCN0000081625   Egr1
    545   TRCN0000081626   Egr1
    546   TRCN0000081627   Egr1
  114   547   TRCN0000081678   Egr2
    548   TRCN0000081679   Egr2
    549   TRCN0000081680   Egr2
    550   TRCN0000081681   Egr2
    551   TRCN0000081682   Egr2
  115   552   TRCN0000081788   Ehf
    553   TRCN0000081789   Ehf
    554   TRCN0000081790   Ehf
    555   TRCN0000081791   Ehf
    556   TRCN0000081792   Ehf
  116   557   TRCN0000081938   Elf5
    558   TRCN0000081939   Elf5
    559   TRCN0000081940   Elf5
    560   TRCN0000081941   Elf5
    561   TRCN0000081942   Elf5
  117   562   TRCN0000042643   Elk3
    563   TRCN0000042644   Elk3
    564   TRCN0000042645   Elk3
    565   TRCN0000042646   Elk3
    566   TRCN0000042647   Elk3
  118   567   TRCN0000023679   Epha7
    568   TRCN0000023680   Epha7
    569   TRCN0000023681   Epha7
    570   TRCN0000023682   Epha7
    571   TRCN0000023683   Epha7
  119   572   TRCN0000092273   Eps8
    573   TRCN0000092274   Eps8
    574   TRCN0000092275   Eps8
    575   TRCN0000092276   Eps8
    576   TRCN0000092277   Eps8
  120   577   TRCN0000190945   Esm1
    578   TRCN0000192471   Esm1
    579   TRCN0000192502   Esm1
    580   TRCN0000192617   Esm1
  121   581   TRCN0000026176   Esr1
    582   TRCN0000026184   Esr1
    583   TRCN0000026197   Esr1
    584   TRCN0000026201   Esr1
    585   TRCN0000026214   Esr1
  122   586   TRCN0000026150   Esr2
    587   TRCN0000026170   Esr2
    588   TRCN0000026192   Esr2
    589   TRCN0000026215   Esr2
  123   590   TRCN0000111725   Exoc4
    591   TRCN0000111726   Exoc4
    592   TRCN0000111727   Exoc4
    593   TRCN0000111728   Exoc4
    594   TRCN0000111729   Exoc4
  124   595   TRCN0000095694   Ezh1
    596   TRCN0000095695   Ezh1
    597   TRCN0000095696   Ezh1
    598   TRCN0000095697   Ezh1
    599   TRCN0000095698   Ezh1
  125   600   TRCN0000039039   Ezh2
    601   TRCN0000039040   Ezh2
    602   TRCN0000039041   Ezh2
    603   TRCN0000039042   Ezh2
    604   TRCN0000039043   Ezh2
  126   605   TRCN0000105190   Fabp3
    606   TRCN0000105191   Fabp3
    607   TRCN0000105192   Fabp3
    608   TRCN0000105193   Fabp3
    609   TRCN0000105194   Fabp3
  127   610   TRCN0000105185   Fabp4
    611   TRCN0000105186   Fabp4
    612   TRCN0000105187   Fabp4
    613   TRCN0000105188   Fabp4
    614   TRCN0000105189   Fabp4
  128   615   NM_010634.1-149s1c1   Fabp5
    616   NM_010634.1-592s1c1   Fabp5
    617   TRCN0000011894   Fabp5
    618   TRCN0000011896   Fabp5
    619   TRCN0000011897   Fabp5
  129   620   TRCN0000114336   Fads2
    621   TRCN0000114337   Fads2
    622   TRCN0000114338   Fads2
    623   TRCN0000114340   Fads2
  130   624   TRCN0000173476   Fancm
    625   TRCN0000173798   Fancm
    626   TRCN0000175001   Fancm
    627   TRCN0000176065   Fancm
    628   TRCN0000176066   Fancm
  131   629   TRCN0000094844   Fath
    630   TRCN0000094845   Fath
    631   TRCN0000094846   Fath
    632   TRCN0000094847   Fath
    633   TRCN0000094848   Fath
  132   634   TRCN0000012828   Fbxw7
    635   TRCN0000012829   Fbxw7
    636   TRCN0000012830   Fbxw7
    637   TRCN0000012831   Fbxw7
    638   TRCN0000012832   Fbxw7
  133   639   TRCN0000004653   Ffar1
    640   TRCN0000004654   Ffar1
    641   TRCN0000004655   Ffar1
  134   642   TRCN0000009606   Flt1
    643   TRCN0000009607   Flt1
    644   TRCN0000009608   Flt1
    645   TRCN0000009609   Flt1
    646   TRCN0000009610   Flt1
  135   647   TRCN0000023739   Flt3
    648   TRCN0000023740   Flt3
    649   TRCN0000023741   Flt3
    650   TRCN0000023742   Flt3
    651   TRCN0000023743   Flt3
  136   652   TRCN0000023754   Flt4
    653   TRCN0000023755   Flt4
    654   TRCN0000023756   Flt4
    655   TRCN0000023757   Flt4
    656   TRCN0000023758   Flt4
  137   657   TRCN0000120512   Fmn2
    658   TRCN0000120513   Fmn2
    659   TRCN0000120514   Fmn2
    660   TRCN0000120515   Fmn2
    661   TRCN0000120516   Fmn2
  138   662   TRCN0000084288   Foxj2
    663   TRCN0000084289   Foxj2
    664   TRCN0000084290   Foxj2
    665   TRCN0000084291   Foxj2
    666   TRCN0000084292   Foxj2
  139   667   TRCN0000072003   Foxp1
    668   TRCN0000072004   Foxp1
    669   TRCN0000072005   Foxp1
    670   TRCN0000072006   Foxp1
    671   TRCN0000072007   Foxp1
  140   672   TRCN0000108925   Fscn1
    673   TRCN0000108926   Fscn1
    674   TRCN0000108927   Fscn1
    675   TRCN0000108928   Fscn1
    676   TRCN0000108929   Fscn1
  141   677   TRCN0000085478   Gata3
    678   TRCN0000085479   Gata3
    679   TRCN0000085480   Gata3
    680   TRCN0000085481   Gata3
    681   TRCN0000085482   Gata3
  142   682   TRCN0000068823   Gjb5
    683   TRCN0000068824   Gjb5
    684   TRCN0000068825   Gjb5
    685   TRCN0000068826   Gjb5
    686   TRCN0000068827   Gjb5
  143   687   TRCN0000027955   Gpr56
    688   TRCN0000027962   Gpr56
    689   TRCN0000027970   Gpr56
    690   TRCN0000027988   Gpr56
    691   TRCN0000027999   Gpr56
  144   692   TRCN0000076528   Gpx2
    693   TRCN0000076529   Gpx2
    694   TRCN0000076530   Gpx2
    695   TRCN0000076531   Gpx2
    696   TRCN0000076532   Gpx2
  145   697   TRCN0000103545   Grhl3
    698   TRCN0000103546   Grhl3
    699   TRCN0000103547   Grhl3
    700   TRCN0000103548   Grhl3
    701   TRCN0000103549   Grhl3
  146   702   TRCN0000103040   Grid1
    703   TRCN0000103041   Grid1
    704   TRCN0000103042   Grid1
    705   TRCN0000103043   Grid1
    706   TRCN0000103044   Grid1
  147   707   TRCN0000012613   Gsk3b
    708   TRCN0000012614   Gsk3b
    709   TRCN0000012615   Gsk3b
    710   TRCN0000012616   Gsk3b
    711   TRCN0000012617   Gsk3b
  148   712   TRCN0000103310   Gsta1
    713   TRCN0000103311   Gsta1
    714   TRCN0000103312   Gsta1
    715   TRCN0000103313   Gsta1
    716   TRCN0000103314   Gsta1
  149   717   TRCN0000103295   Gsta2
    718   TRCN0000103296   Gsta2
    719   TRCN0000103297   Gsta2
    720   TRCN0000103298   Gsta2
    721   TRCN0000103299   Gsta2
  150   722   TRCN0000103280   Gsta3
    723   TRCN0000103281   Gsta3
    724   TRCN0000103282   Gsta3
    725   TRCN0000103283   Gsta3
    726   TRCN0000103284   Gsta3
  151   727   TRCN0000103430   Gsta4
    728   TRCN0000103431   Gsta4
    729   TRCN0000103432   Gsta4
    730   TRCN0000103433   Gsta4
    731   TRCN0000103434   Gsta4
  152   732   TRCN0000103240   Gstm1
    733   TRCN0000103241   Gstm1
    734   TRCN0000103242   Gstm1
    735   TRCN0000103243   Gstm1
    736   TRCN0000103244   Gstm1
  153   737   TRCN0000103160   Gstm2
    738   TRCN0000103161   Gstm2
    739   TRCN0000103162   Gstm2
    740   TRCN0000103163   Gstm2
    741   TRCN0000103164   Gstm2
  154   742   TRCN0000028854   Hes1
    743   TRCN0000028855   Hes1
    744   TRCN0000028881   Hes1
    745   TRCN0000028925   Hes1
    746   TRCN0000028927   Hes1
  155   747   TRCN0000096954   Hist1h2bh
    748   TRCN0000096955   Hist1h2bh
    749   TRCN0000096956   Hist1h2bh
    750   TRCN0000096957   Hist1h2bh
    751   TRCN0000096958   Hist1h2bh
  156   752   TRCN0000126044   Hmga2
    753   TRCN0000126045   Hmga2
    754   TRCN0000126046   Hmga2
    755   TRCN0000126047   Hmga2
    756   TRCN0000126048   Hmga2
  157   757   TRCN0000075583   Hmgb2
    758   TRCN0000075584   Hmgb2
    759   TRCN0000075585   Hmgb2
    760   TRCN0000075586   Hmgb2
    761   TRCN0000075587   Hmgb2
  158   762   TRCN0000070789   Hoxa4
    763   TRCN0000070790   Hoxa4
    764   TRCN0000070791   Hoxa4
    765   TRCN0000070792   Hoxa4
  159   766   TRCN0000012518   Hoxa5
    767   TRCN0000012519   Hoxa5
    768   TRCN0000012520   Hoxa5
    769   TRCN0000012521   Hoxa5
    770   TRCN0000012522   Hoxa5
  160   771   TRCN0000070863   Hoxb6
    772   TRCN0000070864   Hoxb6
    773   TRCN0000070865   Hoxb6
    774   TRCN0000070866   Hoxb6
    775   TRCN0000070867   Hoxb6
  161   776   TRCN0000070888   Hoxb9
    777   TRCN0000070889   Hoxb9
    778   TRCN0000070890   Hoxb9
    779   TRCN0000070891   Hoxb9
    780   TRCN0000070892   Hoxb9
  162   781   TRCN0000070908   Hoxc13
    782   TRCN0000070909   Hoxc13
    783   TRCN0000070910   Hoxc13
    784   TRCN0000070911   Hoxc13
  163   785   TRCN0000070938   Hoxc6
    786   TRCN0000070939   Hoxc6
    787   TRCN0000070940   Hoxc6
    788   TRCN0000070941   Hoxc6
    789   TRCN0000070942   Hoxc6
  164   790   TRCN0000070948   Hoxc8
    791   TRCN0000070949   Hoxc8
    792   TRCN0000070950   Hoxc8
    793   TRCN0000070951   Hoxc8
  165   794   TRCN0000070468   Hoxd9
    795   TRCN0000070469   Hoxd9
    796   TRCN0000070470   Hoxd9
    797   TRCN0000070471   Hoxd9
    798   TRCN0000070472   Hoxd9
  166   799   TRCN0000034379   Hras1
    800   TRCN0000034380   Hras1
    801   TRCN0000034381   Hras1
    802   TRCN0000034382   Hras1
    803   TRCN0000034383   Hras1
  167   804   TRCN0000071433   Id1
    805   TRCN0000071435   Id1
    806   TRCN0000071437   Id1
  168   807   TRCN0000071438   Id3
    808   TRCN0000071439   Id3
    809   TRCN0000071440   Id3
    810   TRCN0000071444   Id4
  169   811   TRCN0000023489   Igf1r
    812   TRCN0000023490   Igf1r
    813   TRCN0000023491   Igf1r
    814   TRCN0000023492   Igf1r
    815   TRCN0000023493   Igf1r
  170   816   TRCN0000096759   Igf2bp2
    817   TRCN0000096760   Igf2bp2
    818   TRCN0000096761   Igf2bp2
    819   TRCN0000096762   Igf2bp2
    820   TRCN0000096763   Igf2bp2
  171   821   TRCN0000012858   Igfbp2
    822   TRCN0000012859   Igfbp2
    823   TRCN0000012860   Igfbp2
    824   TRCN0000012861   Igfbp2
    825   TRCN0000012862   Igfbp2
  172   826   TRCN0000026867   Ikbkb
    827   TRCN0000026891   Ikbkb
    828   TRCN0000026894   Ikbkb
    829   TRCN0000026913   Ikbkb
    830   TRCN0000026945   Ikbkb
  173   831   TRCN0000088808   Ikbkg
    832   TRCN0000088809   Ikbkg
    833   TRCN0000088810   Ikbkg
    834   TRCN0000088811   Ikbkg
    835   TRCN0000088812   Ikbkg
  174   836   TRCN0000068248   Il1r2
    837   TRCN0000068249   Il1r2
    838   TRCN0000068250   Il1r2
    839   TRCN0000068251   Il1r2
    840   TRCN0000068252   Il1r2
  175   841   TRCN0000085328   Irf6
    842   TRCN0000085329   Irf6
    843   TRCN0000085330   Irf6
    844   TRCN0000085331   Irf6
    845   TRCN0000085332   Irf6
  176   846   TRCN0000070478   Irx1
    847   TRCN0000070479   Irx1
    848   TRCN0000070480   Irx1
    849   TRCN0000070481   Irx1
    850   TRCN0000070482   Irx1
  177   851   TRCN0000070403   Irx4
    852   TRCN0000070404   Irx4
    853   TRCN0000070405   Irx4
    854   TRCN0000070406   Irx4
    855   TRCN0000070407   Irx4
  178   856   TRCN0000070418   Irx5
    857   TRCN0000070419   Irx5
    858   TRCN0000070420   Irx5
    859   TRCN0000070421   Irx5
    860   TRCN0000070422   Irx5
  179   861   TRCN0000028850   Jag1
    862   TRCN0000028860   Jag1
    863   TRCN0000028869   Jag1
    864   TRCN0000028887   Jag1
    865   TRCN0000028933   Jag1
  180   866   TRCN0000028871   Jag2
    867   TRCN0000028877   Jag2
    868   TRCN0000028897   Jag2
    869   TRCN0000028906   Jag2
  181   870   TRCN0000075548   Jub
    871   TRCN0000075549   Jub
    872   TRCN0000075550   Jub
    873   TRCN0000075551   Jub
    874   TRCN0000075552   Jub
  182   875   TRCN0000055203   Jun
    876   TRCN0000055204   Jun
    877   TRCN0000055205   Jun
    878   TRCN0000055206   Jun
    879   TRCN0000055207   Jun
  183   880   TRCN0000069668   Kctd8
    881   TRCN0000069669   Kctd8
    882   TRCN0000069670   Kctd8
    883   TRCN0000069671   Kctd8
    884   TRCN0000069672   Kctd8
  184   885   TRCN0000023744   Kdr
    886   TRCN0000023745   Kdr
    887   TRCN0000023746   Kdr
    888   TRCN0000023747   Kdr
    889   TRCN0000023748   Kdr
  185   890   TRCN0000071468   Klf15
    891   TRCN0000071469   Klf15
    892   TRCN0000071470   Klf15
    893   TRCN0000071471   Klf15
    894   TRCN0000071472   Klf15
  186   895   TRCN0000075558   Klf3
    896   TRCN0000075559   Klf3
    897   TRCN0000075560   Klf3
    898   TRCN0000075561   Klf3
    899   TRCN0000075562   Klf3
  187   900   TRCN0000034384   Kras
    901   TRCN0000034385   Kras
    902   TRCN0000034386   Kras
    903   TRCN0000034387   Kras
    904   TRCN0000034388   Kras
  188   905   TRCN0000022524   Ksr1
    906   TRCN0000022525   Ksr1
    907   TRCN0000022527   Ksr1
    908   TRCN0000022528   Ksr1
  189   909   TRCN0000022594   Ksr2
    910   TRCN0000022595   Ksr2
    911   TRCN0000022596   Ksr2
    912   TRCN0000022597   Ksr2
    913   TRCN0000022598   Ksr2
  190   914   TRCN0000075563   Lasp1
    915   TRCN0000075564   Lasp1
    916   TRCN0000075565   Lasp1
    917   TRCN0000075566   Lasp1
    918   TRCN0000075567   Lasp1
  191   919   TRCN0000022704   Lats2
    920   TRCN0000022705   Lats2
    921   TRCN0000022706   Lats2
    922   TRCN0000022707   Lats2
    923   TRCN0000022708   Lats2
  192   924   TRCN0000012673   Lef1
    925   TRCN0000012674   Lef1
    926   TRCN0000012675   Lef1
    927   TRCN0000012676   Lef1
    928   TRCN0000012677   Lef1
  193   929   TRCN0000067908   Lefty1
    930   TRCN0000067909   Lefty1
    931   TRCN0000067911   Lefty1
    932   TRCN0000067912   Lefty1
  194   933   TRCN0000070533   Lhx2
    934   TRCN0000070534   Lhx2
    935   TRCN0000070535   Lhx2
    936   TRCN0000070536   Lhx2
    937   TRCN0000070537   Lhx2
  195   938   TRCN0000095669   Limd1
    939   TRCN0000095670   Limd1
    940   TRCN0000095671   Limd1
    941   TRCN0000095672   Limd1
    942   TRCN0000095673   Limd1
  196   943   TRCN0000084373   Lmo4
    944   TRCN0000084374   Lmo4
    945   TRCN0000084375   Lmo4
    946   TRCN0000084376   Lmo4
    947   TRCN0000084377   Lmo4
  197   948   TRCN0000070438   Lmx1a
    949   TRCN0000070439   Lmx1a
    950   TRCN0000070440   Lmx1a
    951   TRCN0000070441   Lmx1a
    952   TRCN0000070442   Lmx1a
  198   953   TRCN0000119622   Lrp1
    954   TRCN0000119623   Lrp1
    955   TRCN0000119624   Lrp1
    956   TRCN0000119625   Lrp1
    957   TRCN0000119626   Lrp1
  199   958   TRCN0000119607   Lrp1b
    959   TRCN0000119608   Lrp1b
    960   TRCN0000119609   Lrp1b
    961   TRCN0000119610   Lrp1b
    962   TRCN0000119611   Lrp1b
  200   963   TRCN0000119632   Lrp4
    964   TRCN0000119633   Lrp4
    965   TRCN0000119634   Lrp4
    966   TRCN0000119635   Lrp4
    967   TRCN0000119636   Lrp4
  201   968   TRCN0000109360   Lrp6
    969   TRCN0000109361   Lrp6
    970   TRCN0000109362   Lrp6
    971   TRCN0000109363   Lrp6
    972   TRCN0000109364   Lrp6
  202   973   TRCN0000108455   Lrrc4c
    974   TRCN0000108456   Lrrc4c
    975   TRCN0000108457   Lrrc4c
    976   TRCN0000108458   Lrrc4c
    977   TRCN0000108459   Lrrc4c
  203   978   TRCN0000102225   Lrrfip1
    979   TRCN0000102226   Lrrfip1
    980   TRCN0000102227   Lrrfip1
    981   TRCN0000102229   Lrrfip1
  204   982   TRCN0000189740   Ly6g6c
    983   TRCN0000190117   Ly6g6c
    984   TRCN0000193012   Ly6g6c
    985   TRCN0000202432   Ly6g6c
  205   986   TRCN0000012608   Map2k7
    987   TRCN0000012609   Map2k7
    988   TRCN0000012610   Map2k7
    989   TRCN0000012611   Map2k7
    990   TRCN0000012612   Map2k7
  206   991   TRCN0000012763   Map3k14
    992   TRCN0000012764   Map3k14
    993   TRCN0000012765   Map3k14
    994   TRCN0000012766   Map3k14
    995   TRCN0000012767   Map3k14
  207   996   TRCN0000012758   Map4k1
    997   TRCN0000012759   Map4k1
    998   TRCN0000012761   Map4k1
    999   TRCN0000012762   Map4k1
  208   1000   TRCN0000055223   Mapk14
    1001   TRCN0000055224   Mapk14
    1002   TRCN0000055225   Mapk14
    1003   TRCN0000055226   Mapk14
    1004   TRCN0000055227   Mapk14
  209   1005   TRCN0000023184   Mapk3
    1006   TRCN0000023185   Mapk3
    1007   TRCN0000023186   Mapk3
    1008   TRCN0000023187   Mapk3
    1009   TRCN0000023188   Mapk3
  210   1010   TRCN0000023179   Mapk4
    1011   TRCN0000023180   Mapk4
    1012   TRCN0000023181   Mapk4
    1013   TRCN0000023182   Mapk4
    1014   TRCN0000023183   Mapk4
  211   1015   TRCN0000023199   Mapk6
    1016   TRCN0000023200   Mapk6
    1017   TRCN0000023201   Mapk6
    1018   TRCN0000023202   Mapk6
    1019   TRCN0000023203   Mapk6
  212   1020   TRCN0000012599   Mapk8ip1
    1021   TRCN0000012600   Mapk8ip1
  213   1022   TRCN0000004691   Mcl1
    1023   TRCN0000004692   Mcl1
    1024   TRCN0000004693   Mcl1
    1025   TRCN0000004694   Mcl1
    1026   TRCN0000004695   Mcl1
  214   1027   TRCN0000012068   Mef2c
    1028   TRCN0000012069   Mef2c
    1029   TRCN0000012070   Mef2c
    1030   TRCN0000012071   Mef2c
    1031   TRCN0000012072   Mef2c
  215   1032   TRCN0000012523   Meis1
    1033   TRCN0000012524   Meis1
    1034   TRCN0000012525   Meis1
    1035   TRCN0000012526   Meis1
    1036   TRCN0000012527   Meis1
  216   1037   TRCN0000022599   Mlk1
    1038   TRCN0000022600   Mlk1
    1039   TRCN0000022601   Mlk1
    1040   TRCN0000022602   Mlk1
    1041   TRCN0000022603   Mlk1
  217   1042   TRCN0000034424   Mll1
    1043   TRCN0000034428   Mll1
  218   1044   TRCN0000032834   Mmp16
    1045   TRCN0000032835   Mmp16
    1046   TRCN0000032836   Mmp16
    1047   TRCN0000032837   Mmp16
    1048   TRCN0000032838   Mmp16
  219   1049   TRCN0000071523   Morf4l1
    1050   TRCN0000071524   Morf4l1
    1051   TRCN0000071525   Morf4l1
    1052   TRCN0000071526   Morf4l1
    1053   TRCN0000071527   Morf4l1
  195   1054   TRCN0000012663   Mre11a
    1055   TRCN0000012664   Mre11a
    1056   TRCN0000012665   Mre11a
    1057   TRCN0000012667   Mre11a
  196   1058   TRCN0000070623   Msx1
    1059   TRCN0000070624   Msx1
    1060   TRCN0000070625   Msx1
    1061   TRCN0000070626   Msx1
    1062   TRCN0000070627   Msx1
  197   1063   TRCN0000075943   Mthfd11
    1064   TRCN0000075944   Mthfd11
    1065   TRCN0000075945   Mthfd11
    1066   TRCN0000075946   Mthfd11
    1067   TRCN0000075947   Mthfd11
  198   1068   TRCN0000042513   Myc
    1069   TRCN0000042514   Myc
    1070   TRCN0000042515   Myc
    1071   TRCN0000042516   Myc
    1072   TRCN0000042517   Myc
    1073   TRCN0000054853   Myc
    1074   TRCN0000054854   Myc
    1075   TRCN0000054855   Myc
    1076   TRCN0000054856   Myc
  199   1077   TRCN0000011993   Myef2
    1078   TRCN0000011994   Myef2
    1079   TRCN0000011995   Myef2
    1080   TRCN0000011996   Myef2
    1081   TRCN0000011997   Myef2
  200   1082   TRCN0000071503   Myh9
    1083   TRCN0000071504   Myh9
    1084   TRCN0000071505   Myh9
    1085   TRCN0000071506   Myh9
    1086   TRCN0000071507   Myh9
  201   1087   TRCN0000125409   Nav1
    1088   TRCN0000125410   Nav1
    1089   TRCN0000125411   Nav1
    1090   TRCN0000125412   Nav1
    1091   TRCN0000125413   Nav1
  202   1092   TRCN0000009791   Nedd9
    1093   TRCN0000009792   Nedd9
    1094   TRCN0000009793   Nedd9
    1095   TRCN0000009794   Nedd9
    1096   TRCN0000009795   Nedd9
  203   1097   TRCN0000087559   Neto1
    1098   TRCN0000087560   Neto1
    1099   TRCN0000087561   Neto1
    1100   TRCN0000087562   Neto1
  204   1101   TRCN0000086943   Neto2
    1102   TRCN0000086944   Neto2
    1103   TRCN0000086945   Neto2
    1104   TRCN0000086946   Neto2
    1105   TRCN0000086947   Neto2
  205   1106   TRCN0000034339   Nf1
    1107   TRCN0000034340   Nf1
    1108   TRCN0000034341   Nf1
    1109   TRCN0000034342   Nf1
    1110   TRCN0000034343   Nf1
  206   1111   TRCN0000075343   Nfe2l1
    1112   TRCN0000075344   Nfe2l1
    1113   TRCN0000075345   Nfe2l1
    1114   TRCN0000075346   Nfe2l1
    1115   TRCN0000075347   Nfe2l1
  207   1116   TRCN0000012128   Nfe2l2
    1117   TRCN0000012129   Nfe2l2
    1118   TRCN0000012130   Nfe2l2
    1119   TRCN0000012131   Nfe2l2
    1120   TRCN0000012132   Nfe2l2
    1121   TRCN0000054658   Nfe2l2
    1122   TRCN0000054659   Nfe2l2
    1123   TRCN0000054660   Nfe2l2
    1124   TRCN0000054661   Nfe2l2
    1125   TRCN0000054662   Nfe2l2
  208   1126   TRCN0000012088   Nfib
    1127   TRCN0000012089   Nfib
    1128   TRCN0000012090   Nfib
    1129   TRCN0000012091   Nfib
    1130   TRCN0000012092   Nfib
  209   1131   TRCN0000075348   Nfix
    1132   TRCN0000075349   Nfix
    1133   TRCN0000075350   Nfix
    1134   TRCN0000075351   Nfix
    1135   TRCN0000075352   Nfix
  210   1136   TRCN0000096119   Nfkbia
    1137   TRCN0000096120   Nfkbia
    1138   TRCN0000096121   Nfkbia
    1139   TRCN0000096122   Nfkbia
    1140   TRCN0000096123   Nfkbia
  211   1141   TRCN0000025895   Notch1
    1142   TRCN0000025902   Notch1
    1143   TRCN0000025908   Notch1
    1144   TRCN0000025918   Notch1
    1145   TRCN0000025935   Notch1
  212   1146   TRCN0000012063   Nr1d2
    1147   TRCN0000012064   Nr1d2
    1148   TRCN0000012065   Nr1d2
    1149   TRCN0000012066   Nr1d2
    1150   TRCN0000012067   Nr1d2
  213   1151   TRCN0000034389   Nras
    1152   TRCN0000034390   Nras
    1153   TRCN0000034391   Nras
    1154   TRCN0000034392   Nras
    1155   TRCN0000034393   Nras
  214   1156   TRCN0000025299   Nrk
    1157   TRCN0000025300   Nrk
    1158   TRCN0000025301   Nrk
    1159   TRCN0000025302   Nrk
    1160   TRCN0000025303   Nrk
  215   1161   TRCN0000029859   Nrp1
    1162   TRCN0000029860   Nrp1
    1163   TRCN0000029861   Nrp1
    1164   TRCN0000029862   Nrp1
    1165   TRCN0000029863   Nrp1
  216   1166   TRCN0000028974   Nrp2
    1167   TRCN0000028975   Nrp2
    1168   TRCN0000028976   Nrp2
    1169   TRCN0000028977   Nrp2
    1170   TRCN0000028978   Nrp2
  217   1171   TRCN0000094624   Nrxn1
    1172   TRCN0000094625   Nrxn1
    1173   TRCN0000094626   Nrxn1
    1174   TRCN0000094627   Nrxn1
    1175   TRCN0000094628   Nrxn1
  218   1176   TRCN0000094486   Nrxn2
    1177   TRCN0000094487   Nrxn2
    1178   TRCN0000094488   Nrxn2
  219   1179   TRCN0000094189   Nrxn3
    1180   TRCN0000094190   Nrxn3
    1181   TRCN0000094191   Nrxn3
    1182   TRCN0000094192   Nrxn3
    1183   TRCN0000094193   Nrxn3
  220   1184   TRCN0000114176   Nudt14
    1185   TRCN0000114177   Nudt14
    1186   TRCN0000114178   Nudt14
    1187   TRCN0000114179   Nudt14
    1188   TRCN0000114180   Nudt14
  221   1189   TRCN0000072128   Numa1
    1190   TRCN0000072129   Numa1
    1191   TRCN0000072130   Numa1
    1192   TRCN0000072131   Numa1
  222   1193   TRCN0000075838   Oas1f
    1194   TRCN0000075839   Oas1f
    1195   TRCN0000075840   Oas1f
    1196   TRCN0000075841   Oas1f
    1197   TRCN0000075842   Oas1f
  223   1198   TRCN0000071193   Orc3l
    1199   TRCN0000071194   Orc3l
    1200   TRCN0000071195   Orc3l
    1201   TRCN0000071197   Orc3l
  224   1202   TRCN0000025154   Pak3
    1203   TRCN0000025155   Pak3
    1204   TRCN0000025156   Pak3
    1205   TRCN0000025157   Pak3
    1206   TRCN0000025158   Pak3
  225   1207   TRCN0000032809   Pappa2
    1208   TRCN0000032810   Pappa2
    1209   TRCN0000032811   Pappa2
    1210   TRCN0000032812   Pappa2
    1211   TRCN0000032813   Pappa2
  226   1212   TRCN0000012573   Pbx1
    1213   TRCN0000012574   Pbx1
    1214   TRCN0000012577   Pbx1
  227   1215   TRCN0000094899   Pcdh15
    1216   TRCN0000094900   Pcdh15
    1217   TRCN0000094901   Pcdh15
    1218   TRCN0000094902   Pcdh15
    1219   TRCN0000094903   Pcdh15
  228   1220   TRCN0000111680   Pclo
    1221   TRCN0000111681   Pclo
    1222   TRCN0000111682   Pclo
    1223   TRCN0000111683   Pclo
    1224   TRCN0000111684   Pclo
  229   1225   TRCN0000174416   Pdpn
    1226   TRCN0000174621   Pdpn
    1227   TRCN0000175972   Pdpn
    1228   TRCN0000176005   Pdpn
  230   1229   TRCN0000025977   Pgr
    1230   TRCN0000025996   Pgr
    1231   TRCN0000026003   Pgr
    1232   TRCN0000026032   Pgr
  231   1233   TRCN0000055083   Phlda2
    1234   TRCN0000055084   Phlda2
    1235   TRCN0000055085   Phlda2
    1236   TRCN0000055086   Phlda2
    1237   TRCN0000055087   Phlda2
  232   1238   TRCN0000088628   Pik3ap1
    1239   TRCN0000088629   Pik3ap1
    1240   TRCN0000088630   Pik3ap1
    1241   TRCN0000088631   Pik3ap1
    1242   TRCN0000088632   Pik3ap1
  233   1243   TRCN0000025614   Pik3ca
    1244   TRCN0000025615   Pik3ca
    1245   TRCN0000025616   Pik3ca
    1246   TRCN0000025617   Pik3ca
    1247   TRCN0000025618   Pik3ca
  234   1248   TRCN0000024584   Pip5k1a
    1249   TRCN0000024585   Pip5k1a
    1250   TRCN0000024586   Pip5k1a
    1251   TRCN0000024587   Pip5k1a
    1252   TRCN0000024588   Pip5k1a
  235   1253   TRCN0000054653   Pitx1
    1254   TRCN0000054654   Pitx1
    1255   TRCN0000054655   Pitx1
    1256   TRCN0000054656   Pitx1
    1257   TRCN0000054657   Pitx1
  236   1258   TRCN0000072083   Pkd1
    1259   TRCN0000072084   Pkd1
    1260   TRCN0000072085   Pkd1
    1261   TRCN0000072086   Pkd1
    1262   TRCN0000072087   Pkd1
  237   1263   TRCN0000123359   Pkp4
    1264   TRCN0000123360   Pkp4
    1265   TRCN0000123361   Pkp4
    1266   TRCN0000123362   Pkp4
    1267   TRCN0000123363   Pkp4
  238   1268   TRCN0000076908   Plcb1
    1269   TRCN0000076909   Plcb1
    1270   TRCN0000076910   Plcb1
    1271   TRCN0000076911   Plcb1
    1272   TRCN0000076912   Plcb1
  239   1273   TRCN0000105980   Ppp1r9a
    1274   TRCN0000105981   Ppp1r9a
    1275   TRCN0000105982   Ppp1r9a
    1276   TRCN0000105983   Ppp1r9a
    1277   TRCN0000105984   Ppp1r9a
  240   1278   TRCN0000081058   Ppp3ca
    1279   TRCN0000081059   Ppp3ca
    1280   TRCN0000081060   Ppp3ca
    1281   TRCN0000081061   Ppp3ca
    1282   TRCN0000081062   Ppp3ca
  241   1283   TRCN0000085193   Prdm9
    1284   TRCN0000085194   Prdm9
    1285   TRCN0000085195   Prdm9
    1286   TRCN0000085196   Prdm9
    1287   TRCN0000085197   Prdm9
  242   1288   TRCN0000091048   Prickle2
    1289   TRCN0000091049   Prickle2
    1290   TRCN0000091050   Prickle2
    1291   TRCN0000091051   Prickle2
    1292   TRCN0000091052   Prickle2
  243   1293   TRCN0000022875   Prkca
    1294   TRCN0000022878   Prkca
    1295   TRCN0000022754   Prkci
  244   1296   TRCN0000022755   Prkci
    1297   TRCN0000022756   Prkci
    1298   TRCN0000022757   Prkci
    1299   TRCN0000022758   Prkci
  245   1300   TRCN0000022717   Prkg2
    1301   TRCN0000022718   Prkg2
  246   1302   TRCN0000115318   Prom1 (CD133)
    1303   TRCN0000115316   Prom1 (CD133)
    1304   TRCN0000115317   Prom1 (CD133)
    1305   TRCN0000115319   Prom1 (CD133)
    1306   TRCN0000115320   Prom1 (CD133)
  247   1307   TRCN0000025359   Prpf4b
    1308   TRCN0000025360   Prpf4b
    1309   TRCN0000025361   Prpf4b
    1310   TRCN0000025362   Prpf4b
    1311   TRCN0000025363   Prpf4b
  248   1312   TRCN0000012113   Psip1
    1313   TRCN0000012114   Psip1
    1314   TRCN0000012115   Psip1
    1315   TRCN0000012116   Psip1
    1316   TRCN0000012117   Psip1
  249   1317   TRCN0000042538   Ptch1
    1318   TRCN0000042539   Ptch1
    1319   TRCN0000042540   Ptch1
    1320   TRCN0000042541   Ptch1
    1321   TRCN0000042542   Ptch1
  250   1322   TRCN0000028989   Pten
    1323   TRCN0000028991   Pten
    1324   TRCN0000028993   Pten
  251   1325   TRCN0000011913   Ptgds
    1326   TRCN0000011914   Ptgds
    1327   TRCN0000011915   Ptgds
    1328   TRCN0000011916   Ptgds
    1329   TRCN0000011917   Ptgds
  252   1330   TRCN0000067938   Ptgs2
    1331   TRCN0000067939   Ptgs2
    1332   TRCN0000067940   Ptgs2
    1333   TRCN0000067941   Ptgs2
    1334   TRCN0000067942   Ptgs2
  253   1335   TRCN0000023484   Ptk2
    1336   TRCN0000023485   Ptk2
    1337   TRCN0000023486   Ptk2
    1338   TRCN0000023487   Ptk2
    1339   TRCN0000023488   Ptk2
  254   1340   TRCN0000081068   Ptprz1
    1341   TRCN0000081069   Ptprz1
    1342   TRCN0000081070   Ptprz1
    1343   TRCN0000081071   Ptprz1
    1344   TRCN0000081072   Ptprz1
  255   1345   TRCN0000100435   Rab31
    1346   TRCN0000100436   Rab31
    1347   TRCN0000100437   Rab31
    1348   TRCN0000100438   Rab31
    1349   TRCN0000100439   Rab31
  256   1350   TRCN0000055188   Rac1
    1351   TRCN0000055189   Rac1
    1352   TRCN0000055190   Rac1
    1353   TRCN0000055191   Rac1
    1354   TRCN0000055192   Rac1
  257   1355   TRCN0000012658   Rad51
    1356   TRCN0000012659   Rad51
    1357   TRCN0000012660   Rad51
    1358   TRCN0000012661   Rad51
    1359   TRCN0000012662   Rad51
  258   1360   TRCN0000012628   Raf1
    1361   TRCN0000012629   Raf1
    1362   TRCN0000012630   Raf1
    1363   TRCN0000012631   Raf1
    1364   TRCN0000012632   Raf1
    1365   TRCN0000055138   Raf1
    1366   TRCN0000055139   Raf1
    1367   TRCN0000055140   Raf1
    1368   TRCN0000055141   Raf1
    1369   TRCN0000055142   Raf1
  259   1370   TRCN0000071953   Rapgef3
    1371   TRCN0000071954   Rapgef3
    1372   TRCN0000071955   Rapgef3
    1373   TRCN0000071956   Rapgef3
    1374   TRCN0000071957   Rapgef3
    1375   TRCN0000077653   Rasa1
    1376   TRCN0000077654   Rasa1
    1377   TRCN0000077655   Rasa1
    1378   TRCN0000077656   Rasa1
    1379   TRCN0000077657   Rasa1
  260   1380   TRCN0000042543   Rb1
    1381   TRCN0000042544   Rb1
    1382   TRCN0000042545   Rb1
    1383   TRCN0000042546   Rb1
    1384   TRCN0000042547   Rb1
    1385   TRCN0000055378   Rb1
    1386   TRCN0000055379   Rb1
    1387   TRCN0000055380   Rb1
    1388   TRCN0000055381   Rb1
    1389   TRCN0000055382   Rb1
  261   1390   TRCN0000071273   Rbl2
    1391   TRCN0000071274   Rbl2
    1392   TRCN0000071275   Rbl2
    1393   TRCN0000071276   Rbl2
    1394   TRCN0000071277   Rbl2
  262   1395   TRCN0000042548   Rel
    1396   TRCN0000042549   Rel
    1397   TRCN0000042550   Rel
    1398   TRCN0000042551   Rel
    1399   TRCN0000042552   Rel
  263   1400   TRCN0000120627   Reln
    1401   TRCN0000120628   Reln
    1402   TRCN0000120629   Reln
    1403   TRCN0000120630   Reln
    1404   TRCN0000120631   Reln
  264   1405   TRCN0000071343   Rest
    1406   TRCN0000071344   Rest
    1407   TRCN0000071345   Rest
    1408   TRCN0000071346   Rest
    1409   TRCN0000071347   Rest
  265   1410   TRCN0000106155   Rims2
    1411   TRCN0000106156   Rims2
    1412   TRCN0000106157   Rims2
    1413   TRCN0000106158   Rims2
    1414   TRCN0000106159   Rims2
  266   1415   TRCN0000022634   Ripk4
    1416   TRCN0000022635   Ripk4
    1417   TRCN0000022636   Ripk4
    1418   TRCN0000022637   Ripk4
    1419   TRCN0000022638   Ripk4
  267   1420   TRCN0000027509   Rxfp3
    1421   TRCN0000027517   Rxfp3
    1422   TRCN0000027523   Rxfp3
    1423   TRCN0000027528   Rxfp3
    1424   TRCN0000027574   Rxfp3
  268   1425   TRCN0000011858   S100a4
    1426   TRCN0000011859   S100a4
    1427   TRCN0000011860   S100a4
    1428   TRCN0000011861   S100a4
    1429   TRCN0000011862   S100a4
  269   1430   TRCN0000072043   S100a9
    1431   TRCN0000072044   S100a9
    1432   TRCN0000072045   S100a9
    1433   TRCN0000072046   S100a9
    1434   TRCN0000072047   S100a9
  270   1435   TRCN0000071628   Sfrs3
    1436   TRCN0000071629   Sfrs3
    1437   TRCN0000071630   Sfrs3
    1438   TRCN0000071631   Sfrs3
    1439   TRCN0000071632   Sfrs3
  271   1440   TRCN0000071933   Sfrs7
    1441   TRCN0000071934   Sfrs7
    1442   TRCN0000071935   Sfrs7
    1443   TRCN0000071936   Sfrs7
    1444   TRCN0000071937   Sfrs7
  272   1445   TRCN0000022884   Sgk
    1446   TRCN0000022885   Sgk
    1447   TRCN0000022886   Sgk
    1448   TRCN0000022887   Sgk
  273   1449   TRCN0000022879   Sgk2
    1450   TRCN0000022880   Sgk2
    1451   TRCN0000022881   Sgk2
    1452   TRCN0000022882   Sgk2
    1453   TRCN0000022883   Sgk2
  274   1454   TRCN0000011953   Si
    1455   TRCN0000011954   Si
    1456   TRCN0000011955   Si
    1457   TRCN0000011956   Si
    1458   TRCN0000011957   Si
  275   1459   TRCN0000042563   Ski
    1460   TRCN0000042564   Ski
    1461   TRCN0000042565   Ski
    1462   TRCN0000042566   Ski
    1463   TRCN0000042567   Ski
  276   1464   TRCN0000079543   Slc16a1
    1465   TRCN0000079544   Slc16a1
    1466   TRCN0000079545   Slc16a1
    1467   TRCN0000079546   Slc16a1
    1468   TRCN0000079547   Slc16a1
  277   1469   TRCN0000079308   Slc6a2
    1470   TRCN0000079309   Slc6a2
    1471   TRCN0000079310   Slc6a2
    1472   TRCN0000079311   Slc6a2
    1473   TRCN0000079312   Slc6a2
  278   1474   TRCN0000079253   Slco3a1
    1475   TRCN0000079254   Slco3a1
    1476   TRCN0000079255   Slco3a1
    1477   TRCN0000079256   Slco3a1
    1478   TRCN0000079257   Slco3a1
  279   1479   TRCN0000106575   Slit1
    1480   TRCN0000106576   Slit1
    1481   TRCN0000106577   Slit1
    1482   TRCN0000106578   Slit1
    1483   TRCN0000106579   Slit1
  280   1484   TRCN0000120817   Slit2
    1485   TRCN0000120818   Slit2
    1486   TRCN0000120819   Slit2
    1487   TRCN0000120820   Slit2
    1488   TRCN0000120821   Slit2
  281   1489   TRCN0000114071   Slitrk3
    1490   TRCN0000114073   Slitrk3
    1491   TRCN0000114074   Slitrk3
    1492   TRCN0000114075   Slitrk3
  282   1493   TRCN0000025884   Smad1
    1494   TRCN0000025910   Smad1
    1495   TRCN0000025933   Smad1
    1496   TRCN0000025963   Smad1
  283   1497   TRCN0000025881   Smad4
    1498   TRCN0000025885   Smad4
    1499   TRCN0000025900   Smad4
    1500   TRCN0000025953   Smad4
  284   1501   TRCN0000025891   Smad9
    1502   TRCN0000025893   Smad9
    1503   TRCN0000025912   Smad9
    1504   TRCN0000025913   Smad9
    1505   TRCN0000025937   Smad9
  285   1506   TRCN0000071398   Smarca2
    1507   TRCN0000071399   Smarca2
    1508   TRCN0000071400   Smarca2
    1509   TRCN0000071401   Smarca2
    1510   TRCN0000071402   Smarca2
  286   1511   TRCN0000085748   Sox2
    1512   TRCN0000085749   Sox2
    1513   TRCN0000085750   Sox2
    1514   TRCN0000085751   Sox2
    1515   TRCN0000085752   Sox2
  287   1516   TRCN0000086338   Spic
    1517   TRCN0000086339   Spic
    1518   TRCN0000086340   Spic
    1519   TRCN0000086341   Spic
    1520   TRCN0000086342   Spic
  288   1521   TRCN0000087743   Spink5
    1522   TRCN0000087744   Spink5
    1523   TRCN0000087745   Spink5
    1524   TRCN0000087746   Spink5
    1525   TRCN0000087747   Spink5
  289   1526   TRCN0000009601   Spp1
    1527   TRCN0000009602   Spp1
    1528   TRCN0000009603   Spp1
    1529   TRCN0000009604   Spp1
    1530   TRCN0000009605   Spp1
    1531   TRCN0000054698   Spp1
    1532   TRCN0000054699   Spp1
    1533   TRCN0000054700   Spp1
    1534   TRCN0000054701   Spp1
    1535   TRCN0000054702   Spp1
  290   1536   TRCN0000098415   Sprr1b
    1537   TRCN0000098416   Sprr1b
    1538   TRCN0000098417   Sprr1b
    1539   TRCN0000098418   Sprr1b
    1540   TRCN0000098419   Sprr1b
  301   1541   TRCN0000065478   Spry1
    1542   TRCN0000065479   Spry1
    1543   TRCN0000065480   Spry1
    1544   TRCN0000065481   Spry1
    1545   TRCN0000065482   Spry1
  302   1546   TRCN0000103591   Spry2
    1547   TRCN0000103592   Spry2
    1548   TRCN0000103593   Spry2
    1549   TRCN0000103594   Spry2
  303   1550   TRCN0000065538   Spry3
    1551   TRCN0000065539   Spry3
    1552   TRCN0000065540   Spry3
    1553   TRCN0000065541   Spry3
    1554   TRCN0000065542   Spry3
  304   1555   TRCN0000065934   Spry4
    1556   TRCN0000065935   Spry4
    1557   TRCN0000065936   Spry4
    1558   TRCN0000065937   Spry4
  305   1559   TRCN0000103170   Sptlc2
    1560   TRCN0000103171   Sptlc2
    1561   TRCN0000103172   Sptlc2
    1562   TRCN0000103173   Sptlc2
    1563   TRCN0000103174   Sptlc2
  306   1564   TRCN0000125734   Steap1
    1565   TRCN0000125735   Steap1
    1566   TRCN0000125736   Steap1
    1567   TRCN0000125737   Steap1
    1568   TRCN0000125738   Steap1
  307   1569   TRCN0000023729   Styk1
    1570   TRCN0000023730   Styk1
    1571   TRCN0000023731   Styk1
    1572   TRCN0000023732   Styk1
    1573   TRCN0000023733   Styk1
  308   1574   TRCN0000072048   Sub1
    1575   TRCN0000072049   Sub1
    1576   TRCN0000072050   Sub1
    1577   TRCN0000072051   Sub1
    1578   TRCN0000072052   Sub1
  309   1579   TRCN0000125999   Susd2
    1580   TRCN0000126000   Susd2
    1581   TRCN0000126001   Susd2
    1582   TRCN0000126002   Susd2
    1583   TRCN0000126003   Susd2
  310   1584   TRCN0000108875   Syne1
    1585   TRCN0000108876   Syne1
    1586   TRCN0000108877   Syne1
    1587   TRCN0000108878   Syne1
    1588   TRCN0000108879   Syne1
  311   1589   TRCN0000042573   Tal1
    1590   TRCN0000042574   Tal1
    1591   TRCN0000042575   Tal1
    1592   TRCN0000042576   Tal1
    1593   TRCN0000042577   Tal1
  312   1594   TRCN0000176581   Tanc1
    1595   TRCN0000176582   Tanc1
    1596   TRCN0000178012   Tanc1
    1597   TRCN0000178631   Tanc1
  313   1598   TRCN0000012093   Tcf4
    1599   TRCN0000012094   Tcf4
    1600   TRCN0000012095   Tcf4
    1601   TRCN0000012096   Tcf4
    1602   TRCN0000012097   Tcf4
  314   1603   TRCN0000012178   Tcf7l2
    1604   TRCN0000012179   Tcf7l2
    1605   TRCN0000012180   Tcf7l2
    1606   TRCN0000012181   Tcf7l2
  315   1607   TRCN0000075508   Tcfap2c
    1608   TRCN0000075509   Tcfap2c
    1609   TRCN0000075510   Tcfap2c
    1610   TRCN0000075511   Tcfap2c
    1611   TRCN0000075512   Tcfap2c
  316   1612   TRCN0000086223   Tcfap2e
    1613   TRCN0000086224   Tcfap2e
    1614   TRCN0000086225   Tcfap2e
    1615   TRCN0000086227   Tcfap2e
  317   1616   TRCN0000071308   Terf2ip
    1617   TRCN0000071309   Terf2ip
    1618   TRCN0000071310   Terf2ip
    1619   TRCN0000071311   Terf2ip
    1620   TRCN0000071312   Terf2ip
  318   1621   TRCN0000054809   Tgfbi
    1622   TRCN0000054811   Tgfbi
  319   1623   TRCN0000022624   Tgfbr2
    1624   TRCN0000022625   Tgfbr2
    1625   TRCN0000022626   Tgfbr2
    1626   TRCN0000022627   Tgfbr2
    1627   TRCN0000022628   Tgfbr2
  320   1628   TRCN0000075523   Tgif2
    1629   TRCN0000075524   Tgif2
    1630   TRCN0000075525   Tgif2
    1631   TRCN0000075526   Tgif2
    1632   TRCN0000075527   Tgif2
  321   1633   TRCN0000042593   Tiam1
    1634   TRCN0000042595   Tiam1
    1635   TRCN0000042596   Tiam1
    1636   TRCN0000042597   Tiam1
  322   1637   TRCN0000112785   Tm4sf1
    1638   TRCN0000112786   Tm4sf1
    1639   TRCN0000112787   Tm4sf1
    1640   TRCN0000112788   Tm4sf1
    1641   TRCN0000112789   Tm4sf1
  323   1642   TRCN0000174268   Tm7sf3
    1643   TRCN0000174778   Tm7sf3
    1644   TRCN0000193418   Tm7sf3
    1645   TRCN0000193467   Tm7sf3
    1646   TRCN0000193517   Tm7sf3
  324   1647   TRCN0000110735   Tnc
    1648   TRCN0000110736   Tnc
    1649   TRCN0000110737   Tnc
    1650   TRCN0000110738   Tnc
    1651   TRCN0000110739   Tnc
  325   1652   TRCN0000023749   Tnk2
    1653   TRCN0000023750   Tnk2
    1654   TRCN0000023751   Tnk2
    1655   TRCN0000023752   Tnk2
    1656   TRCN0000023753   Tnk2
  326   1657   TRCN0000070163   Tnpo2
    1658   TRCN0000070164   Tnpo2
    1659   TRCN0000070165   Tnpo2
    1660   TRCN0000070166   Tnpo2
    1661   TRCN0000070167   Tnpo2
  327   1662   TRCN0000012362   Trp53
    1663   TRCN0000012362   Trp53
    1664   TRCN0000054551   Trp53
    1665   TRCN0000054552   Trp53
  328   1666   TRCN0000012748   Trp63
    1667   TRCN0000012749   Trp63
    1668   TRCN0000012750   Trp63
    1669   TRCN0000012751   Trp63
    1670   TRCN0000012752   Trp63
  329   1671   TRCN0000012753   Trp73
    1672   TRCN0000012754   Trp73
    1673   TRCN0000012755   Trp73
    1674   TRCN0000012756   Trp73
    1675   TRCN0000012757   Trp73
  330   1676   TRCN0000094629   Tspan6
    1677   TRCN0000094630   Tspan6
    1678   TRCN0000094631   Tspan6
    1679   TRCN0000094632   Tspan6
    1680   TRCN0000094633   Tspan6
  331   1681   TRCN0000094474   Tspan8
    1682   TRCN0000094475   Tspan8
    1683   TRCN0000094477   Tspan8
    1684   TRCN0000094478   Tspan8
  332   1685   TRCN0000088743   Ttn
    1686   TRCN0000088744   Ttn
    1687   TRCN0000088745   Ttn
    1688   TRCN0000088746   Ttn
    1689   TRCN0000088747   Ttn
  333   1690   TRCN0000071573   Usf2
    1691   TRCN0000071574   Usf2
    1692   TRCN0000071575   Usf2
    1693   TRCN0000071576   Usf2
    1694   TRCN0000071577   Usf2
  334   1695   TRCN0000042608   Vav1
    1696   TRCN0000042609   Vav1
    1697   TRCN0000042610   Vav1
    1698   TRCN0000042611   Vav1
    1699   TRCN0000042612   Vav1
  335   1700   TRCN0000027068   Vdr
    1701   TRCN0000027098   Vdr
    1702   TRCN0000027101   Vdr
    1703   TRCN0000027104   Vdr
    1704   TRCN0000027123   Vdr
  336   1705   TRCN0000066818   Vegfa
    1706   TRCN0000066819   Vegfa
    1707   TRCN0000066820   Vegfa
    1708   TRCN0000066821   Vegfa
    1709   TRCN0000066822   Vegfa
  337   1710   TRCN0000097084   Was
    1711   TRCN0000097085   Was
    1712   TRCN0000097086   Was
    1713   TRCN0000097087   Was
    1714   TRCN0000097088   Was
  338   1715   TRCN0000012403   Wasf1
    1716   TRCN0000012404   Wasf1
    1717   TRCN0000012405   Wasf1
    1718   TRCN0000012406   Wasf1
    1719   TRCN0000012407   Wasf1
  339   1720   TRCN0000099640   Wasl
    1721   TRCN0000099641   Wasl
    1722   TRCN0000099642   Wasl
    1723   TRCN0000099643   Wasl
    1724   TRCN0000099644   Wasl
  340   1725   TRCN0000183172   Waspip
    1726   TRCN0000183384   Waspip
    1727   TRCN0000184459   Waspip
    1728   TRCN0000195856   Waspip
  341   1729   TRCN0000115481   Wdr63
    1730   TRCN0000115482   Wdr63
    1731   TRCN0000115483   Wdr63
    1732   TRCN0000115484   Wdr63
    1733   TRCN0000115485   Wdr63
  342   1734   TRCN0000080203   Wfdc1
    1735   TRCN0000080204   Wfdc1
    1736   TRCN0000080205   Wfdc1
    1737   TRCN0000080206   Wfdc1
    1738   TRCN0000080207   Wfdc1
  343   1739   TRCN0000080198   Wfdc2
    1740   TRCN0000080199   Wfdc2
    1741   TRCN0000080200   Wfdc2
    1742   TRCN0000080201   Wfdc2
    1743   TRCN0000080202   Wfdc2
  344   1744   TRCN0000042113   Wwox
    1745   TRCN0000042114   Wwox
    1746   TRCN0000042115   Wwox
    1747   TRCN0000042116   Wwox
    1748   TRCN0000042117   Wwox
  345   1749   TRCN0000095864   Yap1
    1750   TRCN0000095865   Yap1
    1751   TRCN0000095866   Yap1
    1752   TRCN0000095867   Yap1
    1753   TRCN0000095868   Yap1
  346   1754   TRCN0000071943   Zfp503
    1755   TRCN0000071944   Zfp503
    1756   TRCN0000071945   Zfp503
    1757   TRCN0000071946   Zfp503
    1758   TRCN0000071947   Zfp503
  347   1759   TRCN0000096684   Zic1
    1760   TRCN0000096685   Zic1
    1761   TRCN0000096686   Zic1
    1762   TRCN0000096687   Zic1
    1763   TRCN0000096688   Zic1
 
[00004] [TABLE-US-00004]
  TABLE 2
 
  List of genes mutated in 306 HNSCC patients ranked by statistical
  significance of enrichment of these genes with predicted functional mutations. Number of
  genes displayed: 16.
  Gene   Cytoband   TS/OG   CG   Samples   MM   TM   SM   FIS ≧ 2.0   P val (FIS ≧ 2.0)   Q val (FIS ≧ 2.0)
 
  TP53   17p13.1   1   9   302   171   128   6   160   0   0
  NOTCH1   9q34.3   1   10   302   43   31   7   33   0   0
  DNAH5   5p15.2   0   0   302   48   14   20   32   0   0
  NFE2L2   2q31.2   0   2   302   24   0   0   24   0   0
  CASP8   2q33.1   1   4   302   15   18   0   12   0   0
  MYH8   17p13.1   0   0   302   21   2   4   15   0.000001   0.002
  SMARCA4   19p13.2   1   4   302   16   1   1   12   0.000003   0.006
  FAT1   4q35.2   1   1   302   22   89   2   13   0.000006   0.009
  RAC1   7p22.1   0   4   302   10   0   0   9   0.000006   0.011
  CUL3   2q36.2   0   0   302   9   5   1   8   0.000006   0.011
  HIST1H2BD   6p22.1   0   0   302   6   1   0   6   0.000009   0.012
  SCN3A   2q24.3   0   1   302   16   2   3   13   0.00001   0.016
  PCDHGA1   5q31.3   0   0   302   10   2   1   9   0.00002   0.023
  PRPF6   20q13.33   0   1   302   9   0   2   8   0.00002   0.023
  EP300   22q13.2   0   10   302   22   8   1   14   0.00002   0.023
  MYH9   22q12.3   0   5   302   16   2   4   12   0.00003   0.024
 
  MM is a number of missense mutations
  TM is a number of truncating mutations
  SM is a number of silent mutations
  FIS ≧ 2 is a number of missense mutations with the predicted functional score bigger than 2 [PMID: 21727090 PMCID: PMC3177186]
  DD and D are, respectively, numbers of homozygous and hemizygous deletions
  AA and A are, respectively, numbers DNA copy amplifications and DNA copy gains;
  P-val (FM) and P-val (FTM) are, respectively, probabilities to observe the obtained distributions of predicted functional mutations and predicted functional and truncating mutations by chance.
[00005] [TABLE-US-00005]
  TABLE 3
 
  Statistics of genomic alterations of MYH9 across 10 cancer types
  found in the TCGA data set.
                          Cancers   Cancers   Cancers
    Cyto-     Sam-         FIS >=           with DFTM   with FM   with FTM
  Gene   band   Cancer type   ples   MM   TM   SM   2.0   DD   D   AA   A   enrichment   enrichment   enrichment
 
  MYH9   22q12.3   BLCA/   3081   102   24   28   58   5   1076   16   323   LUSC   LUSC/   LUSC/
      LUSC/GBM/                       COADREAD/   COADREAD/
      KIRC/                       UCEC/   UCEC/
      COADREAD/                       HNSC   HNSC/
      UCEC/                         BRCA/
      HNSC/                         LUAD
      BRCA/OVC/
      LUAD
 
  Abbreviations are as in Table 2 and:
  BLCA: bladder carcinoma;
  LUSC: lung squamous cell carcinoma;
  GBM: gliobastoma;
  KIRC: Kidney Renal Papillary Cell Carcinoma;
  COADREAD: colorectal carcinoma;
  UCEC: cervical SCC & endocervical carcinoma;
  HNSCC: head and neck SCC;
  BRCA: breast carcinoma;
  OVC: ovarian carcinoma;
  LUAD; lung adenocarcinoma
[00006] [TABLE-US-00006]
  TABLE 4
 
  List of 18.014 genes mutated in 306 HNSCC patients ranked
  according to their p-value and false discovery rate analysed by MutSig2.0 and MutSigCV0.9.
  Number of significant genes found: 35. Number of genes displayed: 50.
  rank   gene   description   n   npat   nsite   nsil   p_cons   p_joint   p   q
 
  1   NSD1   nuclear receptor binding SET domain protein 1   36   33   36   1   0.0694   0.00748   0   0.00
  2   PIK3CA   phosphoinositide-3-kinase, catalytic, alpha polypeptide   65   64   24   0   0.000659   0   0   0.00
  3   CDKN2A   cyclin-dependent kinase inhibitor 2A   65   65   31   0   0   0   0   0.00
  4   HRAS   v-Ha-ras Harvey rat sarcoma viral oncogene homolog   11   10   6   0   0.00126   0   0   0.00
  5   TP53   tumor protein p53   246   214   153   5   0   0   0   0.00
  6   NFE2L2   nuclear factor (erythroid-derived 2)-like 2   18   17   13   0   1.00E−06   0   0   0.00
  7   NOTCH1Notch homolog 1, translocation-associated (Drosophila)   62   57   62   5   0.729   0.00107   1.11E−16   0.00
  8   FAT1FAT tumor suppressor homolog 1 (Drosophila)   80   72   80   2   0.0294   0.14   5.22E−15   0.00
  9   CASP8   caspase 8, apoptosis-related cysteine peptidase   27   27   24   0   0.0282   0.136   1.64E−14   0.00
  10   JUBjub, ajuba homolog (Xenopus laevis)   19   18   19   1   0.383   0.275   7.54E−14   0.00
  11   MLL2   myeloid/lymphoid or mixed-lineage leukemia 2   58   56   58   3   0.242   0.519   8.58E−14   0.00
  12   FBXW7   F-box and WD repeat domain containing 7   16   15   14   1   0.634   1.18E−05   3.97E−11   0.00
  13   EPHA2   EPH receptor A2   16   14   15   0   0.29   0.108   4.58E−10   0.00
  14   ZNF750   zinc finger protein 750   15   13   14   1   0.0158   7.38E−05   1.01E−09   0.00
  15   FLG   filaggrin   59   48   59   9   0.449   0.0488   2.18E−09   0.00
  16   B2M   beta-2-microglobulin   7   7   6   0   0.249   0.464   2.03E−08   0.00
  17   IL32   interleukin 32   4   4   2   0   0.915   0.000263   3.18E−07   0.00
  18   EP300   E1A binding protein p300   25   25   22   1   0.15   0.00532   4.53E−07   0.00
  19   RHOA   ras homolog gene family, member A   4   4   1   0   0.0944   6.40E−06   2.64E−06   0.00
  20   HLA-A   major histocompatibility complex, class I, A   9   9   8   2   0.176   0.22   2.80E−06   0.00
  21   CTCF   CCCTC-binding factor (zinc finger protein)   13   11   13   1   0.253   0.0674   6.15E−06   0.01
  22   RB1   retinoblastoma 1 (including osteosarcoma)   10   10   10   2   0.155   0.493   9.84E−06   0.01
  23   TGFBR2   transforming growth factor, beta receptor II   11   10   9   1   0.591   0.54   1.40E−05   0.01
  24   CSMD3   CUB and Sushi multiple domains 3   88   70   87   17   0.814   1   1.76E−05   0.01
  25   NECAB1   N-terminal EF-hand calcium binding protein 1   6   6   6   2   0.899   1   1.90E−05   0.01
  26   KRTAP1-5   keratin associated protein 1-5   3   3   1   1   0.899   0.000775   2.07E−05   0.01
  27   MAPK1   mitogen-activated protein kinase 1   4   4   1   0   0.231   0.000176   2.39E−05   0.02
  28   PLSCR1   phospholipid scramblase 1   5   5   4   0   0.976   0.0101   4.32E−05   0.03
  29   CNPY3   canopy 3 homolog (zebrafish)   3   3   1   0   0.666   0.000755   6.04E−05   0.04
  30   EPB41L3   erythrocyte membrane protein band 4.1-like 3   16   16   16   5   0.96   0.0299   7.81E−05   0.05
  31   RAC1   ras-related C3 botulinum toxin substrate 1 (rho family,   10   9   8   0   0.332   0.458   8.82E−05   0.05
      small GTP binding protein Rac1)
  32   CUL3   cullin 3   10   10   10   1   0.576   0.159   0.00013   0.07
  33   TRPV4   transient receptor potential cation channel, subfamily V   7   7   7   4   0.172   0.000541   0.00013   0.07
  34   PRB2   proline-rich protein BstNI subfamily 2   11   10   10   3   0.943   0.0784   0.00015   0.08
  35   PRB1   proline-rich protein BstNI subfamily 1   8   7   7   1   0.283   0.453   0.00019   0.10
  36   WHSC1   Wolf-Hirschhorn syndrome candidate 1   11   10   8   0   0.00368   0.0131   0.00026   0.13
  37   STEAP4   STEAP family member 4   10   10   10   1   0.95   1   0.00037   0.18
  38   HIST1H1B   histone cluster 1, H1b   7   7   7   2   0.149   0.245   0.00038   0.18
  39   KCNA3   potassium voltage-gated channel, member 3   8   8   8   2   0.852   0.0764   0.00039   0.18
  40   EPDR1   ependymin related protein 1 (zebrafish)   6   6   6   2   0.0509   0.00472   0.00041   0.18
  41   SLC26A7   solute carrier family 26, member 7   8   8   8   1   0.267   0.178   0.00042   0.18
  42   OR8D4   olfactory receptor, family 8, subfamily D, member 4   6   6   5   0   0.967   0.192   0.00043   0.18
  43   POU4F2   POU class 4 homeobox 2   7   7   4   3   0.996   0.104   0.00044   0.19
  44   FCRL4   Fc receptor-like 4   14   13   14   1   0.97   0.404   0.00045   0.19
  45   TXK   TXK tyrosine kinase   3   3   2   0   0.971   0.000725   0.00048   0.19
  46   C3orf59   chromosome 3 open reading frame 59   8   8   4   1   0.187   0.0316   0.00056   0.22
  47   RAB32   RAB32, member RAS oncogene family   3   3   3   0   0.938   0.0017   0.00060   0.23
  48   KCNT2   potassium channel, subfamily T, member 2   17   17   16   1   0.541   0.0461   0.00075   0.28
  49   MYH9   myosin, heavy chain 9, non-muscle   13   13   13   3   0.0226   0.00669   0.00077   0.28
  50   C5orf23   chromosome 5 open reading frame 23   3   3   3   0   0.0402   0.019   0.00087   0.31
 
  n = number of (nonsilent) mutations in this gene across the individual set;
  npat = number of patients (individuals) with at least one nonsilent mutation;
  nsite = number of unique sites having a non-silent mutation;
  p_cons = p-value for enrichment of mutations at evolutionarily most-conserved sites in gene;
  p_joint = p-value for clustering + conservation;
  p = p-value (overall);
  q = q-value, False Discovery Rate (Benjamini-Hochberg procedure)
[00007] [TABLE-US-00007]
  TABLE 5
 
  Full list of cancer types with their respective percentage of MYH9 hemizygosity
 
 
    MYH9     MYH9
  Human Cancers:   hemizygosity     hemizygosity
 
  HNSCC   15%   Lung Adenocarcinoma   40%
      Lung Squamous Cell Carcinoma   9%
  Acute Myeloid Leukemia   1%   Lymphoid Neoplasm Diffuse Large B-   6%
      cell Lymphoma
  Bladder Urothelial Carcinoma   35%   Ovarian Serous Cystadenocarcinoma   79%
  Brain Lower Grade Glioma   10%   Pancreatic Adenocarcinoma   15%
  Breast Invasive Carcinoma   46%   Prostate Adenocarcinoma   8%
  Cervical Squamous Cell   26%   Sarcoma   42%
  Carcinoma and Endocervical
  Adenocarcinoma
  Colon and Rectum   34%   Skin Cutaneous Melanoma   10%
  Adenocarcinoma
  Glioblastoma Multiforme   38%   Stomach Adenocarcinoma   29%
  Kidney Renal Clear Cell   8%   Thyroid Carcinoma   17%
  Carcinoma
  Kidney Renal Papillary Cell   26%   Uterine Corpus Endometrial Carcinoma   11%
  Carcinoma
 
    Tumor     Tumor
  Mouse:   incidence     incidence
 
  heterozygous Myh9 iKO TbRII-   ~26%   homozygous Myh9 iKO TbRII-iKO mice   100%
  iKO mice
 
[0103] While the disclosure has been particularly shown and described with reference to specific embodiments (some of which are preferred embodiments), it should be understood by those having skill in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the present description as set forth herein.
(57)

Claim

1. A method of aiding in diagnosing whether a subject has an aggressive form of a cancer, comprising: testing a sample of a tumor from the subject to determine a mutation in the Myh9 gene or low expression of the Myh9 gene relative to a control, wherein the presence of the mutation and/or the low expression aids in the diagnosis that the individual has an aggressive form of cancer.
2. The method of claim 1, wherein the mutation in the Myh9 gene is selected from the group consisting of A454V, E457K, E465Q, N470S, E530K, T538K, D567N, G696S, L812X, E1131M, S1163X, K1249E, F1261L, A1351P, L1411P, L1485P, and combinations thereof.
3. The method of claim 1, wherein the testing the sample comprises determining a polynucleotide sequence of the Myh9 gene.
4. The method of claim 2, wherein at least one of the mutations are determined
5. The method of claim 1, wherein the cancer is a squamous cell carcinoma of the head and neck or the skin cancer or a breast cancer.
6. The method of claim 5, wherein the squamous cell carcinoma is a head and neck squamous cell carcinoma.
7. A method for identifying an individual as a candidate for treatment with a nuclear export inhibitor comprising testing a sample of a tumor from the subject to determine a mutation in the Myh9 gene and/or low expression of the Myh9 gene relative to a control, wherein the presence of the mutation in the Myh9 and/or the low expression of the Myh9 gene relative to a control indicates that the individual is a candidate for therapy with a nuclear export inhibitor.
8. The method of claim 7, wherein the mutation in the Myh9 gene selected from the group consisting of A454V, E457K, E465Q, N470S, E530K, T538K, D567N, G696S, L812X, E1131M, S1163X, K1249E, F1261L, A1351P, L1411P, L1485P, and combinations thereof.
9. The method of claim 8, further comprising administering to the individual a pharmaceutical composition comprising a nuclear export inhibitor.
10. A method for determining whether tumor cells have defective p53 nuclear transportation comprising testing the tumor cells for a mutation in the Myh9 gene, wherein the presence of the mutation in the Myh9 gene determines that the cells have defective p53 nuclear transportation.
11. The method of claim 10 wherein the mutation in the Myh9 gene is selected from the group consisting of A454V, E457K, E465Q, N470S, E530K, T538K, D567N, G696S, L812X, E1131M, S1163X, K1249E, F1261L, A1351P, L1411P, L1485P, and combinations thereof.
12. The method of claim 10, wherein the determining the defective p53 nuclear transportation further determines that the tumor cells are an aggressive form of tumor cells.
13. The method of claim 10, wherein the tumor cells are a component of a sample of a tumor obtained from an individual diagnosed with cancer.
14. The method of claim 13, wherein the cancer is a squamous cell carcinoma of the head and neck region or the skin or a breast cancer.
15. A method for treating an individual diagnosed with an aggressive cancer, wherein the aggressive cancer comprises cancer cells, which comprise a mutation in the Myh9 gene, comprising administering to the individual a composition comprising an effective amount of a nuclear export inhibitor.
*****

Download Citation


Sign in to the Lens

Feedback