Methods Of Detecting Braf Mutations In Cancer

Abstract

The disclosure relates to an allele-specific PCR assay for BRAF V600E mutation. The forward primer comprises one of the following sequences: AGGTGATTTTGGTCTAGCTACAGA; G GTG ATTTTG GTCTAG CTACAG A; AGGTGATTTTGGTCTAGCTACCGA; or G GTG ATTTTG GTCTAG CTACCG A; and the reverse primer comprises GTA ACTC AG C AG C ATCTC AG G G. The assay is suitable for use in diagnosis of hairy cell leukemia.


Claims
Download PDF
Document Preview
Document History
  • Publication: May 2, 2013
  • Application: Oct 23, 2012
    WO US 2012/0061501 W
  • Priority: Oct 24, 2011
    US US 201161550504 P

Download Citation


Sign in to the Lens

Feedback