Dna Encoding A Cell Membrane Glycoprotein Of A Tick Gut

*US5587311A*  
(12)United States Utility Patent(10)Patent No: US 5,587,311 A
  Cobon et al.(45)Date of Patent:Dec. 24, 1996

(54) DNA encoding a cell membrane glycoprotein of a tick gut  
(75)Inventors: Gary S. Cobon, New South Wales ( AU ); Joanna T. Moore, Umea ( SE ); Law A. Y. Johnston, Capalaba ( AU ); Peter Willadsen, Chapel Hill ( AU ); David H. Kemp, Upper Brookfield ( AU ); Alagacone Sriskantha, Florey ( AU ); George A. Riding, Indooroopilly ( AU ); and Keith N. Rand, Frenchs Forest ( AU )
(73)Assignees:Biotechnology Australia Pty. Ltd., Roseville (Australia); Commonwealth Scientific and Industrial Research Organization, Campbell (Australia) 
Type: FOREIGN
( * )Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 0 days. 
(21)Appl. No.: 08/325,071 
(22)Filed: Oct. 19, 1994 
(30) Foreign Application Priority Data
 Nov. 27, 1986(AU)PH9196
 Jun. 19, 1987(AU)PH2570
 Oct. 16, 1987(AU)PH4912
(51)Int. Cl.6C12N 1/00; C12N 1/15; C12N 1/21; C12N 5/10; C12N 15/12; C12N 15/63 
(52)U.S. Cl.352/402; 352/401; 352/523; 525/233; 525/411; 353/201; 352/542; 36/235 
(58)Field of Search 435/240.1; 435/252.3; 435/252.33; 435/172.3; 435/240.2; 435/254.11; 435/254.2; 435/320.1; 536/235 

        
(56)References Cited
 
 U.S. PATENT DOCUMENTS
 
 4,237,224 12/1980  Cohen et al. 35/69. 1
 
 FOREIGN PATENT DOCUMENTS
  16459/83  1/1984 ( AU )
  45936/85  2/1986 ( AU )
  59707/86  1/1987 ( AU )
  2142334  1/1985 ( GB )
 OTHER PUBLICATIONS
Allen et al., "Immunization of Guinea Pigs and Cattle Against Ticks", Nature, vol. 280, Aug. 1979, pp. 491-493.
Johnston et al., "Immunization of Cattle Against Boophilus microplus Using Extracts Derived from Adult Female Ticks: Effects of Induced Immunity on Tick Populations", Inter. Journ. Parasitology, vol. 16, No. 1, 1984, pp. 27-34.
Brown et al., "Characterization of Tick Antigens Inducing Host Immune Resistance", Journ. Immun., vol. 133, No. 6, Dec. 1984, pp. 3319-3325.
Ackerman et al., "Artifical Immunity to Dermacentor variabilis (Acari: Ixodidae): Vaccination Using Tick Antigens.sub.1 ", J. Med. Entomol., vol. 17, No. 5, 1980, pp. 391-397.
McGowan et al., "Success of Tick Feeding on Calves Immunized with Amblyomma americanum (Acari: Ixodidae) Extract.sub.1 ", J. Med. Entomol., vol. 18, No. 4, 1981, pp. 328-332.
Stephen K. Wikel, "The Induction of Host Resistance to Tick Infestation with Salivary Gland Antigen", Am. J. Trop. Med. Hyg., vol. 30, No. 1, 1981, pp. 284-288.
Briggs et al., "Molecular Mechanisms of Protein Secretion", Advances in Protein Chemistry, Academic Press, vol. 38, pp. 110-180. (no date supplied).
van Hemert et al., "The Primary Structure of Elongation Factor EF-1 α from the Brine Shrimp Artemia", EMBO Journ. vol. 3, No. 5, 1984, pp. 1109-1113.
P. Willadsen, "Immunological Approaches to the Control of Ticks", Int. J. Parasit., 17:pp. 671-677. 1987.
Per Vretblad, "Purification of Lectins by Biospecific Affinity Chromatography", Biochimica et Biophysica Acta, vol. 434., 1976, pp. 169-176.
Sage et al., "Common Lentil (Lens culinaris) Phytohemagglutinin", Ginsburg. V. Ed., pp. 332-339 Methods in Enzymology 28 (1972).
Stephen K. Wikel, "Tick and Mite Toxicosis and Allergy", Handbook of Natural Toxins, vol. 2, 1984, pp. 371-396.
Stephen A. Wikel, "Immunomodulation of Host Responses to Ectoparasite Infestation-an Overview", Vet., Para., vol. 14, 1984, pp. 321-339.
George et al., "Acquistion and Expression of Resistance by Bos indicus and Bos indicus x Bos taurus Calves to Amblyomma Americanum Infestation", J. Parasit. vol. 71, No. 2, 1985, pp. 174-182.
S. K. Wikel., "Effects of Tick Infestation on the Plague-Forming Cell Response to a Thymic Dependent Antigen", Ann. Trop. Med. Parasit., vol. 79, No. 2, 1985, pp. 195-198.
S. K. Wilkel, "Resistance to Ixodid Tick Infestation Induced by Administration of Tickl-Tissue Culture Cells", Ann. Trop. Med. Parasit., vol. 79, No. 5, 1985, pp. 513-518.
Wikel et al., "Ixodid-Host Immune Interaction. Identification and Characterization of Relevant Antigens and Tick-Induced Host Immunosuppresion", Vet. Parasit., vol. 20, 1986, pp. 149-174.
Whelen et al., "Dot-Elisa Assessment of Guinea Pig Antibody Responses to Repeated Dermacentor andersoni Infestations", J. Parasit. vol. 72, No. 1, 1986, pp. 155-162.
Wikel et al., "Immunological Studies of Ixodid Tick-Host Interaction: Analysis of Immunogens", J. Toxicol. Toxin Rev. vol. 5, No. 2, 1986, pp. 145-160.
Sharp et al., "Chromatography and Generation of Specific Antisera to Synthetic Peptides from a Protective Boophilus Microplus Antigen", J. Chrom., vol. 512, 1990, pp. 189-202.
"Principles of Gene Manipulation", Blackwell Scientific Pibl., 1985, p. 13.
 
(74)Primary Examiner — Charles L. Patterson, Jr.
 Assistant Examiner — Gabriele E. Bugaisky
 Attorney, Agent, or Firm — Foley & Lardner
 Exemplary claim number — 1
 Art Unit — 184

(57)

Abstract

[00001]  The invention relates to antigens derived from ticks and to their purification. It also relates to genes encoding such antigens and to their cloning and expression from recombinant DNA molecules. Further, the invention describes the use of purified antigens and recombinant expression products having similar biological activity to those purified antigens to provide vaccines to protect cattle against tick infestation.
16 Claims, 29 Drawing Sheets, and 20 Figures
   [00002]  This application is a continuation of Ser. No. 08/062,109, filed May 17, 1993, abandoned, which is a continuation-in-part of Ser. No. 07/926,368, filed Aug. 7, 1992, abandoned, which is a continuation-in-part of Ser. No. 07/242,196, filed as PCT/AU87/00401, Nov. 27, 1987, abandoned.

TECHNICAL FIELD

   [00003]  This invention relates to an antigen isolated from the cattle tick Boophilus microplus and to the gene coding for that antigen and to the protein product of that gene. The antigen when used in part or in entirety as an immunogen administered to cattle as a vaccine results in the production by the cattle of an immune response which is capable of damaging ticks feeding on vaccinated cattle to such an extent that the survival of such ticks is decreased and/or the reproductive capacity of the ticks is decreased to such an extent that the antigen coded for by the gene can be used as an effective vaccine against said ticks.

BACKGROUND ART

   [00004]  On first infestation with ticks such as the cattle tick, Boophilus microplus, animals such as cattle are very susceptible to the parasite. Typically about 50% of the tick larvae which attach, complete the full life cycle to eventually drop off as engorged adults. On prolonged exposure to the parasite, cattle acquire some degree of immunological resistance to it, but this resistance reaches a relatively stable level at which economically important losses to cattle production still occur. The losses to production are largely due to losses of blood and tissue fluid taken up by the parasite during feeding. Additional losses are due to the hypersensitive or allergic response which animals develop to tick salivary and cement antigens in conjunction with natural immunity, a condition known as tick worry.
   [00005]  A large number of approaches are used to control ticks. The most widely used is treatment of cattle with acaracides -chemicals which kill ticks. This approach has several short comings. For example resistance to the chemicals arises in the tick population and new classes of chemicals must be introduced frequently. The chemicals have little residual effect so cattle must be treated frequently in order to control the ticks effectively. The chemicals may have detrimental effects on the cattle, personnel and the environment. A second method for control of ticks is to breed for host resistance. Zebu breeds and Zebu cross breeds are more resistant to ticks than the highly susceptible British breeds. However Zebu crosses have behavioural problems, are less productive than pure British breeds and, even with the use of chemicals, the degree of resistance to ticks is far from ideal. Other methods of tick management such as pasture spelling and tick eradication present practical problems in most cattle producing areas throughout the world. An effective vaccine against ticks would provide a highly attractive alternative to the currently available methods of tick control.
   [00006]  Intermittent attempts have been made in the past to immunise animals against ticks. (1-5, see 13 for review) The majority of these studies have used tick-host systems in which strong immunity seems to develop naturally, and have usually used laboratory animals as hosts. Usually the effects observed have been some reduction in engorgement weights and egg masses of adult ticks and some decrease in the viability of those eggs (1-5) although in two reports some decrease in the viability of engorging adults has been reported (3,4). Many of these studies have used antigens derived from salivary glands in order to attempt to mimic natural immunity. However, it is unlikely that a vaccine which mimics natural immunity would be of great commercial benefit due to the economic losses which still occur once natural immunity has been expressed and the deleterious effect of hypersensitivity responses to ticks.
   [00007]  The alternative approach is to vaccinate animals with "concealed" or "novel" antigens, "Concealed" or "novel" antigens are, in this context, components of the parasite which can be used to raise a protective immune response in animals when used (in partially or fully purified form) to vaccinate those animals, but are antigens which are not involved in naturally acquired immunity.
   [00008]  The successful vaccination against ticks using concealed or novel antigens has been reported (2,5). Animals were immunised with extracts of whole ticks or tick midgut. Immunization led to reductions in tick engorgement weights, feeding period, egg masses and egg viability but no significant increase in tick mortality was observed. However, the antigen fractions used in these experiments were so complex that it was not possible to identify the individual tick antigens which were responsible for the effects noted and the reasons for the effects were not investigated in detail.
   [00009]  In a recent patent application (Australian Patent Application No. 59707/86), claims are made that antigens derived from the synganglia of ticks can act as effective vaccines against tick infestation. However, there is no evidence presented in that patent that synganglia antigens can be effective alone. In this work dissected guts and synganglia were isolated, the gut cells were lysed, centrifuged and both the supernatant and pellet were used to vaccinate the same animals together, in some cases, with a cell suspension of synganglia. All cattle in the experiments reported were vaccinated with tick gut components and some received synganglia in addition. Therefore, it is clearly implicit in the experimental design that gut damage as a result of an immune response against gut components of ticks such as the gut cell antigens described herein and in the CSIRO patent application (45936/85), is an essential prerequisite for any secondary protective effects which may possibly result from an immune response against synganglia-specific antigens.
   [00010]  In all of the examples cited above, the tick extracts which were used to vaccinate the animals were extremely complex. In the majority of the reports the fractions used were homogenates of tick organs and in some cases, the pellets derived therefrom by centrifugation. In this and the other studies, no data on the complexity of the fractions is presented but it is certain that they must contain many hundreds and probably thousands of components. In the one study where any purification and characterization of the protective fraction was carried out (Australian patent application No. 45936/85) the most highly purified fraction, GF 5/6 was still very complex as will be shown below and it was not possible from this work to identify the individual component(s) of this fraction which were responsible for the protective immune response. In the present invention one such antigen is purified and characterized.
   [00011]  Boophilus microplus presents a particularly challenging problem. Since the naturally-acquired immunity is only partially effective, duplication of natural immunity by artificial immunization would be of comparatively little commercial value. Boophilus microplus is a parasite of cattle and does not feed readily on laboratory animals. The possibility of inducing "unnatural immunity" to Boophilus microplus has been examined and shown to be possible (6, 7, 8, Australian Patent Application No. 45936/85). The practical exploitation of this, however, would require as a first step the isolation of the antigen or antigens responsible, and as a second step, the development of means by which the effective antigens could be produced in quantities which would be sufficient for commercial uses.
   [00012]  The initial steps in the purification of the antigens in question and the demonstration of the efficacy of these antigens has been described previously (Australian Patent Application No. 45936/85). Briefly, ticks removed from cattle were disrupted, and sonicated, the cuticles and debris removed by low speed centrifugation, the supernatant was subjected to high speed centrifugation at 100,000× g for 1 hour, the membrane enriched pellet was extracted with a non-ionic detergent, the extract was subjected sequentially to chromatography on Sephacryl S-300 columns, broad range isoelectric focussing, narrow range isoelectric focussing and gel filtration chromatography on HPLC. At each step, fractions obtained were tested for efficacy as immunogens and the most highly protective fractions subjected to the next purification step. The most highly protective antigens were thus identified as being membranous, possessing an isoelectric point (pI) of between 5.05 and 5.65 and molecular weights in the range 205 to 79 kilodaltons. Other less highly protective fractions were also described and are of interest in both this and the preceding Australian Patent Application 45936/85.
   [00013]  Further development of the purification procedure as described herein has enabled the most highly protective antigens to be more clearly defined and characterised more precisely and has enabled animals to be vaccinated with more highly purified immunogen preparations. One such antigen has been purified to near homogeneity and it has been shown that when cattle are vaccinated with this tick component an immune response is generated in those cattle which results in the death of the majority of ticks used to challenge those vaccinated animals. The antigen isolated from ticks has been shown to be a glycoprotein with a molecular weight of approximately 89 kilodaltons and an isoelectric point in the range of 5.30 to 5.67. The method for the purification of this glycoprotein (referred to hereafter as the WGL.sup.+ antigen or WGL.sup.+) has been improved and a method is disclosed herein which results in a much larger yield of the antigen than could be obtained by the method previously described (Aust. Patent Application No. 45936/85). During this and previous work, other fractions which give protection have been identified.
   [00014]  Having devised means by which the WGL.sup.+ antigen can be obtained in larger amounts (not sufficient for commercial uses), experiments have been performed to analyse the structure of parts of the protein portion of the antigen. The purified preparation was reduced and carboxy-methylated and digested with endoproteinase lys-C. The peptide fragments so produced were purified and the partial amino acid sequence determined for some peptides. This amino acid sequence data has enabled the design of oligonucleotides which have been used to isolate bacterial cells containing cDNA coding for the WGL.sup.+ antigen.
   [00015]  Analysis of the DNA from these bacterial cells leads to the unambiguous identification of the gene coding for one protective antigen and the production of recombinant proteins which can be used as effective vaccines against ticks. These developments are the subject of the present invention.

DEFINITIONS

   [00016]  Whilst the invention provides products and processes suitable for the protection of cattle against tick infestation, it is to be understood that the principles of the invention can be equally applied to the protection of other animals such as horses, deer, goats, sheep, dogs, cats and pigs against tick infestation.
   [00017]  It is recognised that the tick population worldwide is genetically diverse as is the case for all organisms which reproduce sexually. Each individual of a population differs subtly from the others in the population and these differences are a consequence of differences in the sequence of the DNA which each individual inherits from its parents.
   [00018]  Further, random mutational events which can occur in either sexually or asexually reproducing organisms are a further source of genetic variation.
   [00019]  Thus for each gene encoding a particular protein, there are likely to be differences in the sequence among the population of individuals.
   [00020]  Such related molecules are referred to herein as homologues of antigens according to the invention and to the extent that they fulfill the functions of immunogens as defined herein they are included within the scope of the invention.
   [00021]  Homologous antigens may be defined as antigens related by evolution but not necessarily by function. Similar but not necessarily identical DNA or protein sequences may be provided. It should be noted however that function in this sense relates to the natural in vivo function of the protein.
   [00022]  Illustration of this point is provided by considering:
[00023]  1. WGL.sup.+ form Boophilus microplus and other tick species
[00024]  2. WGL.sup.+ from variants or different individuals of the Boophilus microplus population
[00025]  3. WGL.sup.+ and related gut cell plasma membrane glycoproteins from ticks which are homologues of the WGL.sup.+ antigen defined herein.
   [00026]  It is stressed that for the purposes of this invention, homologues include only those WGL.sup.+ related plasma membrane glycoproteins which function as immunogens as defined herein.
   [00027]  Such homologous WGL.sup.+ related plasma membrane glycoproteins may exist in the tick population worldwide and will be capable, when incorporated into a vaccine, of eliciting in animals vaccinated with those antigens an immune response which is capable of killing ticks, by damaging tick gut cells and which additionally results in a reduction in tick engorgement weights or otherwise damaging the surviving ticks in such a way that for example egg production by those ticks is decreased to such an extent that the vaccine can be used commercially agains infestation by tick species such as Boophilus spp, Haemaphysalis spp, Otobius spp, Rhiphicephalus spp, Ambylomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp, and especially from B. annulatus, B. decoloratus, Otobius megnini, Rhiphicephalus appendiculatus, Dermacentor andersoni, D. variabilis, Haemaphysalis longicornis, Ambylomma variegatum and Ixodes holocyclus.
   [00028]  Further, it should be recognised that it is possible to generate chemicals which are not related to the WGL.sup.+ antigen by evolution or necessarily by structure but which may serve as immunogens to generate an immune response against protective epitopes on the WGL.sup.+ antigen and thereby act as effective vaccines. These molecules are referred to herein as analogues and to the extent that they fulfill the functions of immunogens as defined herein, they are included within the scope of the invention. Such analogues include chemically synthesized oligopeptide molecules with sequences corresponding to portions of the amino acid backbone of the WGL.sup.+ molecule, oligopeptides which when used as immunogens elicit an immune response which recognises native WGL.sup.+ antigen in ticks, carbohydrate structures from whatever source which when used as antigens elicit an immune response which recognises the WGL.sup.+ antigen in ticks, and anti-idiotype antibodies raised against the variable region of antibodies which recognise the epitope(s) of the WGL.sup.+ antigen.

DISCLOSURE OF THE INVENTION

   [00029]  In a first embodiment the invention provides an immunogen comprising an antigen derived from a tick species or tick cell line which antigen is capable of inducing immunity to tick infestation of a mammalian host to which said immunogen has been administered characterised in that said immunity results in the mammalian host producing an immune response which is capable of damaging the plasma membrane of the gut cells of ticks feeding on said host to such an extent that the majority of said ticks fail to survive to adult stage or surviving ticks become red in colour and the reproductive capacity of said surviving ticks is substantially decreased wherein said immunogen includes immunogens displaying similar immunological activity to said antigen including parts, analogues, homologues, derivatives and combinations thereof of said antigen.
   [00030]  Preferably the antigen is derived from Boophilus microplus.
   [00031]  In a preferred embodiment the immunity induced is immunity to infestation by a Boophilus species.
   [00032]  More preferably the immunity induced is immunity to B. microplus infestation.
   [00033]  However, immunity may also be induced to other species of ticks, including Haemaphysalis spp, Otobius spp, Rhiphicephalus spp, Ambylomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp and especially to other species of Boophilus such as B. annulatus or B. decoloratus.
   [00034]  Of the other species of ticks against which immunity can be induced preferred species include Otobius megnini, Rhiphicephalus appendiculatus, Dermacentor andersoni, D. variabilis, Haemaphysalis longicornis, Ambylomma variegatum and Ixodes holocyclus.
   [00035]  By immunization with related antigens isolated from other species of ticks including Boophilus spp, Haemaphysalis spp, Otobius spp, Rhiphicephalus spp, Ambylomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp., immunity to infestation by other ticks may also be induced. Preferred species from which the related antigens are isolated include B. annulatus, B. decoloratus, Otobius megnini, Rhiphicephalus appendiculatus, Dermacentor andersoni, D. variabilis, Haemaphysalis longicornis, Ambylomma variegatum and Ixodes holocyclus. By protecting against infestation with ticks, the antigen may also provide protection against diseases caused by agents such as Babesia bovis, Babesia bigemina, Anaplasma marginale, Cowdria ruminantium, Theileria parva parva, T. parva lawrencii, T. annulata and T. hirci.
   [00036]  In a second embodiment the invention provides a polynucleotide sequence comprising a first polynucleotide sequence which acts as a coding sequence for amino acid sequences of an immunogen according to the invention, a polynucleotide sequence which hybridises to said first sequence or a polynucleotide sequence related to said first sequence or hybridising sequence by mutation including single or multiple base substitutions, deletions, insertions and inversions.
   [00037]  Preferably the polynucleotide sequence is a DNA sequence.
   [00038]  In a further preferred form of the invention the DNA sequence is a cDNA sequence.
   [00039]  The DNA sequence coding for part or all of the protective antigen isolated from Boophilus microplus can be used in DNA hybridization experiments to identify related DNA sequence from other species of ticks. These latter DNA sequences can be constructed by genetic engineering techniques to obtain the expression by bacterial or eukaryote cells such as yeast, plant, insect, tick or mammalian cell lines of all or parts of the antigen from other species of ticks and provide an effective vaccine against those tick species which are responsible for morbidity or economic losses to man or morbidity and productivity losses to animals.
   [00040]  The invention also provides recombinant DNA molecule which comprises at least one DNA sequence according to the invention and vector DNA.
   [00041]  In a preferred form the vector DNA comprises plasmid, phage or viral DNA.
   [00042]  Preferred vectors include lambda gt11, pUR290, pUR291, pUR282, pUK270, pUC8, pUC9, baculovirus, pZipNeo, an SV40 based vector, lambda gt10, an EMBL vector, pBR327, pBR329, and pBR329 containing a par locus.
   [00043]  The invention further provides a transformant cell line, said transformant carrying at least one recombinant DNA molecule according to the invention.
   [00044]  In a further embodiment the invention provides a vaccine comprising at least one immunogen according to the invention together with a pharmaceutically acceptable carrier, adjuvant, immunopotentiator or diluent.
   [00045]  In accordance with the present invention an antigen derived from a tick species which antigen is capable of inducing a highly significant degree of immunity to tick challenge when used to vaccinate cattle has been purified and characterised. Further, bacterial cells which contain DNA sequences derived from a tick species have been produced and those bacterial cells which contain DNA sequences encoding portions of the tick protective antigen have been identified. The DNA sequence of the tick gene encoding that antigen has been determined, the resulting DNA sequence has been used to identify further bacterial cells containing related genes from other species of ticks. Expression of the antigen or portions of the antigen by bacteria or other microorganisms or by eukaryotic cells such as yeast, insect, tick, plant and mammalian cells grown in vitro provides a large amount of the antigen effective as an immunogen for the protection of cattle and other domestic animals against infestation by Boophilis microplus and other tick species.
   [00046]  The invention also includes within its scope the epitope or the epitopes of immunogens of the invention which are responsible for the protective immune response. These epitopes may be created artificially by the synthetic production of oligopeptides which contain sequences of portions of the protective antigen which can be predicted from the results of immunochemical tests on fragments of the protective antigen produced in bacteria or generated as a result of chemical or enzymatic cleavage of the native or recombinant peptides and includes relevant epitopes from those protective antigens, oligopeptides, idiotypes and anti-idiotypes which resemble or recognise those epitopes which may have protective effects when used to actively or passively immunise animals.
   [00047]  In a further embodiment the invention provides methods for the purification of immunogens according to the invention and particularly protective antigens derived from ticks.
   [00048]  The invention provides a process for the preparation of an immunogen according to the invention which process comprises a chromatographic step performed on wheat germ lectin or on a lectin having the same or similar terminal sugar specificity as wheat germ lectin.
   [00049]  Preferably the invention provides a process for the preparation of an immunogen according to the invention said process comprising extracting membrane enriched fractions obtained from homogenised ticks with detergent and subjecting the solubilised material to wheat germ lectin sepharose chromatography and elution with N-acetylglucosamine or chromatography using a lectin having the same or similar terminal sugar specificity to wheat germ lectin.
   [00050]  Preferably said detergent is selected from NP40, an NP40 derivative, Zwittergent 3-14 or SDS.
   [00051]  The process may further comprise Concanavalin-A sepharose chromatography and elution with methyl-α-D-mannopyranoside, a preparative isoelectrofocussing step or size exclusion chromatography.
   [00052]  In a preferred form said methods include preparation of an homogenate of ticks, centrifugation to produce membrane enriched fractions, treatment of those membranes with detergents such as Zwittergent 3-14, chromatography of the detergent soluble material on lectin affinity columns such as wheat germ lectin-Sepharose 6B columns, separation of the lectin binding antigens by isoelectric focusing in buffers containing detergent such as Zwittergent 3-14, chromatography of these antigens by size exclusion HPLC on columns such as Bio-Sil TSK 4,000 and PP 300 SW columns in series in buffers containing detergents and analysis of various fractions produced by SDS-polyacrylamide gel electrophoresis.
   [00053]  The invention also provides an immunogen produced by a process according to the invention. Included within the scope of an immunogen produced by a process according to the invention are those immunogens produced as a result of purification schemes performed on native materials and recombinant or synthetic immunogens produced as a result of recombinant DNA or chemical synthetic methods respectively.
   [00054]  In a further embodiment, the invention provides examples of methods for the treatment of the purified antigens with proteolytic enzymes such as endo lys-C, the purification of oligopeptide fragments produced as a result of proteinase digestion by HPLC chromatography on columns such as Aquapore RP-300 C-8 or Aquapore RP-318 columns and determination of the amino acid sequence of some of the oligopeptides so produced and purified.
   [00055]  The invention further provides the peptide sequence information for such peptide fragments including: ______________________________________ FRAGMENT NUMBER ______________________________________ F1 (SEQ ID NO: 1) (K) D P D P G K F2 (SEQ ID NO: 2) (K) W Y E D (G) V L E A I (X) T S I G K F3 (SEQ ID NO: 3) (K) (X) Q A C E (H) P I G E (W) C M M Y P K F4 (SEQ ID NO: 4) ##STR1## F5 (SEQ ID NO: 5) ##STR2## F6 (SEQ ID NO: 6) ##STR3## F7 (SEQ ID NO: 7) ##STR4## F8 (SEQ ID NO: 8) ##STR5## F9 (SEQ ID NO: 10) ##STR6## F10 (SEQ ID NOS: 11 and 12) ##STR7## F11 (SEQ ID NO: 13) (K) W Y E D R V L E A I R T S I G K F12 (SEQ ID NO: 14) (K) E S S I C X D F G N E F C R N A E C E V V P F13 (SEQ ID NO: 15) (K) T R E C S Y G R C V E S N P S K F14 (SEQ ID NO: 16) (K) A Y E C T C P R A F T V A E D G I S/H C K F15 (SEQ ID NOS: 17-19) ##STR8## F16 (SEQ ID NO: 20) ##STR9## F17 (SEQ ID NO: 21) (K) -- Q A C E H P I ______________________________________ NOTE: Amino acids which were ascribed with low confidence are bracketed. X indicates no amino acid could be ascribed to this position; [ ] denotes mixed sequences.
   [00056]  In a preferred embodiment of the invention, these peptide sequences are: __________________________________________________________________________ F1 (SEQ ID NO: 1) K D P D G K F2, F11 (SEQ ID NO: 13) K W Y E D R V L E A I R T S I G K F3, F17 (SEQ ID NO: 22) K L Q A C E H P I G E W C M M Y P K F4 (SEQ ID NO: 23) K E A G F V C K F5 (SEQ ID NO: 24) K G P D G O C I N A C K F6 (SEQ ID NO: 25) K A G V S C N E N E Q S E C A D K F8 (SEQ ID NO: 26) K D Q E A A Y K F9, F10 (SEQ ID NOS: 27-29) K C P R D N M Y F N A A E K K A N C Q C P P D T K P G E I G C I E K A N C Q C P P D T R P G E I G C I E F12 (SEQ ID NO: 30) A E S S I C S D F G N E F C R N A E C E V V P G F13 (SEQ ID NO: 15) K T R E C S Y G R C V E S N P S K F14 (SEQ ID NOS: 31 and 32) K A Y E C T C P S G S T V A E D G I T C K K A Y E C T C P R A F T V A E D G I T C K F15 (SEQ ID NO: 33) K N L L Q R D S R C C Q F16 (SEQ ID NO: 34) K G T V L C E C P __________________________________________________________________________
   [00057]  The invention also provides examples of methods which can be used to design from the amino acid sequence data oligonucleotide sequences which are suitable for use as hybridization probes to identify nucleic acids sequences (DNA or RNA) coding for the polypeptide containing those amino acid sequences, methods for the construction of bacterial cells containing complementary DNA and genomic DNA fragments from ticks, the use of the oligonucleotides to identify bacterial cells containing complementary and genomic DNA fragments coding for that antigen, the DNA sequence of one such cDNA fragment, methods by which recombinant DNA technology can be used to produce bacterial or eukaryote cells which synthesize the protein or parts of that protein and methods for culturing those cells and for purification of the tick antigen or parts thereof to be incorporated into effective vaccines against ticks.
   [00058]  In a preferred model, the mechanism of action of the vaccine is one in which an immune response is generated in vaccinated animals which results in ticks feeding on those animals ingesting components of the host immune system such as antibodies which interact with the surface of tick gut cells and either alone, or together with other factors in the host blood such as components of complement result in damage occuring such as lysis of the tick gut cells which in turn results in the ticks becoming unable to effectively digest blood, the tick gut becoming permeable to host blood components, to such an extent that host blood components such as albumin, haemoglobin, immunoglobulin and blood cells can be identified in the haemoloymph of the ticks and the ticks appear red in colour. This gut damage in turn results in the death of the majority of the ticks feeding on vaccinated animals before they reach engorgement stage and those few which may survive are so badly damaged that their engorgement weight is decreased and/or reproductive capacity is impaired (6,7,8).
   [00059]  The invention also relates to antibodies generated against epitopes on the antigens according to the invention (so called idiotype antibodies) and to antibodies generated against the variable region of those first antibodies, (so called anti-idiotype antibodies) which mimic the protective epitopes on the antigen and may be used as effective vaccines in either passive protection of animals (idiotypes) or active immunization of animals (anti-idiotypes) and thereby result in effective protection.

BRIEF DESCRIPTION OF THE DRAWINGS

   [00060]  FIG. 1 is a schematic representation of the method for the isolation of the "WGL post IEF pool" and "LL Post IEF pool".
   [00061]  FIG. 2 is a schematic representation of the fractionation procedure for the isolation of "LL.sup.+ antigen".
   [00062]  FIG. 3 is a schematic representation of the fractionation procedure for the isolation of "WGL.sup.+ antigen".
   [00063]  FIG. 4 is a simplified schematic representation of the purification procedure for the isolation of WGL.sup.+ and LL.sup.+ antigens.
   [00064]  FIGS. 5A and 5B show purity of the WGL.sup.+ antigen.
   [00065]  FIGS. 6-6(2) show the DNA sequence for the WGL.sup.+ gene (bases 1-2012 of SEQ ID NO:55 and SEQ ID NO:56).
   [00066]  FIG. 8 shows the translated amino acid sequence (residues 11-688 of SEQ ID NO:57) for the WGL.sup.+ antigen deduced from the DNA sequence.
   [00067]  FIGS. 8A-8B show a restriction enzyme map for part of the WGL.sup.+ gene showing an example of the expression strategy.
   [00068]  FIGS. 9A and 9B show a SDS polyacrylamide gel and immunoblot demonstrating expression of WGL.sup.+ by bacteria.
   [00069]  FIGS. 10A-10C show hybridization of the Boophilus microplus DNA coding for WGL.sup.+ to DNA from other tick species.
   [00070]  FIGS. 11-11(2) show the DNA sequence (SEQ ID NO:58) for the YBm017 gene and the translated amino acid sequence deduced from the DNA sequence (SEQ ID NO:59). YBm017 is an Australian isolate (Yeerongpilly, Queensland) of Boophilus microplus.
   [00071]  FIGS. 12-12(2) show the DNA sequence (SEQ ID NO:60) for the YBm22M8 gene and the translated amino acid sequence (SEQ ID NO:61) deduced from the DNA sequence. YBm22M8 is an Australian isolate (Yeerongpilly, Queensland) of Boophilus microplus.
   [00072]  FIGS. 13-13(2) show the DNA sequence (SEQ ID NO:62) for the Bm023 gene and the translated amino acid sequence deduced from the DNA sequence (SEQ ID NO:63). Bm023 is another Australian isolate of Boophilus microplus.
   [00073]  FIGS. 14-14(2) show the DNA sequence (SEQ ID NO:64) for the Vbm021 gene and the translated amino acid sequence deduced from the DNA sequence (SEQ ID NO:65). VBm021 is a Venezuelan isolate of Boophilus microplus.
   [00074]  FIGS. 15-15(2) show the DNA sequence (SEQ ID NO:66) for the MexBm86 gene and the translated amino acid sequence deduced from the DNA sequence (SEQ ID NO:67). MexBm86 is a Mexican isolate of Boophilus microplus.
   [00075]  FIG. 17 shows a partial DNA sequence (SEQ ID NO:68) for the Ra442 gene and the translated amino acid sequence deduced from the DNA sequence (SEQ ID NO:69). Ra442 is a Rhipicephalus appendiculatus isolate.

BEST MODE OF CARRYING OUR THE INVENTION

   [00076]  The invention is further described in the following examples which are illustrative of the invention but in no way limiting on its scope. ______________________________________ SOURCE OF REAGENTS ______________________________________ Sephacryl Pharmacia Sepharose 6 MB Pharmacia Zwittergent 3-14 Calbiochem Sephadex Pharmacia Brij 35 Sigma Bio-gel Bio Rad Cyanogen Bromide Sigma or Ajax Sarkosyl Sigma Endoproteinase lys-c Boehringer Triflouroacetic acid Pierce HFBA Pierce Acetonitrile Mallinckrodt Columns for HPLC Waters, BioRad, Beckman Poly U Sepharose Collaborative research Oligo dT cellulose Collaborative research dATP, dCTP, dGTP and dTTP Boehringer .sup.32 P-labelled deoxynucleic acid Amersham triphosphates Spermidine Calbiochem PEI cellulose Merck Concanavalin A-Sepharose Pharmacia CNBr-Sepharose Pharmacia Other chemicals used were of reagent grade. ______________________________________ ABBREVIATIONS ______________________________________ HPLC High performance liquid chromatography SDS Sodium dodecylsulfate EDTA Ethylenediaminetetraacetic acid WGL Wheat germ lectin WGL 1 Wheat germ lectin bound antigen pool 1 WGL 2 Wheat germ lectin bound antigen pool 2 WGL.sup.+ Wheat germ lectin bound antigen WGL.sup.- Wheat germ lectin unbound IEF Iso electric focussing LL Lentil lectin LL.sup.+ Lentil lectin bound antigen LL.sup.- Lentil lectin unbound HEPES N-2-Hydroxyethylpiperazine-N.sup.1 -2-ethane- sulfonic acid Endo lys C Endoproteinase lys C DTT dithiothreitol pI isoelectric point HFBA heptafluorobutytic acid BSA bovine serum albumin MMLV murine maloney leukemia virus dNTP deoxy nucleotide triphosphate dATP deoxy adenosine triphosphate dCTP deoxy cytidine triphosphate dGTP deoxy guanidine triphosphate dTTP deoxy thymidine triphosphate d(GCT)TP a mixture of dGTP, dCTP, and dTTP NAD nicatinamide adenine dinucleotide ATP adenosine triphosphate PEI polyethyleneimine BRL Bethesda Research Laboratories IBI International Biotechnologies Inc. A260, A280 Absorbance at 260 or 280 nm cDNA Complementary DNA ds double stranded g gram g.sub.av average gravity units m,μ,n,p (prefixes) milli, micro, nano, pico M Molar l liter U Units of activity (restriction enzymes) bp base pairs Kb Kilobase pairs (thousand base pairs) TLC Thin layer chromatograph ELISA enzyme linked immunoabsorbent assay ______________________________________ BUFFERS ______________________________________ 10 × 1st strand 0.5M Tris pH 7.5 0.75M KCl 0.03M MgCl.sub.2 5 × 2nd strand (RNase H) 0.2M Tris pH 7.5 0.05M MgCl.sub.2 0.1M (NH.sub.4).sub.2 SO.sub.4 1M KCl 1.5 mm B-NAD 10 × Methylase Buffer 0.5M Tris pH 7.5 0.01M EDTA 10 × TA Buffer 0.33M Tris-Acetate pH 7.9 0.66M K-Acetate 0.1M Mg-Acetate 5 × Kinase Buffer 0.05M Tris pH 7.5 0.05M Mg Cl.sub.2 0.05M DTT 0.5 mM Spermidine 10 × Ligation Buffer 0.3M Tris pH 8 17 mM EDTA 70 mM MgCl.sub.2 10 mM ATP 0.1M DTT 20 ug/ml BSA 1 mM Spermidine 10 × High Salt Buffer 1M NaCl 0.5M Tris pH 7.5 0.1M MgCl.sub.2 10 mM DTT 10 × S1 Buffer 0.3M NaAcetate pH 4.4 2.5M NaCl 10 mM ZnCl.sub.2 TE 10 mM Tris pH 7.5 1 mM EDTA PEI cellulose buffer 0.75M KH.sub.2 PO.sub.4 pH 3.5 Buffer A 0.05M Tris 0.03M acetic acid 0.1M NaCl ______________________________________

TEAB buffer

   [00077]  TEAB is a solution of triethylamine equilibrated to pH 7 by bubbling CO.sub.2 through the solution. It is prepared as a 1M stock solution which is stored at 4° C. The pH is checked before use, the solution being re-equilibrated with a CO.sub.2 pellet if required.

EXAMPLE 1

   [00078]  (a) Demonstration that at least some of the protective antigens are glycoproteins.
   [00079]  Since the majority of plasma membrane proteins are glycoproteins, initial attempts at further characterization of the protective antigen(s) focussed on lectin affinity.
   [00080]  It was found that wheat germ lectin and Concanavalin A bound to several components of tick antigen preparation B4/B5. Thus it appeared that a number of antigens in the tick preparation bear terminal N-acetylglucosamine residues and it is recognised that wheat germ lectin could be replaced in the purification scheme by other lectins with the same or similar terminal sugar specificity.
   [00081]  Approximately 2.1 mg of antigen B4/B5 purified by the narrow range isoelectric focussing procedure (described in Australian Patent Application No. 45936/85) was applied to a column of WGL-Sepharose 6 MB (14) in 0.05M Tris chloride buffer, 1% Zwittergent 3-14, pH 8 and washed with the same buffer. Bound glycoproteins were then eluted with 100 mg/ml N-acetylglucosamine in the same buffer. Bound and unbound material was used to immunize sheep (Two vaccinations in Freunds incomplete adjuvant using five sheep per group). Induced immunity was estimated by applying freshly moulted adult ticks to the sheep and measuring the success of engorgement by the proportion of female ticks which finally engorged, relative to the number attached to the sheep skin three days after initial application of the young adults (Table 1). TABLE 1 ______________________________________ Immunization of Sheep with Glycoprotein Preparations Percentage of Ticks Group Engorging ______________________________________ Controls 100, 100, 100, 100, 100 Material not binding to WGL 100, 6, 93, 100, 100 Material binding to WGL 0, 93, 0, 83, 28 ______________________________________
   [00082]  It is clear that some animals in each vaccinated group were highly protected from tick challenge. Serum was obtained from each sheep in this experiment after vaccination but before tick challenge and the antibody titres of each serum sample against the antigens used in the vaccine were measured by radioimmunoassays. The animals in each group which showed tick damage had high antibody titres against the antigen preparation injected whereas those which had low titres allowed large numbers of ticks to engorge without any visible signs of damage (data not shown). It appears that protective antigens were present in both fractions used in this experiment but failure to observe tick damage with some animals was due to the failure of those animals to respond vigorously to vaccination for reasons which are currently unclear.
   [00083]  (b) In a subsequent experiment with sheep, fraction GF5 and 6, the more highly purified gel filtration fractions (Australian Patent Application No. 45936/85) were chromatographed on a WGL-sepharose affinity column and the specifically bound and the unbound material was used to vaccinate sheep in a similar way to that described above. Again, for some animals in each group, the immune response generated by vaccination with either fraction was capable of producing damage to ticks feeding on those animals as demonstrated by the lower numbers of viable ticks recovered from the sheep (% surviving), the percentage of those ticks where were red in colour (% damage) and the lower weight of those ticks which survived or engorged (Table 2). TABLE 2 __________________________________________________________________________ Number of Ticks Surviving/Number % Surviving Mean Group Animal No. Applied Ticks % Damage Weight __________________________________________________________________________ Controls 181 36/40 90% 0 254 182 45/50 90% 4 224 183 32/40 80% 3 214 WGL 121 27/40 67.5% 19 182 unbound 122 27/40 67.5% 41 179 123 30/40 75% 3 223 WGL bound 124 27/40 67.5% 52 156 125 7/40 17.5% 100 11 180 9/40 22.5% 100 11 __________________________________________________________________________
   [00084]  In particular the material which was specifically bound to the affinity column is to be characterized herein but the protective antigens in the unbound fraction are also clearly capable of giving protection.
   [00085]  (c) An experiment similar to that described above was performed in which cattle were vaccinated with material which had specifically bound and material which failed to bind to a WGL-Sepharose column (Table 3). Again, the immune response generated by both fractions following vaccination gave indications of damage to ticks feeding on vaccinated cattle. The material which failed to bind to the WGL-Sepharose column was particularly effective in this experiment. TABLE 3 ______________________________________ Animal Group No. Tick No. % Damage Weight (mg) ______________________________________ Controls 943 239 2 226 944 190 7 216 957 282 1 245 WGL bound 945 214 22 202 960 125 64 183 962 188 5 218 WGL unbound 938 19 84 148 950 10 97 164 959 25 92 140 ______________________________________ NOTE: Tick no. in this and subsequent experiment refers to the average number of engorged female ticks dropping from each animal per day. Three weeks after vaccination, cattle are challenged with approximately 1000 larvae per day for a period of at least 16 days. When the ticks mature an engorged female ticks are observed, the engorged female ticks are collected each day and counted for a period of at least 16 days. This number is averaged over that period and presented in the Tick no. column. On each day during this period, the number of ticks which are visibly damaged are scored (red ticks) and that proportion listed in the % damage column. The average weight of the engorged females is also determined. (d) Concurrently with this experiment, the material which had specificall bound to the WGLsepharose column was fractionated on SDS polyacrylamide gels. Silver stains of these gels showed two major staining components which were excised (fractions S2 and S4) and these, as well as the intermediate portions of the gels (fractions S1, S3, S5 and S6) were used to vaccinate cattle. The most highly protective fraction was S2 (Table 4) which corresponds to one of the bands observed in stained gels which has an apparent molecular weight of approximately 80-90 kilodaltons in this gel system compared with Pharmacia and BRL molecular weight markers.
   [00086]  In this experiment, the number of ticks surviving on the cattle vaccinated with S2 was reduced compared with the other groups (Tick No column--the average number of engorged adult female ticks dropping from each animal per day over the 21 day period studied). In addition, the majority of the surviving ticks were red or appeared to be otherwise abnormal when examined visually (% damage) and the weight of those surviving ticks in the S2 group was reduced compared to the ticks from the animals in the other groups (Table 4). TABLE 4 ______________________________________ Group Animal No. Tick No. % Damage Weight ______________________________________ S1 947 196 10 215 951 194 1 230 963 243 30 198 S2 941 115 66 147 942 86 87 150 953 173 32 192 S3 961 166 3 212 967 240 4 243 968 193 4 233 S4 939 163 1 229 940 155 4 229 952 149 9 258 S5 937 276 3 248 955 232 2 225 956 160 5 221 S6 946 269 12 222 954 157 19 297 958 281 1 245 ______________________________________
   [00087]  (e) In vitro experiments were conducted in which a range of lectins were tested to determine which were capable of reacting with the material not retained on the WGL-sepharose column. Lentil lectin was found to be reactive and therefore the material not bound to the WGL-Sepharose was fractionated on a lentil lectin column (15). Cattle were vaccinated with these fractions, and the immune response generated against the material not bound to WGL-sepharose but bound to the LL-sepharose was found to result in some small indication of damage to ticks feeding on vaccinated cattle (Table 5). SDS gel analysis of this fraction shows a band which has a molecular weight which is in the same range as the S2 antigen identified in the previous experiment. TABLE 5 ______________________________________ Group Animal No. Tick No. % Damage Weight ______________________________________ Controls 990 195 0.7 252 980 220 0.7 243 979 248 0.6 252 WGL unbound 1006 183 6.2 196 LL unbound 1002 188 0.3 233 988 185 30.8 197 WGL unbound 1001 270 3.9 244 LL bound 996 267 1.1 252 994 249 16.1 206 ______________________________________
   [00088]  Both fractions used in this experiment were capable of generating an immune response which was capable of giving some indication of protection in this experiment.
   [00089]  The lentil lectin chromatography step produced a far greater yield of material having a similar molecular weight to the S2 antigen than was produced by the wheat germ lectin chromatography step.
   [00090]  This similarity in molecular weight and difference in lectin affinity suggested that the molecules may have been related by a common peptide backbone but differed in glycosylation.
   [00091]  This was later disproved (Example 2g).
   [00092]  Due to the presumed similarity to S2 and greater abundance of the LL bound material it was proposed that this material be used as a starting material for further purification.
   [00093]  However, subsequent poor vaccination results with this material in the light of good vaccination results with WGL bound material (Example 3) and demonstrated differences in amino acid composition have led to further purification schemes and cloning schemes being developed for the S2 or WGL.sup.+ material.

EXAMPLE 2

   [00094]  Knowing from the above results the iso-electric point, molecular weight and lectin binding characteristics of the major protective antigen (referred to above as S2), a number of experiments were performed in order to improve the efficiency of the isolation procedure. The following method has been devised which yields at least 10 times more of the S2 antigen (later referred to as the wheat germ lectin bound antigen, WGL.sup.+ antigen or WGL.sup.+) and lentil lectin bound antigen (later referred to as the LL.sup.+ antigen or LL.sup.+) than the methods described in Australian Patent Application No. 45936/85.
   [00095]  The procedure is outlined in the flow charts (FIGS. 1, 2, 3, and 4).

Improvement of the Procedures for Isolation of the Major Protective Antigen

   [00096]  (a) Isolation and Extraction of Tick Membrane and Particulate Material
   [00097]  1290 grams of semi-engorged adult female Boophilus microplus were picked from cattle on the day prior to the completion of engorgement. They were homogenised in 0.05M Tris, 0.025M acetic acid, 0.1M sodium chloride, 1 mM EDTA, the homogenate strained through fine gauze and the retained material, which was mostly cuticle fragments, was rinsed with buffer. A total of 3 ml of buffer per gram of ticks was used in the extraction. The suspension of tick material was then mixed with 350 mg phenylmethanesulfonyl fluoride per liter and centrifuged at 600× g.sub.av for 15 min. The supernatant was then centrifuged at 20,000× g.sub.av for 30 min and the supernatant from that, centrifuged for 100,000× g.sub.av for 1 h. Precipitates were collected from each of these centrifugation steps and frozen at -20° C. until used.
   [00098]  The 600× g, 20,000× g and 100,000× g precipitates were thawed, suspended in buffer A (0.05M Tris, 0.03M acetic acid) and the protein concentration was measured. The suspension was diluted in buffer A containing Brij 35 to final protein and detergent concentrations of 5 and 10 mg/ml respectively. The tick material was extracted at 37° C. for 1 h then centrifuged at 3,300× g.sub.av for 30 min at 20° C. The precipitate was resuspended in buffer A and the protein concentration re-assayed. Extraction was repeated at the protein and detergent concentrations used before, substituting Zwittergent 3-14 for Brij 35, while the extraction time was lengthened to 90 min. The suspension was centrifuged as before and the supernatant was retained.
   [00099]  (b) Lectin Affinity Chromatography and Isoelectric Focussing (FIG. 1)
   [00100]  The supernatant from the Zwittergent 3-14 extraction, (3255 ml), was stirred with 90 ml of WGL Sepharose for 16 h at 20° C., filtered and the WGL-Sepharose conjugate was poured into an 18×2.5 cm column, washed with buffer A containing 1% Zwittergent 3-14 then eluted in buffer A containing 1% Zwittergent 3-14 and 100 mg/ml N-acetylglucosamine. Fractions were pooled on the basis of the A280 absorption of specifically eluted material to give wheat germ lectin bound pool 1 (WGL1).
   [00101]  The adsorption of the detergent supernatant with WGL-Sepharose and subsequent elution of bound material was repeated as described above to give WGL2. The two eluates were then pooled (WGL pool).
   [00102]  The WGL pool was dialysed against 2×2.5 liters of water, then against 0.05M Tris-chloride buffer pH 7.5 containing 0.1M ammonium thiocyanate. Concanavalin A-Sepharose (Pharmacia) was poured as a 2.5×11 cm column and washed in buffer containing 0.05M Tris, 1% Zwittergent 3-14, 0.1 mM calcium chloride, 0.1 mM manganese chloride, 0.1M ammonium thiocyanate, adjusted to pH 7.5 with hydrochloric acid. The WGL pool was loaded on this column, washed and the specifically bound material was eluted in the same buffer to which had been added 50 mg/ml methyl-α-D-mannopyranoside. Fractions were pooled, dialysed against water then subjected to preparative isoelectricfocussing.
   [00103]  Isoelectricfocussing was carried out in a flat bed of IEF Sephadex containing 1% (w/v) Zwittergent 3-14 and Pharmalyte 4-6.5 diluted 1 to 15 (v/v) for 10,000 Vhr. Individual fractions were analysed by SDS gel electrophoresis. The required protein appeared to be present in fractions with pI's of 5.3 to 5.7 though, for the sake of better purification, only those fractions with pI's of 5.4 to 5.6 were pooled to give "WGL post IEF pool".
   [00104]  The Zwittergent 3-14 soluble material left after the second extraction with WGL-Sepharose was mixed with 70 ml of LL-Sepharose and stirred for 24 h at 20° C., the suspension was filtered and the collected Sepharose conjugate was poured as a 2.5×14 cm column. This was then washed with Tris-acetate, 1% Zwittergent 3-14 buffer and eluted in the same buffer containing 50 mg/ml methyl-α-D-manno-pyranoside. Fractions were pooled on the basis of their A280 and dialysed against water. Further fractionation was carried out by preparative isoelectric focussing using the conditions already described for material which bound to WGL. Fractions were analysed by SDS polyacrylamide gel electrophoresis. The protein being isolated focussed over a pI range of 4.8 to 5.2 though the fractions which were pooled for further purification covered the range of 4.8 to 5∅
   [00105]  The LL unbound material from the first affinity chromatography was readsorbed to LL-Sepharose and the material specifically eluted with methyl-α-D-mannopyranoside was separated by IEF. Material with the same pI range of 4.8 to 5.0 was pooled, then the products of the two experiments mixed to give "LL post IEF pool".
   [00106]  The method for the isolation of "WGL post IEF pool" and "LL post IEF pool" is shown schematically in FIG. 1.
   [00107]  (c) Hydrophobic Chromatography of LL Post IEF Pool (FIG. 2)
   [00108]  A 1.6×6.5 cm column of LL-Sepharose was equilibrated in 0.1M Tris-acetate buffer, 1% Zwittergent 3-14 pH 8∅ The "LL post IEF pool" was adjusted to pH 7.1 and applied to this column which was subsequently washed with buffer, then with 0.1M Tris-acetate buffer, 0.1% Brij pH 7.5. Bound material was then eluted with 0.1M Tris-acetate-Brij buffer containing 50 mg/ml methyl-α-D-mannopyranoside.
   [00109]  Eluted material was dialysed against 0.1M Tris-acetate-Brij buffer then ammonium sulfate was added to a final concentration of 0.5M. The sample was applied to a 7.5×75 mm TSK phenyl-5-PW column which had been equilibrated in 0.1M Tris-acetate, 0.5M ammonium sulfate, 0.1% Brij, pH 7.5 and, after washing, the column was resolved with a linear gradient from this starting buffer to a buffer containing 0.1M Tris-acetate, 0.1% Brij pH 7.5. Fractions were analysed by SDS gel electrophoresis and those containing the required protein pooled to give "LL.sup.+ antigen" or LL.sup.+.
   [00110]  This procedure is shown schematically in FIG. 2.
   [00111]  (d) Size Exclusion Chromatography of WGL Post IEF Pool (FIG. 3)
   [00112]  The pH of the "WGL post IEF pool" was increased to 7.3 and the material then loaded on a column of WGL-Sepharose equilibrated in 0.05M Tris-chloride, 0.2% Zwittergent 3-14 pH 7.5. The column was washed with 0.05M Tris-chloride, 0.1% SDS, then bound material eluted in Tris-chloride-SDS buffer containing 100 mg/ml N-acetylglucosamine. Fractions were analysed by SDS electrophoresis and those containing the required protein pooled, dialysed against 0.05M Tris-chloride buffer pH 7.5 and concentrated on a Savant Speedvac.
   [00113]  Size exclusion chromatography was carried out using a Waters HPLC system and, in sequence, an Si200 Polyol guard column (Serva, Heidelberg), a 7.5×30 cm Bio-Sil TSK 4000 and a 7.5 mm×30 cm PP 300 SW (Waters). Chromatography was carried out in a buffer containing 0.05M HEPES, 0.1M sodium thiocyanate, 0.1% SDS, the pH adjusted to 7.0 with sodium hydroxide, at a flow rate of 1 ml/min and a column temperature of 37° C. In this system, bovine serum albumin had an elution time of 13.8 min and ribonuclease A of 17.7 min. Fractions were analysed by SDS gel electrophoresis. The material of interest was found to elute from the HPLC column at between 14.0 and 15.0 min and these fractions were pooled.
   [00114]  The product of this step still contained some impurity of lower molecular weight. It was therefore loaded on a 0.6×10 cm column of WGL-Sepharose in 0.05M Tris-chloride, 0.1% SDS pH 7.5, washed in this buffer, then the bound material was eluted in the same buffer containing firstly 20 mg/ml then 100 mg/ml N-acetylglucosamine. Fractions were analysed by SDS gel electrophoresis and pooled on a basis of the amount and purity of the desired protein in each. They were concentrated and re-chromatographed on HPLC size exclusion chromatography as described above. The final pool of fractions containing the desired antigen ("WGL.sup.+ antigen") was made after analysis by SDS gel electrophoresis as described above.
   [00115]  This procedure is shown schematically in FIG. 3.
   [00116]  (e) Protein Determination
   [00117]  Four methods of protein determination were used during antigen isolation, the methods being chosen on a basis of sensitivity required and the nature of expected interfering substances. These methods, and the abbreviations used for them in FIGS. 1, 2 and 3 were:
[00118]  1. Biuret method; abbreviated (B)
[00119]  2. Spectrophotometric method, from A280 and A260 measurements; abbreviated (S).
[00120]  3. Fluorescence method, from the integrated fluorescence of high molecular weight material after derivatization with o-phthalaldehyde; abbreviated (F).
[00121]  4. Absorbance method, based on the integrated A280 from HPLC chromatographic runs, assuming that a 1 mg/ml solution of the protein in a 1 cm light path had an absorbance at 280 nm of 1; abbreviated (A).
   [00122]  (f) Comments on the Isolation Procedure
   [00123]  The major residual problem with the procedure described above is that in some preparations of the WGL.sup.+ antigen, a contaminant of lower molecular weight was observed as judged by SDS polyacrylamide gel electrophoresis. This contaminant could be partially, though not entirely, removed by repeating the affinity chromatography on WGL-Sepharose in SDS buffer and elution at two concentrations of N-acetylglucosamine.
   [00124]  The amounts of this impurity are variable from preparation to preparation. In a subsequent antigen isolation it was present in minor amounts and good antigen purity was obtained after pooling fractions with pI's in the range 5.30 to 5.67 on preparative isoelectricfocussing, followed by a single HPLC size exclusion chromatography. The yield of WGL.sup.+ antigen was thus higher (approximately 300 μg from 1.3 kg of ticks).
   [00125]  FIG. 5 shows SDS-polyacrylamide gel profiles of fraction GF 5/6, the starting material in this work, (lane 2) and of the purified WGL.sup.+ antigen (lanes 4 & 5) and LL.sup.+ antigen (lanes 6 & 7) together with appropriate molecular weight markers (lanes 1, 3 & 8). It is clear from these gels that the GF 5/6 fraction is very impure and contains a large number of components in addition to the WGL.sup.+ antigen which is in fact such a minor component that it can not be distinguished from the other components in the fraction. The WGL.sup.+ and LL.sup.+ antigens are highly purified. In lane 5 which is an overloaded sample of WGL.sup.+ antigen, a small amount of the contaminating material at lower molecular weight can just be seen.
   [00126]  (g) Amino Acid Composition of WGL.sup.+, and LL.sup.+ Antigens
   [00127]  Samples of the WGL.sup.+ and LL.sup.+ antigens isolated by the new purification procedure were analysed by amino acid analysis. The HPLC plots and calculated amino acid compositions derived from the HPLC printout by integration of the areas under each peak (Table 6) indicate that the antigens have different amino acid compositions. In addition the antigens clearly have different terminal sugar residues accounting for the different lectin binding characteristics. TABLE 6 ______________________________________ Amino Acid Compositions of Tick Antigens (mole %) WGL.sup.+ LL.sup.+ Antigen ______________________________________ Asp 7.4 11.0 Glu 6.8 10.3 Ser 9.7 7.4 Gly 7.4 10.5 His 2.9 2.9 Arg 5.0 5.2 Thr 9.0 5.6 Ala 9.1 6.8 Pro 5.9 5.2 Tyr 4.8 3.9 Val 7.9 6.5 Met 1.9 2.9 Cys 1.4 0.5 Ile 4.7 4.5 Leu 6.6 8.8 Phe 4.1 4.0 Lys 5.4 3.8 ______________________________________ NOTES: Trp is destroyed in this assay. The results presented are obtained from samples taken after 24, 48 and 72 hours of acid hydrolysis.

EXAMPLE 3

Vaccinal Activities of WGL.sup.+ and LL.sup.+ Antigens

   [00128]  Samples of WGL.sup.+ antigen (21 μg) and LL.sup.+ antigen (400 μg) were homogenised in Freunds Complete adjuvant and used to vaccinate cattle (1/10 of each preparation per animal per vaccination) as described in Australian Patent Application No. 45936/85. Vaccinated animals, together with control cattle were challenged with ticks and the numbers of engorged female ticks dropping from the experimental animals was monitored over a 16 day period (Table 7). It is clear that cattle vaccinated with very small amounts of WGL.sup.+ antigen were strongly protected from infestation in that the number of ticks dropping from each animal per day was reduced, the weight of the surviving ticks was lower and a high proportion of the surviving ticks were visibly damaged as a result of gut damage allowing cattle blood components to pass into the haemolymph of the ticks (% Red column). In addition, the ticks which survived on the cattle vaccinated with the WGL.sup.+ antigen had a greatly reduced capacity to produce eggs compared to the control animals. TABLE 7 ______________________________________ Animal Wt. eggs/ Tick No. Wt. Ticks Antigen No. Tick Wt. % Red ______________________________________ 26 0.49 Controls 199 224 6 29 0.52 237 231 3 31 0.47 227 220 1 28 269 223 9 36 WGL.sup.- 186 228 3 40 LL.sup.- 170 199 4 27 272 224 2 35 LL.sup.+ antigen 338 262 0 37 (130 μg) 238 233 1 30 0.16 25 152 86 32 0.25 WGL.sup.+ antigen 135 175 79 34 0.22 (7 μg) 38 152 70 ______________________________________
   [00129]  The LL.sup.+ antigen at a higher dose failed to give significant protection to the cattle despite the fact that the cattle had mounted a strong immune response to the vaccine as determined by ELISA [data not shown].
   [00130]  Both WGL.sup.+ and LL.sup.+ antigens appeared to be largely pure by SDS gel electrophoresis (FIG. 5) and both have similar molecular weights of approximately 89 kd in the gel system used compared to the BRL molecular weight standards used.
   [00131]  The new purification procedure outlined above is an improvement over that used previously giving a yield of 33-300 μg WGL.sup.+ antigen compared with approximately 3 μg of "S2" antigen per 1.29 kg tick starting material. It is asserted that these two antigens (WGL.sup.+ and S2) are the same glycoprotein based on similar molecular weight, isoelectric point, lectin binding properties, amino acid composition and vaccinal efficacy.

EXAMPLE 4

   [00132]  Digestion of WGL.sup.+ antigen with endoproteinase lys-C, separation of oligopeptides, determination of the amino acid sequence of oligopeptides and design of oligonucleotide sequences suitable as hybridization probes to detect recombinant organisms containing DNA sequences coding for the WGL.sup.+ peptide.
   [00133]  Approximately 40 μg of WGL.sup.+ antigen purified as described in Example 2 was mixed with 100 μl of 0.1M Tris-chloride buffer pH 8.3 containing 20 mM dithiothreitol and 2% (.sup.w /v) SDS, then incubated at 56° C. for 30 min. The solution was then cooled to room temperature and sodium iodoacetate added to a final concentration of 0.14M. After 45 min. in the dark, cold methanol was added in a ratio 9:1 methanol:sample (.sup.v /v). The sample was stored at -20° C. overnight, centrifuged, the supernatant removed and the precipitate dried.
   [00134]  The precipitate was then dissolved in 76 μl of 0.1M Tris-chloride buffer containing 4M urea, pH 8.5, then 4 μl of endo lys C (6 units per ml) was added. After 2 hrs at 37° C., another 4 μl of enzyme was added and the digestion was continued for a further 17 hrs.
   [00135]  The digest was applied directly to an Aquapore RP-300 C-8 column in 0.1% trifluoroacetic acid and peptides were eluted in a linear gradient from 0-60% .sup.v /v acetonitrile/water in 0.1% trifluoroacetic acid. If necessary, peptides were rechromatographed in the same solvent system using an Aquapore 318 column. Peptides were collected, concentrated to 50-100 μl by rotary dessication in a rotary evaporator. The amino acid sequences of the oligopeptides were determined using an Applied Biosystems amino acid sequencer. The following peptide sequences were obtained. The one letter and 3 letter codes used for amino acids are shown in Table 8.

Fragment Number

   [00136]  F1(SEQ ID NO:1) (K).sup.1 D P D P G K (20-mer oligonucleotide)
   [00137]  F2(SEQ ID NO:2) (K).sup.1 W Y E D (G).sup.2 V L E A I (X).sup.3 T S I G K (50-mer oligonucleotide)
   [00138]  F3(SEQ ID NO:3) (K).sup.1 (X).sup.4 Q A C E (H).sup.2 P I G E (W).sup.2 C M M Y P K (53-mer oligonucleotide)
   [00139]  (C).sup.5
   [00140]  F4(SEQ ID NO:4) (K).sup.1 E A G F V Q K (23-mer oligonucleotide)
   [00141]  In addition, the following peptide sequences were deduced from mixed sequences which may assist in the characterization of the clones although there is a great deal of uncertainty in some of these sequences (especially F7). __________________________________________________________________________ ##STR10## ##STR11## ##STR12## ##STR13## ##STR14## Oligonucleotides may be prepared using these amino acid sequences. For example the following could be used..sup.7 20-mer (SEQ ID NO: 37) .sup.5' T T A C C T G G A T C T G G A T C C T T.sup.3' 50-mer (SEQ ID NO: 38) TTA CCA ATG GAT GTA CAA ATA GCT TCA AGG ACA CCA TCT TCG TAC CAC TT ##STR15## __________________________________________________________________________ NOTES: The following assumptions were made in interpreting the peptide sequences and in designing oligonucleotides probes: Numbers 1-6 refer to superscripts in the peptide sequence listed above. 1. It was assumed that a lysine (K) preceded the first amino acid which was determined for each peptide based on the specificity of the endo lys-C. 2. These amino acids were assumed to be correct although they were detected at lower molar ratios than expected. 3. No amino acid could be confidently ascribed to the positions shown as X. 4. This position contained a number of amino acids. For the design of oligonucleotides, the correct amino acid was assumed to be either D, A or but may be another. 5. More than one amino acid was detected in some sequences. The uncertainty is denoted by brackets. 6. These sequences were mixed (square brackets) and the relative molar abundance of the amino acids detected was approximately the same in each cycle. 7. A number of approaches known in the art can be used to design oligonucleotides suitable for use as hybridization probes. For example inosine base can be incorporated in positions where a number of deoxyribonucleotides are used in the third positions of redundant codons. The reverse complementary sequences to those presented can also be used equally well as hybridization probes. In the examples shown the codon usage was based on the sequence for the mRNA coding for the brine shrimp elongation factor (12). TABLE 8 ______________________________________ amino acid three letter code one letter code ______________________________________ alanine ala A arginine arg R asparagine asn N aspartic acid asp D cysteine cys C glutamic acid glu E glutamine gln Q glycine gly G histidine his H isoleucine ile I leucine leu L lysine lys K methionine met M phenylalanine phe F proline pro P serine ser S thrionine thr T tryptophan trp W tyrosine tyr Y valine val V ______________________________________

EXAMPLE 5

   [00142]  Approximately 40 μg of WGL.sup.+ antigen was digested with endo lys-C as described in Example 4. The digest products were applied to an Aquapore RP-300 C-8 column in 0.1% heptafluorobutyric acid (HFBA) and peptides were eluted in a linear gradient from 0-60% acetonitrile/water in 0.1% HFBA. Selected fractions were then re-chromatographed on Aquapore RP-300 C-8 or C-18 columns using trifluoroacetic acid in place of HFBA. The most symmetrical fractions were analysed for the presence of amino acids by hydrolysis of one tenth of the sample in hydrochloric acid vapour, derivatization with O-phthalaldehyde followed by reverse phase separation on HPLC and detection by fluorescence. The remaining portions of the samples were dessicated to 50-100 μl volumes in a rotary evaporator and the amino acid sequence was determined using an Applied Biosystems amino acid sequencer.
   [00143]  The following peptide sequences were obtained. __________________________________________________________________________ FRAGMENT NUMBER __________________________________________________________________________ ##STR16## F11 (SEQ ID NO: 13) (K) W Y E D R V L E A I R T S I G K ##STR17## 51-merF13 (SEQ ID NO: 15) (K) T R E C S Y G R C V E S N P S K ##STR18## ##STR19## ##STR20## F17 (SEQ ID NO: 21) (K) L Q A C E H P I __________________________________________________________________________ NOTES: It was assumed that a lysine precedes each fragment (K). X indicates that no amino acid could be confidently ascribed to the position during the peptide sequencing. F10 and F15 were mixtures of two and three peptide fragments repectively (denoted by []).
   [00144]  F10 is the sequence of the same mixture of two peptides as analysed for F9. It is surprising that these two oligopeptides co-purified on both occasions as the peptide fractionation procedure was different in the two examples.
   [00145]  F11 and F2 are likely to be the same fragment as the only differences are that the two uncertain amino acids in the F2 sequence are both R in the F11 sequence. A larger amount of material was present in F11 so this sequence is likely to be correct.
   [00146]  F17 and F3 appear to be sequences of the same peptide. F3 could be read further as more material was present but F17 contained less impurities so the first residue could be identified.
   [00147]  From these amino acid sequences, oligonucleotides can be prepared which would be suitable for screening cDNA and genomic DNA banks to identify the gene coding for the WGL.sup.+ antigen. The following examples could be used (see note 7 in Example 4. In the following examples, the third position in the codons was chosen to minimise secondary structure, not on brine shrimp usage as used in Example 4). ##STR21##
   [00148]  In addition, degenerate shorter oligonucleotides could be synthesized. For example 64 fold degenerate 17-mer oligonucleotides could be designed using the sequence DFGNEF from the F12 sequence and from the sequences KAYECT and YECTCP from the F14 sequence. 16 fold degenerate 17-mer oligonucleotide mixtures could also be designed using the sequence CMMYPK from the amino acid sequence of F3 shown in Example 4. These short degenerate sequences may be useful to confirm that clones isolated using long oligonucleotides contain the desired DNA sequences coding for the WGL.sup.+ antigen.

EXAMPLE 6

Genetic Engineering of the WGL.sup.+ (S2) Antigen

   [00149]  The major limitation to the development of commercial vaccines using the WGL.sup.+ antigen is the limited availability of WGL.sup.+ material which can be obtained from natural sources. Means by which this limitation can be overcome include the construction by genetic engineering techniques of bacteria, yeast or other readily cultivated cells including mammalian or insect cell lines which synthesize large amounts of all or part of the WGL.sup.+ antigen. There are several means by which this goal can be achieved but they basically fall into a small number of steps which, by means of example only, are set out below.
   [00150]  In order to identify the recombinant organisms which contain the tick genetic information coding for the protein backbone of the WGL.sup.+ antigen, appropriate reagents must first be generated. These may be antibodies from animals vaccinated with the purified protective antigen or with partially purified preparations containing that antigen preferably following denaturation of the antigen with a suitable detergent such as SDS. Bacterial yeast or other cells which synthesize part or all of the WGL.sup.+ antigen must then be constructed and screened with the antiserum.
   [00151]  Preferably the WGL.sup.+ antigen is isolated in sufficient quantities in order to determine the amino acid sequence of the protein portion of the antigen or of fragments of the antigen produced as a result of endoproteolytic enzyme digestion using enzymes such as trypsin, endo lys C or pepsin or by chemical cleavage of the peptide using reagents such as cyanogen bromide. Fragments produced as a result of these treatments are separated and isolated using methods known in the art such as fractionation by HPLC reverse phase liquid chromatography or HPLC on columns containing hydrophobic resins, ion exchange resins or size fractionation resins. Preferably reverse phase resins such as C1, C8 or C18 are used singly or consecutively depending on the characteristics of the fragments produced as a result of the enzymatic or chemical treatment chosen.
   [00152]  Fragments of the WGL.sup.+ peptide produced as a result of these treatments are then analysed on a gas phase amino acid sequenator using methods known in the art. From the amino acid sequence and the known DNA sequences which encode each amino acid, oligonucleotide sequences can be prepared which are complementary to the DNA sequence coding for the antigen and these can be used in hybridisation experiments to identify recombinant organisms containing the DNA coding for the antigen. The DNA sequence of these reacting clones can then be determined to confirm that the sequence is the one of interest. The DNA sequence can then be used to design the best means by which the microorganisms can be engineered to manufacture large amounts of the polypeptide.
   [00153]  (a) Construction of Gene Libraries
   [00154]  Readily cultivated microorganisms which contain the genetic information coding for the WGL.sup.+ protective antigen can be constructed using synthesised DNA which is complementary to the RNA isolated from the appropriate developmental stage of ticks or using DNA fragments isolated from any stage of ticks, preferably eggs or larvae as they will not contain bovine blood.
   [00155]  If antibody probes are the only reagents available for detection of the clones containing the WGL.sup.+ antigen, cDNA or genomic DNA libraries must be constructed in a phage, viral or plasmid system which would result in the expression of the tick antigen or parts thereof. Such vectors include lambda gt11, bacterial plasmids such as pUR290, pUR291, pUR282, pUK270, pUC8, pUC9 or eukaryotic viral vectors such as the baculovirus, pZipNeo, or SV40-based vectors.
   [00156]  If oligonucleotide probes are available, clone libraries can be constructed using cDNA or genomic DNA fragments in a larger range of phage, plasmid and viral systems including, for example, lambda gt10, EMBL vectors, or plasmid vectors such as pBR327, pBR329 or pBR322.
   [00157]  Preferably cDNA libraries are generated since smaller numbers of clones have to be screened and any problems with expression through introns are avoided. Ideally the developmental stage of ticks which synthesis maximum levels of the WGL.sup.+ antigen are first identified. If antibodies are the only means available to do this, in vitro translation of RNA isolated from ticks of various ages followed by immunoprecipitation of the translation products with antibodies and analysis by SDS gel electrophoresis and fluorography enables the identification of the most suitable stage of ticks for extraction of RNA for construction of cDNA banks. The apparently low abundance of the WGL.sup.+ protein makes this approach very difficult. If oligonucleotides are available, hybridisation to the RNA isolated from ticks of various ages should enable the identification of the RNA source containing the highest abundance of mRNA coding for the WGL.sup.+ antigen.
   [00158]  RNA can be isolated from ticks and cDNA synthesized and cloned a number of methods known in the art can be used. The following methods are outlined by means of example only.
   [00159]  (b) Ethanol Precipitation
   [00160]  In the following methods, ethanol precipitation involves adding to the solution of nucleic acid, one tenth of the solution volume of 3M sodium acetate and three to four volumes of absolute ethanol. The mixture is then stored at -20° C. for at least 2 hrs or at -70° C. or in an ethanol/dry ice bath until the solution becomes viscous. The mixture is then centifuged usually at 12,000× g.sub.av for at least 10 minutes. The supernatant is carefully removed and the pellet containing the nucleic acid material (as well as other macro-molecules) is used in further manipulations.
   [00161]  (c) Ethanol Precipitation from 2M Ammonium Acetate
   [00162]  In high salt solutions (e.g. 2M ammonium acetate), the majority of unincorporated deoxynucleotide triphosphates (and other small molecular weight material) will remain in the supernatant after an ethanol precipitation. The procedure is as described above except an equal volume of 4M ammonium acetate is added to the solution instead of the sodium acetate followed by 3-4 volumes of ethanol before cooling as described above.
   [00163]  (d) Phenol or Phenol/chloroform Extraction
   [00164]  Phenol or phenol/chloroform extraction involves the addition to the nucleic acid solution of an equal volume of redistilled phenol or a 1:1 (.sup.v /v) mixture of phenol and chloroform equilibrated with 0.1M Tris pH 8. The contents of the tube are mixed and the phases separated by centrifugation. The upper (aqueous) phase is removed to a fresh tube and the phenol or phenol/chloroform is discarded. Usually the aqueous phase is re-extracted and then extracted with ether to remove remaining phenol. Optionally the phenol or phenol chloroform phase from the first extraction may be re-extracted by addition of TE, mixing and centrifugation. In this case, the two aqueous phases would be combined before ether extraction and further processing.
   [00165]  (e) PEI Cellulose TLC
   [00166]  To monitor incorporation of radioactive dATP into nucleic acids during the various reactions in this procedure, thin layer chromatography on PEI cellulose was performed in 0.75M phosphate buffer pH 3.5. An aliquot of material to be monitored is applied toward one end of a strip of PEI cellulose and, after the chromatogram is resolved, the strip is exposed to an X-ray film. Following development of the autoradiograph, the areas of the PEI cellulose strip containing radioactivity are cut, placed in vials and the radioactivity in each determined by Cherenkov counting in a scintillation counter. The proportion of the radioactive material at the origin of the chromatograph can be used to determine the success of the reaction. This procedure is referred to as PEI cellulose chromatography.
   [00167]  (f) Extraction of DNA and RNA
   [00168]  High molecular weight DNA and RNA are isolated from ticks picked from the host at different developmental stages. Ticks are homogenised at room temperature in an Omnimixer for 2-3 minutes in a buffer containing guanidine isothiocyanate (4.7M), Sarkosyl (7.4%), Tris (5 mM) and β-mercaptoethanol (70 mM). The homogenate is centrifuged at 4° C. at 14,000× g.sub.av for 10 minutes. Solid CsCl is added to the homogenate (1 g/2.5 ml) which is layered onto a CsCl cushion (2.5 g/ml) and centrifuged for 48 hours at 25,000 rpm in a SW28 rotor (Beckman). The upper layer is aspirated, the DNA band recovered and the RNA pellet recovered, precipitated with ethanol, washed several times with 70% ethanol and stored in TE at -70° C. until used.
   [00169]  Polyadenylated mRNA can be isolated by passage over oligo dT cellulose columns or poly U Sepharose columns using methods described by the manufacturers (Collaborative Research).
   [00170]  (g) cDNA Synthesis
   [00171]  Several methods can be used for the construction of cDNA banks in phage or plasmid vectors. The following method by means of example only is a modification of the "RNase H" method for construction of cDNA banks in lambda gt11. The method is outlined schematically in FIG. 6.
   [00172]  (h) First Strand Synthesis
   [00173]  2 μg of poly A.sup.+ RNA is dissolved in TE. Water is added to give a final volume of 25 μl. The solution is heated at 70° C. for 3 minutes then rapidly cooled on ice. To the cooled solution is added 5 μl 10×1st Strand Buffer, 5 μl 0.1M DTT, 5 μl Oligo-dT [Boehringer 100 ng/1 μl], 1.25 μl RNasin [Promega 40 U/μl], 2 μl BSA (5 mg/ml), 5 μl 10 mM d(GCT)TP, 0.5 μl 10 mM dATP and 3 μl M-MLV Reverse transcriptase [BRL 200 U/μl].
   [00174]  2.5 μl of the mixture is transferred to tube A (analytical reaction for monitoring synthesis) and 0.2 μl [.sup.32 P]dATP is added (0.2 μCi).
   [00175]  To the remaining bulk reaction 0.5 μl 50 mM dATP is added. The tubes are incubated for 30 minutes at 42° C. 0.25 μl 10 mM dATP is then added to tube A and the incubations continued for a further 30 minutes. A 0.5 μl sample is taken from tube A and ethanol precipitated for gel analysis. A further 0.2 μl sample is taken from the tube to be monitored by TLC on PEI cellulose.
   [00176]  If all of the 2 μg of RNA added to the reaction was poly A-adenylated, it can be calculated that approximately 30% incorporation of [.sup.32 P]dATP into nucleic acids is equivalent to 100% efficiency in first strand synthesis. Commonly RNA passaged over Oligo-dT cellulose once yields 6-10% incorporation.
   [00177]  To prepare a sample to monitor the second strand reaction, 2.5 μl of the bulk reaction is removed and precipitated with ethanol from 2M ammonium acetate. The sample is washed twice with 70% ethanol then resuspended in 2.5 μl 1×1st Strand Buffer in tube B.
   [00178]  (i) Second Strand (RNase H)
   [00179]  A solution of; 28 μl of water, 10 μl 10× RNase H Buffer; 1 μl 5 mg/μl BSA, 1.25 μl 10 mM d(GCT)TP, 0.5 μl 10 mM dATP, 1.6 μl RNase H [BRL 20 U/μl], 5 μl DNA Polymerase 1 [holoenzyme (Biolabs) 100 U/μl] and 2 μl E. coli DNA ligase, is prepared.
   [00180]  The solution is mixed, then 2.5 μl is dispensed into Tube B with 0.2 μl [.sup.32 P]dATP, 1.8 μl is dispensed into Tube A and the remainder is dispensed into the bulk reaction tube. 0.75 μl of 10 mM dATP is added to the bulk reaction tube. The three tubes are incubated at 15° C. for 60 minutes, then at 22° C. for a further 60 minutes.
   [00181]  A 0.2 μl sample from tube B is chromatographed on PEI cellulose to monitor the reaction. A further sample from tube B is ethanol precipitated from 2M ammonium acetate for gel analysis. The tube A sample from the first strand synthesis and the tube B second strand synthesis sample are run on a 1.5% agarose gel to determine the size of the cDNA which has been synthesized.
   [00182]  To prepare a sample to monitor the T.sub.4 polymerase reaction, 0.5 μl is taken from the bulk reaction tube and placed in Tube C.
   [00183]  The remaining contents of Tubes A and B are pooled with the bulk reaction. The contents of both the bulk reaction, and Tube C are extracted with phenol/chloroform (1:1), precipitated with ethanol from 2M ammonium acetate and the precipitates are washed twice with 70% ethanol.
   [00184]  (j) EcoR1 Methylation
   [00185]  A solution of 29.5 μl of water, 4 μl 0.1M DTT, 2 μl 10× EcoR1 Methylase buffer, 4 μl 1 mM S-adenosyl methonine [Biolabs] and 0.5 μ1 EcoR1 Methylase [Biolabs 20 U/μl] is prepared in a fresh tube. 2 μl of the mix is dispensed into Tube C and the remainder into the bulk reaction tube. The two tubes are incubated at 37° C. for 30 minutes then at 70° C. for a further 15 minutes then cooled in ice.
   [00186]  In a fresh tube, the following buffer is prepared: 4 μl 10× TA buffer, 2 μl 5 mg/ml BSA, 1.4 μl 0.1M DTT, 2 μl T.sub.4 DNA polymerase [Biolabs 1 U/μl] and 29.5 μl of water. 2 μl is added to tube C which is then incubated at 37° C. for 10 minutes. 0.5 μl of a solution containing 10 mM d(GCTA)TP is added to the remainder of the solution and this is added to the bulk reaction tube which is then incubated at 37° C. for 50 minutes, 70° C. for 15 minutes then ice quenched.
   [00187]  To Tube C 0.2 μl of each of 50 μM d(GTC)TP, [.sup.32 P]dATP [0.2 μCi] and 5 μM dATP are added and incubation is continued at 37° C. for a further 50 minutes, after which time 0.2 μl of the sample is spotted and chromatographed on PEI cellulose.
   [00188]  0.2 μl of 0.2 mM dATP represents approximately three times the amount of dATP required to add 2 adenosine residues to the 5' ends of each molecule, assuming that there was a total of 2 μg of dscDNA of average size of 1 kb synthesized after 2nd strand synthesis.
   [00189]  (k) Kinase
   [00190]  There is some indication that the kinase step is not necessary and can probably be omitted. To the bulk reaction 20 μl 5× Kinase buffer, 0.2 μl 0.1M ATP, and 0.5 μl polynucleotide kinase [Biolabs 4 U/μl] is added. The mixture is incubated at 37° C. for 60 minutes. The reaction is extracted with an equal volume of a phenol/chloroform mixture (1:1), the aqueous phases are pooled, precipitated by ethanol from 2M ammonium acetate then washed twice with 70% ethanol.
   [00191]  (l) Linker Ligation
   [00192]  To monitor the linker ligation reaction, samples are prepared for agarose and polyacrylamide gel analysis. ______________________________________ Agarose gel: Samples from bulk reaction (.sup.32 P cDNA) ______________________________________ Sample 1 cDNA before ligation to cold linkers Sample 2 cDNA after ligation to cold linkers Sample 3 cDNA after ligation to cold linkers and digestion with Eco R1 ______________________________________ Polyacrylamide gel: .sup.32 P linker samples ______________________________________ Sample 4 Tube D .sup.32 P linkers + cDNA before digestion with Eco R1 Sample 5 Tube D .sup.32 P linkers + cDNA after digestion with Eco R1 Sample 6 Tube E .sup.32 P linkers alone before digestion with Eco R1 Sample 7 Tube E .sup.32 P linkers alone after digestion with Eco R1 ______________________________________
   [00193]  The ligation mixture is prepared by adding to a fresh tube 9 μl EcoR1 linkers [Biolabs 200 ng/μl], and 1.7 μl of DNA ligase [IBI 3 U/μl]. 15 μl of ligation mixture is dispensed into the bulk reaction tube mixed quickly, then a 0.25 μl sample is removed and frozen on dry ice immediately for agarose gel analysis (Sample 1).
   [00194]  A 1 μl sample is taken from the bulk reaction tube and 0.2 μl .sup.32 P labelled EcoR1 linkers is added (Tube D: cDNA+linkers).
   [00195]  A 1 μl sample is taken from the remainder of the ligation mixture and 0.2 μl .sup.32 P labelled EcoR1 linkers are added (Tube E: linkers alone).
   [00196]  The bulk reaction and tubes D and E are incubated at 25° C. for 4 hours. Samples of 0.25 μl from the bulk reaction tube and 0.6 μl from tubes D and E are removed for agarose or polyacrylamide gel analysis respectively (Samples 2, 4 and 6).
   [00197]  The remainder of the bulk reaction and tubes D and E are heated for 5 hours at 70° C. then cooled on ice.
   [00198]  (m) EcoR1 Digestion
   [00199]  To a fresh tube 11 μl EcoR1 digestion buffer, 2 μl EcoR1 [IBI 18 U/μl] and 82 μl of water are added. 4 μl of the mixture is dispensed into the bulk reaction tube. The three tubes are incubated at 37° C. for 60 minutes. A further 2 μl aliquot of EcoR1 [36 U] is added to the bulk reaction tube and incubation is continued for a further 60 minutes. The remaining samples in tubes D and E are electrophoresed on agarose and acrylamide gels together with the samples taken from tubes D and E above. Autoradiographs of those gels demonstrate whether the reactions have worked.
   [00200]  A 1.4 μl sample is removed from the bulk reaction tube (Sample 3). The remainder of the bulk reaction is extracted with phenol/chloroform.
   [00201]  A 1% agarose gel is run loaded with 0.25 μl each of samples 1, 2 and 3. Samples 4, 5, 6 and 7 are run on a 12% polyacrylamide gel. Both gels are autoradiographed to determine whether all reactions have succeeded.
   [00202]  (n) Separation of Linkers from cDNA
   [00203]  A 1.2×21 cm Sepharose 4B column is equilibrated with 0.1M TEAB. 150 μl samples of EcoR1 digested linkered cDNA are loaded on to the column and fractions collected in TEAB buffer (250-500 μl). Fractions containing cDNA fragments with sizes greater than 600 bp as determined by mobility on agarose or polyacrylamide gels are pooled, evaporated to dryness in a rotary evaporator suspended in TE and ligated to EcoR1 digested and phosphatased lambda gt11 or gt10, packaged in vitro and infected onto suitable host strains such as Y1090 or Y1089 in accordance with suppliers instructions (Promega or Integrated Sciences).
   [00204]  (o) Screening Clones with Oligonucleotides
   [00205]  From the amino acid sequence of the WGL.sup.+ protein, peptide fragments derived from chemical cleavage of the WGL.sup.+ protein or endoproteolytic digestion peptides derived from the WGL.sup.+ protein, oligonucleotides coding for specific portions of the DNA coding for the protein can be designed and used in hybridisation experiments using procedures known in the art. The DNA sequence of hybridising fragments isolated from the library can then be determined and used to design strategies for engineering the gene for expression of the WGL.sup.+ protein or portions thereof for incorporation into an effective vaccine.
   [00206]  A cDNA library was constructed in lambda gt 11 using RNA isolated from young adult B. microplus which had been feeding on cattle for approximately 16 days. The phage were plated on E. coli strain RY1090 and grown at 37° C. for 16 hours. Nitrocellulose filters were placed on the plates and triplicate filters were taken from each plate. The DNA on the filters was denatured and fixed by baking at 80° C. under vacuum. The filters were incubated in prehybridization solution for 2-4 hours and then in hybridization solution for 16 hours essentially as described (10). The hybridization solution contained oligonucleotides which had been labelled with .sup.32 P using polynucleotide kinase (10) and ψ .sup.32 P-ATP (approximately 10.sup.5 cpm/ml of each oligonucleotide used).
   [00207]  For each set of three filters, two were hybridized to the 63-mer oligonucleotide and the remaining replicate filter was hybridized to a mixture of 51-mer, 72-mer, 50-mer, and 53-mer oligonucleotides. Following washing and autoradiography, plaques which gave rise to signals on all three filters were identified, picked and purified to single plaques.

EXAMPLE 7

Analysis of DNA Sequence of Gene Coding for WGL.sup.+ Antigen

   [00208]  The DNA isolated from one clone will be described in detail. This lambda gt11 clone contained three Eco R1 fragments of approximately 4 Kb, 1.5 Kb and 0.3 Kb. Southern hybridization (10) experiments showed that the 4 Kb fragment hybridized to the probes used. This fragment was therefore subcloned into a modified pUC 18 plasmid (giving pBTA 707) in host strain JM101 (recombinant host/plasmid referred to as BTA 1751 ATCC 67548). The 4 Kb fragment was then sonicated and subcloned into M13 mp18 for DNA sequence analysis.
   [00209]  M13 sub-clones were sequenced at random and the complete DNA sequence of the 4 kb inset compiled by assembly of the sequences of the sub-clones by use of an alignment computer program.
   [00210]  FIGS. 6-6(2) show the DNA sequence (bases 1-2012 of SEQ ID NO:55) for the 4 kb DNA fragment and the amino acid sequence (residues 11-688 of SEQ ID NO:56) which can be translated from one region of that DNA sequence into a protein sequence which is identified as the protein backbone of the WGL.sup.+ antigen. FIG. 8 shows that amino acid sequence using the one letter abbreviation code for amino acids (Table 8).
   [00211]  The peptide fragments identified during the peptide sequence analysis of endo lys-C digest products from the WGL.sup.+ antigen isolated from ticks are identified in FIGS. 6-6(2) (SEQ ID NO:56) and 8 (residues 11-688 of SEQ ID NO:57) by underlines and are tabulated in a summary in Table 9. References to aa numbers correspond to the numbering of amino acid residues shown in FIG. 7 and SEQ ID NO:56. TABLE 9 __________________________________________________________________________ ##STR22## ##STR23## ##STR24## ##STR25## ##STR26## ##STR27## ##STR28## ##STR29## ##STR30## ##STR31## ##STR32## ##STR33## ##STR34## ##STR35## __________________________________________________________________________
   [00212]  From the DNA sequence and the amino acid sequence deduced from that DNA sequence, it can be seen that the pre-pro-polypeptide of the WGL.sup.+ antigen consists of 650 amino acids (SEQ ID NO:56).
   [00213]  The DNA sequence coding for peptide F12 (SEQ ID NO:42) can be identified at the region 90-152 bp (FIGS. 6-6(2) (SEQ ID NO:55)) of the DNA sequence and corresponds to amino acids 20-40 in the amino acid sequence (FIG. 8, residues 30-50 of SEQ ID NO:57) of the protein. The amino acid preceding the N-terminal glu residue identified in F12 is not a lysine (K) as would be expected if F12 was generated as a result of digestion by endo lys-C. Therefore it is assumed that the F12 peptide fragment was generated by the action of a proteinase other than endo lys-C. The 19 amino acid sequence preceding the F12 N-terminal glu residue begins with a methionine and has hydrophobicity properties which are very similar to leader sequences which precede other secreted and membrane-bound proteins in eukaryote cells (see 9 for review). In addition, the majority of peptide leader sequences are cleaved at positions following A residues (9). It appears therefore that the F12 sequence is the N-terminus of the mature WGL.sup.+ polypeptide. This then indicates that the protein portion of the mature WGL.sup.+ polypeptide is 631 amino acids long and which would have a molecular weight of 69 729 daltons.
   [00214]  Assuming that the consensus sequence for N-linked glycosylation is Asn X (Ser or Thr) in ticks as has been reported to be the case in other eukaryotic cells (10) 5 potential sites for N-linked glycosylation can be identified in the mature polypeptide sequence (FIGS. 6-6(2). Carbohydrate residues added to these residues or to other amino acids in the WGL.sup.+ antigen produced by ticks would account for the differences in the observed molecular weight for the native antigen compared with that predicted from the DNA sequence.
   [00215]  By comparison of the amino acid sequence (Table 9) with the peptide sequences derived from the fractions from endo lys-C digestion, all of the peptides (F1-17) with the exception of F7 can be identified. In most cases, the amino acids which could not be confidently ascribed during the peptide sequence analysis can be shown to be correct following comparison with the sequence deduced from the DNA sequence.
   [00216]  The amino acid sequence for peptide fragments F1, F11, F13 and F17 (SEQ ID NOS:1,173,15 and 21, respectively) all match precisely with the amino acid sequences deduced from the DNA sequence from the corresponding region of DNA (Table 9).
   [00217]  Peptide F2 (SEQ ID NO:2) can be seen to be coded for by the DNA segment 1104-1152 bp. Table 9 shows that the G and the X tentatively ascribed to positions 5 and 11 in the F2 peptide sequence are both N. N is very difficult to detect during gas phase sequencing and there was very little material in the sample. Otherwise the match is precise. F2 is the same peptide as F11 and all amino acids were ascribed correctly during the sequence analysis of the F11 peptide fragment.
   [00218]  Peptides F3 (SEQ ID NO:3) and F17 show sequences of the same peptide obtained from two different endo lys-C digests of WGL.sup.+ (Examples 3 and 4). The amino acid sequence for F17 matches precisely with the translated sequence from amino acids 405 to 412 of the WGL.sup.+ peptide. When sequencing F3, no amino acid could be ascribed to the first position (L from the DNA sequence) as there was a large amount of background but the rest of the amino acids match precisely with the amino acid sequence derived from the DNA sequence (amino acids 405-421 FIG. 8, residues 415-431 of SEQ ID NO:57).
   [00219]  F4 (SEQ ID NO:4) is found at amino acids 213-219 of the WGL.sup.+ protein (FIG. 8, residues 223-229 of SEQ ID NO:57). The sequence matches perfectly and the uncertain .sup.C /Q is shown from the DNA sequence to be C. Carboxy-methylated C migrates with a similar retention time to Q in the HPLC system used to separate the derivatized amino acids following the sequencing reactions.
   [00220]  Very small amounts of material were sequencable in fragment F5 (SEQ ID NO:5) so there were several uncertainties. But it is clear that the sequence obtained corresponds to amino acids 200-210 in FIG. 8 (residues 210-220 of SEQ ID NO:57). One of the two amino acids tentatively ascribed to each peptide is present in the amino acid sequence derived from the DNA sequence and those ascribed with confidence appear in the expected order.
   [00221]  F6 (SEQ ID NO:6) sequence corresponds to amino acids 488-503 in the WGL.sup.+ protein sequence. The residues in the sequence derived for the F6 fragment differ from that derived from the DNA sequence. The F6 sequence presented was derived from a mixed sequence in which the amino acids shown to be correct from the DNA sequence were in fact present.
   [00222]  F7 (SEQ ID NO:7) has not been identified with confidence in the amino acid sequence derived from the DNA sequence. As with F6, the F7 sequence was derived from a mixed sequence and very little confidence can be placed in it.
   [00223]  Small amounts of material were present in F8 (SEQ ID NO:8) sample so there were several uncertainties in the sequence. However, the F8 amino acid sequence appears to correspond to amino acids 444-450 in FIG. 8 (residues 454-469 of SEQ ID NO:57). Again all uncertain residues can be identified in the translated DNA sequence.
   [00224]  F9 (SEQ ID NOS:27 and 46) and F10 (SEQ ID NOS:27 and 29) were both mixtures of two amino acid sequences. It is apparent that one of those sequences corresponds to amino acids 51-63 in FIG. 8 (residues 61-72 of SEQ ID NO:57). In both cases, one of the two amino acids identified during the peptide sequence analysis can be ascribed to the amino acid sequence derived from the DNA sequence in the expected order.
   [00225]  The remaining peptide sequence from F9 and F10 corresponds to amino acids 514-531 in FIG. 8 (residues 524-541 of SEQ ID NO:57). The R recorded for position 11 in the F9 sequence is P from the DNA sequence which is in agreement with the sequence obtained for F10. The DNA sequence shows K at what would be position 10 of this peptide. The DNA sequence shown is that coding for one molecule of the WGL.sup.+ antigen and it is likely that different ticks have some variants of the sequence. This point will be expanded when discussing the F14 sequence.
   [00226]  The fragment sequenced as F12 (SEQ ID NO:42) clearly corresponds to amino acids 20-41 in FIG. 8 (residues 30-51 of SEQ ID NO:57) and, as discussed previously is assumed to be the N-terminal fragment of the mature WGL.sup.+ peptide so the presumption that lysine preceded the first amino acids sequenced was incorrect in this case. The uncertain residue at position 6 of the peptide fragment is S from the DNA sequence. S is very difficult to detect during gas phase sequencing particularly as in this case, when the preceding amino acid is C and carboxy-methylated-C has a similar retention time to S in the HPLC system used to resolve the derivatized amino acids. Otherwise the F12 peptide sequence matches the sequence derived for WGL.sup.+ exactly.
   [00227]  F14 (SEQ ID NO:16) is very interesting (amino acids 228-247). The peptide sequence showed RAF for amino acids 8-10 in the peptide, whereas the DNA sequence, when translated, shows SGS in these positions. Both sequences appear to be correct retrospectively so there is a clear discrepancy between the two sequences. The most likely explanation is that both sequences are correct for the molecule (in the case of the cDNA) and the mixture of molecules (in the case of F12) which have been sequenced.
   [00228]  The tick population world wide is genetically diverse as is the case for all organisms which reproduce sexually. Each individual of a population differs subtly from the others in the population and these differences are a consequence of differences in the sequence of the DNA which each individual inherits from its parents. Thus for each gene coding for a particular protein, there are likely to be differences in the sequence among the population of individuals, referred to herein as homologues. In the particular example discussed here, the WGL.sup.+ protein which was digested in Example 4 to give rise to F12 was extracted from a large number of ticks (60,000-70,000). The peptide sequence determined for F12 (SEQ ID NO:42) (and the rest of the peptide fragments sequenced) is that of the majority of the population of WGL.sup.+ molecules. Among that population of WGL.sup.+ molecules, it is likely that minor variance (homologues) will exist at a level too low to be detected during the peptide sequence analysis. The cDNA sequence shown in FIG. 7 (bases 1-2012 of SEQ ID NO:55 and SEQ ID NO:56) and the amino acid sequence in FIG. 8 are derived from one cDNA molecule from one individual in the population. This individual may have contained a DNA sequence coding for a minor variant of the WGL.sup.+ molecule. It is of course understood that other cDNA molecules may be derived from other individuals of the tick population world wide which will similarly vary in some small way from the sequence shown in FIGS. 6-6(2) but still code for a protein which is essentially the same as that for the WGL.sup.+ antigen molecule. These homologues are included within the scope of this invention.
   [00229]  If the differences such as the one above are found in regions of the WGL.sup.+ molecule which are important epitopes for the protective immune response generated against the WGL.sup.+ molecule following vaccination, it is possible that the ticks with a WGL.sup.+ product which is a homologues of the sequence shown in FIG. 6-6(2) may survive feeding on vaccinated hosts. In this instance it is to be understood that cDNA can be synthesised or DNA isolated from these individuals as described above or by other methods known in the art. In hybridization experiments the 4 kb DNA fragment (or parts thereof) can be used as hybridization probes to identify clones containing DNA coding for the WGL.sup.+ protein from those variants which can then be used to construct bacteria or other micro-organisms which synthesize the variant WGL.sup.+ antigen to be incorporated into effective vaccine against the variant tick population. This principal extends to isolates of Boophilus microplus and to other species of ticks from anywhere in the world.
   [00230]  The other difference in the sequence of F14 (SEQ ID NO:16) compared with the sequence for WGL.sup.+ polypeptide derived from the DNA sequence is that the residue at position 18 (S or H in F12 which was ascribed with low confidence) is T from the DNA sequence.
   [00231]  F15 (SEQ ID NOS:17-19) was a mixture of at least three oligopeptides. Among those, one seems to be represented in the polypeptide at amino acids 166-176.
   [00232]  The F16 (SEQ ID NO:20) sequence can be seen in the WGL.sup.+ amino acid segment 274-281 (FIG. 8, residues 284-291 of SEQ ID NO:57). The two uncertain residues in the peptide sequences are X═T in the second position and X═C in the seventh position of F16, both of which were due to the very small amounts of material which were present in this peptide sample.
   [00233]  In summary, it is clear that the DNA sequence shown in Table 9 codes for one homologue of the tick WGL.sup.+ polypeptide as 16 of the 17 endo lys-C peptide fragments shown which were generated from the antigen isolated from ticks can be coded for by that DNA sequence. Evidence has been obtained that homologues of that gene may exist in the tick population and these are included within the scope of this invention whether the homologues originate from Boophilus microplus or other species of ticks found world wide.
   [00234]  The procedures outlined above refer to the WGL.sup.+ antigen derived from Boophilus microplus. It is clear that this antigen or the equivalent antigen isolated from other tick species may well be effective against other species of Boophilus such as B. annulatus, other tick species such as Haemaphysalis spp, Otobius spp, Rhiphicephalus spp, Ambylomma spp. Dermacentor spp, Ixodes spp and Hyalomma spp, and particular species thereof including Otobius megnini, Rhiphicephalus appendiculatus, Amblyomma variegatum, Haemaphysalis longicornis, Dermacentor andersoni, D. variabilis and Ixodes holocyclus each of which causes significant economic loss throughout the world either as a result of infestation or as vectors of diseases such as Babesia bovis, Babesia bigemina, Anaplasma marginale, Cowdria ruminatum, Theileria parva parva, T. parva lawrencii, T. annulata and T. hirci. The WGL.sup.+ gene product or the equivalent gene product from the related and other acarines would be expected to provide effective vaccines against the parasites as an extension of the work presented herein.

Comments on Hybridization Probes Used

   [00235]  The oligonucleotide probes which were chosen had several shortcomings which can be identified retrospectively. Some of these were due to incorrect choice of bases in the third codon positions and, of course to the uncertainties in the peptide sequence analysis. The oligonucleotide which was relied upon most heavily was the 63-mer as it was based on the most reliable amino acid sequence obtained at that time. When isolating the clones it was surprising that the hybridization signal with this probe was weaker than expected from theoretical considerations and at one stage there was doubt that the clone isolated coded for the WGL.sup.+ peptide. This uncertainty was alleviated to some extent by the use of the degenerate oligonucleotide sequences mentioned above as probes. These probes hybridized strongly to the DNA in the clone. The reason for the weaker than expected signal with the 63-mer can now be explained by the variation in the DNA sequence from that expected in this region. A large number of other clones were purified based on the hybridization signal obtained with one or two probes but these all turned out to be unrelated to the WGL.sup.+ gene by DNA sequence analysis. Therefore the strategy for isolating the clone by using triplicate filters and the use of the highly degenerate oligonucleotide sequences as hybridization probes to confirm the interest in the clone has been vindicated.

EXAMPLE 8

Construction of Recombinant Organisms Synthesizing WGL.sup.+ Antigen

   [00236]  The major limitation to the development of a commercial vaccine based on the WGL.sup.+ antigen or homologues thereof is the limited amount of the antigen which can be obtained from ticks. The means by which this shortage can be overcome include the use of recombinant DNA techniques to engineer bacteria or eukaryote cells to synthesize large amounts of the antigen. The following by means of example only outline some approaches which could be taken.
   [00237]  FIGS. 8A-8B show a restriction enzyme map of the gene coding for the WGL.sup.+ antigen isolated from B. microplus. In order to engineer bacteria which express the gene product at high levels, it would probably be desirable to remove the parts of the molecule which are hydrophobic. These include the hydrophobic leader sequence (amino acids 1-19) which is not found in the mature polypeptide, and the hydrophobic C-terminal sequence (amino acids 630-650) which is likely to be an anchor sequence involved in attaching the antigen to the outer surface of the tick cells. In FIGS. 8A-8B, cleavage sites for the restriction enzymes XmnI (116 bases), PstI (1915 bases) and BamHI (1889 bases) are highlighted. DNA fragments produced by digestion of the WGL.sup.+ gene with XmnI in addition to BamHI or Pstl will contain the coding region for the majority of the gene without the N-terminal hydrophobic sequence or the C-terminal hydrophobic sequences. These 1773 bp and 1799 bp fragments can be subcloned into a number of plasmids including plasmids pBTA603 and pBTA224 to yield recombinant plasmids which will direct the synthesis of fused proteins containing the majority of the WGL.sup.+ peptide.
   [00238]  Plasmid pBTA603 has the PL promoter followed by a sequence from the N-terminus for the MS2 polymerase gene containing a multiple clone site vis EQU ATG TCG AAG ACA ACA AAG AAG TTC AAC TCT TTA TCG ATG/GAT CCC
   [00239]  Restriction endonuclease BamHl cuts the DNA where indicated (/) to give a 4 base 5' single stranded overhang. When this is filled in with DNA polymerase 1, the sequence (bases 34-43 of SEQ ID NO:48) MS2 --TCG ATG GAT C is generated. When this is ligated to Xmnl cut WGL.sup.+ DNA (Xmnl cuts at the sequence (SEQ ID NO:49) GAANNNNTTC i.e. following base 120) the sequence (SEQ ID NO:50) MS2--TCG ATG GAT CAG TTC TGT--WGL.sup.+ is generated. The plasmid so constructed encodes a protein which contains 15N terminal amino acids from the MS2 polymerase and the cloning site sequences in place of the N-terminal 11 amino acids of the mature WGL.sup.+ sequence followed by the WGL.sup.+ amino acid sequence from amino acids 31 to 620 for the BamHl fragment or 31 to 628 for the Pstl fragment. When transformed into a suitable host such as N4830(10) which contains a mutation (cI.sup.ts) in the gene coding for the cI repressor, expression of the fused polypeptide is repressed at temperatures such as 30° C. but is active at temperatures such as 42° C. This temperature dependence of expression is advantageous in instances where the fused product is deleterious to the cells. Cells are grown at 30° C. to the desired cell density and the temperature is then increased to 42° C. to induce the synthesis of the fused protein.
   [00240]  The expression vector pBTA224 was used to generate a strain capable of producing a β-galactosidase-WGL.sup.+ fusion protein. pBTA224 was derived from pUR292 (EMBO J. 2, 1791-1794 (1983)) by eliminating the EcoR1 site that lies outside of the β-galactosidase-coding region. pBTA224 DNA was cut with the restriction endonucleases Sacl and Pstl, and the resulting 4221 bp fragment was purified by agarose gel electrophoresis. Sacl cuts within the lac Z gene, 1181 bps from the 3' end. Pstl cuts pBTA224 at the 3' end of lacZ. A WGL.sup.+ gene fragment suitable for expression in this vector was prepared by first inserting an Xmnl restriction fragment of about 2 Kb (position 116 to past 3' end of WGL.sup.+ gene) into the vector M13um31 (obtained from International Biotechnologies, Inc.). By cutting the new construct with Sacl and Pstl, a fragment encoding most of the WGL.sup.+ and having Sacl and Pstl cohesive ends could be obtained. The sequences for the Sacl end are also shown in SEQ ID NOS:51 and 52. ##STR36##
   [00241]  The fusion protein expected to be produced after induction with IPTG consists of the first 651 amino acids of β galactosidase, 599 amino acids of WGL.sup.+ and 19 amino acids that are encoded by other parts of the expression vector, such as the multiple cloning sites. The calculated molecular weight is 143,054 daltons.
   [00242]  The plasmid described above has been designated pBTA708. A suitable E. coli host containing the lacI.sup.q gene is JM101. BTA1752 is JM101 transformed with pBTA708.
   [00243]  Cell lysates prepared from IPTG induced and control cultures, were analysed by electrophoresis in SDS-polyacrylamide gels. One gel was stained with Coomassie brilliant blue and a band of about the expected size could be visualised (FIGS. 9A-9B). The band was absent in the non-induced control. A duplicate SDS-polyacrylamide gel was also run and the proteins in the gel were transferred to nitrocellulose paper. The nitrocellulose paper was incubated in BLOTTO (a solution of 5% powdered milk in Tris-saline) for 2 hours, then in BLOTTO containing a 1/500 dilution of serum from a rabbit vaccinated with the fractions GF5 and 6 (see above) for 13 hrs at 4° C., then washed three times with BLOTTO, then incubated in a solution containing goat-anti-rabbit immunoglobulin conjugated to alkaline phosphatase (Promega Biotec). Following incubation for 1 hr, the nitrocellulose was removed, washed twice in BLOTTO and incubated in buffer containing Nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate. A band appeared where the rabbit antibodies had bound to the β galactosidase-WGL.sup.+ fused polypeptide synthesized by the bacteria (FIG. 10). The position of the band corresponds to the position of the band seen in the coomassie stained gel.

EXAMPLE 9

Fermentation Purification and Formulation of Vaccines Based on the WGL.sup.+ Antigen Produced by rDNA Techniques

   [00244]  Strains expressing the WGL.sup.+ antigen or portions thereof are maintained as freeze-dried vials in the production culture collection. Cells from the storage vial are reconstituted and plated out on a selective medium, and the cells from this medium are used to prepare fermentor inocula. The inocula are used to seed fermentors containing a suitable growth medium and the fermentation proceeds under conditions appropriate for the production of the WGL.sup.+ proteins. At the completion of the fermentation the cells are harvested and the product is released from the cells and undergoes purification. The product is subjected to analyses and quality control, and is stored under conditions appropriate for good stability. The product is formulated for use by combination with other ingredients under conditions of strict hygiene.
   [00245]  The strains produce the WGL.sup.+ fusion proteins in vivo as insoluble agglomerates termed inclusion bodies and can be produced and purified by the following procedure which is presented by means of example only.
   [00246]  Overnight cultures of BTA1752 is diluted 1:50 into 2×1 liter fresh LB (10 g tryptone/5 g yeast extract/5 g NaCl per liter pH 7.5) in 2 liter baffled flasks and shaken at 30° C. until the culture density reached OD 0.3-0.4. IPTG is added to a final concentration of 10 mM and incubation continued for a further 10 hours. The cells are harvested and resuspended in 20 ml of water per liter of original culture and broken by use of a French Press. The suspension is made 0.1 mM in phenylmethylsulfonyl fluoride (PMSF) and 5% Triton X-100 then centrifuged at 12,000× gav for 10 minutes. The supernatant is discarded and the pellet resuspended by ultrasound in 50 ml 1M NaCl/5% Triton X-100 and recentrifuged. This washing stage is repeated and the pellet finally resuspended using ultrasound in 2.5 ml 1M NaCl/5% Triton X-100 per liter original culture.
   [00247]  Purified inclusion bodies are dissolved at 2 mg/ml in 8M urea/0.1M DTT/0.1M Tris HCl pH 8.0 under nitrogen at 37° C. for 2 hrs. The solution is centrifuged at 20,000× gav for 20 min and the supernatant passed through a 0.1 μm filter. The flow through is passed through a filter with a molecular weight cut-off of 30 kilodaltons and the retained material is applied to a DEAE resin which is poured into a column and washed with 0.1M tris buffer pH 8. The column is then resolved with a linear gradient of from 0-5M NaCl in 8M urea 0.1M Tris pH 8.0 and the fractions analysed by SDS-Polyacrylamide gel electrophores. Those containing the desired protein are pooled, concentrated and desalted on a XM30 filter. The partially purified protein is emulsified in an adjuvant such as Marcol 52:Montanide 888 (9:1) or Freunds complete or incomplete adjuvant and administered to animals.

EXAMPLE 10

Identification of DNA Sequences Coding for the WGL.sup.+ Antigen in Species of Tick Other than Boophilus microplus

   [00248]  In various countries throughout the world, tick species other than Boophilus microplus are responsible for extensive productivity losses either due to the tick infestation or due to the other parasites which the ticks transmit or a combination of both. It would be highly desirable to develop vaccines against these tick species. This may be achieved by vaccinating animals with the WGL.sup.+ antigen derived from Boophilus microplus or the other immunogenic protective fractions described in this and Australian patent application No. 45936/85. It may also be possible to vaccinate animals with the WGL.sup.+ antigen produced by recombinant organisms described herein and elicit an immune response which protects against infestation of animals by other species of tick.
   [00249]  As discussed above, the other species of tick probably contain a molecule which is functionally related to the Boophilus microplus WGL.sup.+ antigen but which differs in sequence from that shown in FIG. 8. If those differences occur in areas eliciting protective immune responses, then the Boophilus microplus WGL.sup.+ antigen may not be protective. However, the related gene product from the other species of tick is likely to be protective against those tick species, when incorporated into a vaccine.
   [00250]  One means by which this proposal can be tested is to conduct a series of vaccination/challenge experiments using fractions derived from homogenates of other ticks and purify the WGL.sup.+ homologues from the other tick species. These can then be cleaved with proteinases, peptide fragments sequenced, oligonucleotides designed and used to identify recombinant organisms containing the genes in a similar way to that in which the Boophilus microplus WGL.sup.+ gene has been identified in the present work.
   [00251]  A preferable approach is to construct cDNA or genomic DNA libraries from nucleic acids extracted from other tick species and to use the DNA fragment shown in FIGS. 6-6(2) (bases 1-2012 of SEQ ID NO:55) or portions thereof as hybridization probes to identify clones containing the homologous gene from the other tick species. Then, engineered recombinant microorganisms synthesizing the homologous gene product could be incorporated into an effective vaccine against the other species of ticks.
   [00252]  In order to demonstrate that this latter approach is feasible and to generate information concerning the conditions under which the hybridization to the clone libraries should be carried out, preliminary "Southern blot" hybridization experiments can be conducted. Briefly by way of example only DNA isolated from a number of species of tick is purified and digested with restriction endonucleases. The DNA fragments so produced are size fractionated by electrophoresis on agarose gels, denatured and transferred to nylon or nitrocellulose filters by capillary action. The filter is, incubated in a prehybridization solution and then in a hybridization solution containing radioactively labelled DNA fragments derived from the WGL.sup.+ gene coding region. Following hybridization and washing of the filters, they are exposed to X-ray film and the resulting autoradiograph shows exposed areas which correspond to the DNA fragments from the various tick species which have hybridized to the WGL.sup.+ DNA fragments. There are many variations of protocols for carrying out this procedure which will be known to individuals skilled in the art and the following is detailed by means of example only.
   [00253]  Eggs were obtained from female ticks of the species Rhiphicepalus appendiculatus, Amblyomma variegatim, Boophilus decoloratus and Boophilus microplus. They were incubated in a humidified incubator for 2-4 days then suspended in cold TE buffer and washed. They were then suspended in TE buffer containing 0.5% SDS in a loose fitting glass-homogeniser and gently homogenised to disrupt the eggs. Proteinase K was added to a final concentration of 50 μg/ml and the mixture was incubated at 37° C. for 1-2 h with gentle shaking. The viscous solution was gently extracted three times with phenol saturated with 0.1M Tris-HCl pH 8.0 and then twice with ether (centrifugation at 5,000× gav for 10 minutes was used to resolve the phases during the phenol extractions). Sodium acetate was added to 0.3M and 2 volumes of ethanol was slowly added with stirring. The DNA which came out of solution as a fibrous precipitate was removed with a pasteur pipette, washed in ethanol, and gently redissolved in TE.
   [00254]  Aliquots (generally containing 10 μg) of these DNA samples were digested with restriction endonucleases according to the manufacturers instructions. Aliquots of the digest products were fractionated by electrophoresis on a 1.6% agarose gel in SEB buffer (10). The DNA was depurinated with 2 volumes of 0.25M HCl for 15 minutes. The DNA was transferred by capillary action to a nylon membrane (Zetaprobe, Biorad). The filters were incubated in prehybridization in a solution (10) containing herring sperm DNA for 2-4 hours at 55° C. Hybridization was carried out in the same solution containing heat denatured [.sup.32 P] labelled DNA fragments from the WGL.sup.+ gene (approximately 10.sup.5 counts per minute/ml) for 20 hours at 68° C. The filters were washed at 55° C. for 30 minutes each in 2× SSC, 0.1% SDS then three times at 60° C. for 15 minutes. After exposure to X-ray film for at least 24 hours the size of the hybridizing fragments could be determined by comparison with marker DNA fragments of known size.
   [00255]  FIGS. 10A-10C show an autoradiogram of one such experiment. DNA was digested with restriction endonuclease Sau 3A. The WGL.sup.+ DNA clearly hybridizes to the DNA from all four species of ticks. In this experiment, the DNA was not intact so a smear is observed in all cases but hybridization is specific as no hybridization to control DNA on the same gel could be detected.

EXAMPLE 11

Isolation of Clones Coding for WGL.sup.+ Homologous from Other Tick Species

   [00256]  The DNA from each of the species tested possesses sequences which are similar to and homologous with the DNA coding for the WGL.sup.+ antigen from Boophilus microplus. Clones containing those DNA sequences from other tick species can be isolated by constructing cDNA or genomic DNA libraries for the other tick species and hybridizing Boophilus microplus DNA fragments to those libraries, and purifying recombinant organisms containing the DNA sequences hybridizing to the homologous genes.
   [00257]  More specifically, the genomic DNA isolated from the tick species listed was subjected to partial digestion with the restriction enzyme Sau 3A to give fragments with an average size of 15-20 Kb as judged by gel analysis. These were ligated into the Bam HI site of lambda EMBL 3 arms essentially as described by the suppliers (Promega Biotech). The libraries were plated on a restrictive host K62 and incubated overnight at 37° C. The plaques were transferred to triplicate nitrocellulose filters, and the DNA denatured with 1.5M NaCl/0.5M NaOH, neutralised with 3M NaCl/0.5M Tris HCl pH 7∅ Then the filters were vacuum baked at 80° C. for 2 hours and hybridized to Boophilus microplus DNA probes labelled with .sup.32 P. Following autoradiography, plaques which hybridized to the probes on both filters were identified, picked and purified to single plaques by repeated rounds of re hybridization.
   [00258]  DNA was isolated from one plaque from a B. decoloratus genomic library and digested with restriction endonucleases HacIII and Apa 1. The fragments so produced were separated by electrophoresis on 1.6% agarose gels. One gel was stained with an ethidium bromide solution and the bands visualised under ultraviolet light (FIGS. 10A-10C). A replicate gel was transferred to nylon membrane and hybridized to Boophilus microplus DNA coding for the WGL.sup.+ antigen. FIGS. 10A-10C show that fragments from the Boophilus decoloratus, Amblyomma variegatum genomic clone hybridize to the WGL.sup.+ gene.
   [00259]  The bands hybridising in the HaeIII digest are approximately 980, 630, and 340 bp and in the Apa 1 digest 27,300 bp when compared with fragments of DNA from bacteriophage lambda digested with Hind III.
   [00260]  The regions of the DNA in each plaque which codes for portions of the homologous gene for the WGL.sup.+ antigen from each species of tick are sequenced and engineered for expression in recombinant organisms essentially as described above for the Boophilus microplus WGL.sup.+ antigen. The same approach can also be taken to isolate cDNA clones from these and other tick species.
   [00261]  The homologous WGL.sup.+ antigen proteins expressed by the microorganisms are then grown in fermenters, the expression of the recombinant antigen induced and the antigen is purified formulated with an adjuvant or carrier and used to vaccinate animals.
   [00262]  It is understood that this procedure can be equally well applied to any species of tick to isolate clones coding for WGL.sup.+ related antigens and the WGL.sup.+ related proteins expressed by the so constructed genetically engineered microorganisms can be used as effective vaccines against a range of tick species which are responsible for productivity losses, morbidity and mortality to domestic animals and man.

EXAMPLE 12

   [00263]  RNA was extracted from ticks collected from different regions of the world and cDNA libraries were constructed using lambda vectors essentially as described in Example 6. Replicas of these cDNA libraries were hybridised with radioactively labelled restriction fragments derived from the DNA coding for the WGL+ antigen using hybridisation conditions designed to detect nucleic acid sequences having a minimum of 70% homology to the hybridising sequence. The resulting plaques that reacted with the DNA hybridisation probes were then purified to single plaques. The DNA sequences of the genes were determined using standard sequencing techniques. FIGS. 12-17 illustrate the DNA sequences and deduced amino acid sequences (SEQ ID NOS:58-69).
   [00264]  The DNA sequence YBm017 (FIG. 12 (SEQ ID NO:58)), was derived from an Australian isolate of Boophilus microplus (Yeerongpilly, Queensland). The WGL+ antigen described in the preceding examples was also obtained from the same isolate. A comparison of the DNA sequences reveals:
[00265]  (i) The DNA sequences are not identical. There is approximately 95% homology at the DNA level but it is clear that the two sequences code for the same antigen.
[00266]  (ii) The translated amino acid sequence (SEQ ID NO:59) has 8 differences between the two antigens. For example, the WGL+ sequence encodes a phenylalanine at position 1551 while YBm017 encodes a cysteine at the corresponding position (nucleotide 1570 in FIG. 12 (SEQ ID NO:58)). In addition, the sequence serine glycine serine (encoded by nucleotides 735 through 743 in the WGL+ sequence) is arginine alanine phenylalanine in the corresponding position of YBm017 (nucleotides 754 to 762 in FIG. 12 (SEQ ID NO:58)).
   [00267]  A partial cDNA clone encoding a protein fragment with an amino acid sequence homologous to that of WGL+ is presented as YBm22M8 (FIG. 13 (SEQ ID NO:60)). This sequence extends from nucleotide position 276 to nucleotide position 1922 of the WGL+ sequence. There are 13 differences between the deduced amino acid sequences of YBm22M8 (SEQ ID NO:61) and WGL+ (SEQ ID NO:56).
   [00268]  These observations further illustrate that the tick population, even within one isolate of ticks is genetically diverse and that homologues of the antigen are found within that population.
   [00269]  A second form of the antigen consisting essentially of the sequence described for YBm22M8 but including the amino terminus of the original WGL+ clone has been expressed in recombinant bacteria and used to vaccinate cattle which were subsequently challenged with ticks. This recombinant antigen protects cattle as well as that encoded by the WGL+ antigen.
   [00270]  The cDNA clone, Bm023 (FIG. 14 (SEQ ID NO:62)) was obtained from another Australian isolate of Boophilus microplus. The nucleotide sequence of this cDNA codes for a protein (SEQ ID NO:63) that has 13 amino acids that are different from those encoded by the WGL+ cDNA. This demonstrates that the major form of the WGL+ antigen is similar for the two populations of ticks.
   [00271]  The VBm021 and MexBm86 cDNA molecules (FIGS. 15 (SEQ ID NO:64) and 16 (SEQ ID NO:66) respectively) were obtained from Boophilus microplus isolates form Venezuela and Mexico respectively. The VBm021 sequence is a partial cDNA clone in that the sequence does not extend to the start codon of the gene. The sequence begins at a position corresponding to amino acid 31 of the deduced WGL+ amino acid sequence (nucleotide position 123 in FIG. 7 bases 1-2012 of SEQ ID NO:55). The MexBm86 cDNA sequence extends through the start codon and into the 5' untranslated region of the WGL+ sequence (FIG. 7 bases 1-2012 of SEQ ID NO:55). These sequences differ from the WGL+ deduced amino acid sequence by 28 (VBm021 SEQ ID NO:65) and 22 (MexBm86 SEQ ID NO:66) amino acids.
   [00272]  These results confirm that it is possible to isolate related genes from a diverse range of Boophilus microplus isolates using the WGL+ gene (or fragments derived from this gene) as hybridisation probes. The DNA sequences of the variants will enable the gene to be clearly identified as related to the WGL+ gene but the homology at the DNA sequence level may be no more than 50% over some regions. In addition the translated amino acid sequences of these genes clearly indicate that the genes code for proteins which are closely related to the WGL+ protein but may differ in amino acid sequence by as much as 30% over some stretches of the protein.
   [00273]  The Ra442 sequence (FIG. 17, SEQ ID NO:68) was obtained from Rhipicephalus appendiculatus. Comparison of this cDNA with WGL+ demonstrates that the Ra442 sequence codes for a protein fragment (SEQ ID NO:69) which is homologous to the WGL+ sequence corresponding to nucleotides 1113 to 1553 (FIG. 7 bases 1-2012 of SEQ ID NO:58). It contains structural elements which are characteristic of these molecules. The homology over this region is approximately 85% at the DNA level and approximately 70% at the amino acid level, with particular regions having higher homology than others. This is clearly a molecule which is closely related in structure (and presumably in function) to the WGL+ antigen from Boophilus microplus.
   [00274]  The nucleotide sequences presented in both YBm017 (SEQ ID NO:58) and VBm021 (SEQ ID NO:64) contain two nucleotides each that could not be determined unambiguously when reading the sequencing gels. These are represented using the IUPAC ambiguity code and result in the translated amino acid, Xaa. These were not included when describing the number of amino acid differences between these clones and the WGL+ sequence.

DEPOSITION OF MICROORGANISMS

   [00275]  Strain BTA 1751 referred to herein has been deposited with the American Type Culture Collection of 12301 Parklawn Drive Rockville, Md. 20852 USA in accordance with the provisions of the Budapest Treaty on 26 Oct. 1987 under accession number ATCC 67548.
   [00276]  Strain BTA 1751 has also been deposited with the China Centre for Type Culture Collection under import licence IL-87044 and designated CTCC.

INDUSTRIAL APPLICATION

   [00277]  The current invention provides a means of vaccinating cattle against infestation with ticks such as Boophilus microplus, Boophilus annulatus; other species such as Haemaphysalis spp, Otobius spp, Rhiphicephalus spp, Ambylomma spp, Dermacentor spp, Ixodes spp and Hyalomma spp; and particular examples thereof including Otobius megnini, Rhiphicephalus appendiculatus, Dermacentor andersoni, D. variabilis and Ixodes holocyclus. Further it provides a means of protecting cattle against diseases such as those caused by Babesia bovis, Cowdria ruminatum, Theleria parva parva, T. parva lawrencil, T. annulata and T. hirci. Further it provides diagnostic tools for the identification and quantification of tick antigens.

REFERENCES

   [00278]  1. Brown, S. J., Shapiro, S. Z. and Askenase, P. W. J. Immunol. 133, 1984, 3319-3325.
   [00279]  2. Ackerman, S., Floyd, M. and Sonenshine, D. E. J. Med. Entomol. 17, 1980, 391-397.
   [00280]  3. McGowan, M. J., Barker, M. J., Homer, J. T., McNew, R. W. and Holscher, K. M. 1971, J. Med. Entomol. 18, 1981, 328.
   [00281]  4. Wikel, S. K., Am. J. Trop. Med. Hyg. 30, 1981, 284.
   [00282]  5. Allen, J. R. and Humphries, S. J. Nature, 280, 1979, 481-493.
   [00283]  6. Johnson, L. A. Y., Kemp, D. H. and Pearson, R. D. Int. J. Parasitol. 16, 27-34, 1986.
   [00284]  7. Kemp, D. H., Agbede, R. I. S., Johnston, L. A. Y. and Gough, J. M. Int. J. Parasitol. 16, 121-130, 1986.
   [00285]  8. Agbede, R. I. S. and Kemp, D. H. Int. J. Parasitol. 16, 35-42, 1986.
   [00286]  9. Briggs M. S. and Gierasch, L. M. (1986), Molecular Mechanisms of Protein Secretion: The Role of the Signal Sequence, pages 110-180 in Advances in Protein Chemistry, vol. 38, Academic Press.
   [00287]  10. Maniatis, T., Fritsch, E. F. and Sambrook, J. (1982), Molecular cloning: A Laboratory Manual (Cold Spring Harbour Laboratory).
   [00288]  11. Kornfeld, R. and Kornfeld, S., 1985, Ann. Rev. Biochem 54, 631-664
   [00289]  12. Van Hemert, F. J., Amons, R., Pluijms, W. J. M., Van Ormondt, H. and Moeller, W. EMBO 3, 1109-1113 1984
   [00290]  13. Willadsen, P., Int. J. Parasitol, 17, 671-677 (1987)
   [00291]  14. Vretblad, P., Biochemica and Biophysica Acta, 434, 169-176 (1976).
   [00292]  15. Sage, H. J. and Green, R. W., in Methods in Enzymology, 28, Guinsburg, V., ed., 332-339 (1972), London Academic Press. __________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 71 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F1 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: LysAspProAspProGlyLys 15 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F2 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: LysTrpTyrGluAspGlyValLeuGluAlaIleXaaThrSerIleGly 151015 Lys (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: LysXaaGlnAlaCysGluHisProIleGlyGluTrpCysMetMetTyr 151015 ProLys (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F4 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 7 (D) OTHER INFORMATION: /note= "Xaa at position 7 represents Cys or Gln" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: LysGluAlaGlyPheValXaaLys 15 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F5 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 4 (D) OTHER INFORMATION: /note= "Xaa at position 4 represents Ser or Asp" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 7 (D) OTHER INFORMATION: /note= "Xaa at position 7 represents Val or Cys" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 10 (D) OTHER INFORMATION: /note= "Xaa at position 10 represents Val or Ala" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 11 (D) OTHER INFORMATION: /note= "Xaa at position 11 represents Ile or Cys" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: LysGlyProXaaGlyGlnXaaIleAsnXaaXaaLys 1510 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F6 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "Xaa at position 3 represents Gly or Asp" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: LysAlaXaaValSerThrAsnGluAsnGluGlnLeuGluGlnAlaAsp 151015 Lys (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F7 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 3 (D) OTHER INFORMATION: /note= "Xaa at position 3 represents Gly or Asp" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: LysSerXaaThrGlnXaaIleAspHisIleSerLys 1510 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F8 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "Xaa at position 2 represents Asn or Asp" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 5 (D) OTHER INFORMATION: /note= "Xaa at position 5 represents Ala or Tyr" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 6 (D) OTHER INFORMATION: /note= "Xaa at position 6 represents Ala or Tyr" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: LysXaaGlnGluXaaXaaTyr 15 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: LysCysProCysAspAsnMetTyrPheAsnAlaAlaGluGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: AlaAsnGlnCysProProAspThrArgArgGlyGluIleGlyCysIle 151015 Glu (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: LysAlaProArgGlnAsnMetTyrPheAsnAlaAlaGluGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: CysAsnCysAspCysProProAspThrArgProGlyGluIleGlyCys 151015 IleGlu (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F11 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: LysTrpTyrGluAspArgValLeuGluAlaIleArgThrSerIleGly 151015 Lys (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F12 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: LysGluSerSerIleCysXaaAspPheGlyAsnGluPheCysArgAsn 151015 AlaGluCysGluValValPro 20 (2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F13 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: LysThrArgGluCysSerTyrGlyArgCysValGluSerAsnProSer 151015 Lys (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F14 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 19 (D) OTHER INFORMATION: /note= "Xaa at position 19 represents Ser or His" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: LysAlaTyrGluCysThrCysProArgAlaPheThrValAlaGluAsp 151015 GlyIleXaaCysLys 20 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F15 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 8 (D) OTHER INFORMATION: /note= "Xaa at position 8 represents Ser or His" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: LysAspGluValAspAsnAlaXaaLeuValCysGlnAsnAla 1510 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: LysAsnValLeuGlnSerAspGlyCysGlyProTyr 1510 (2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F15 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 7 (D) OTHER INFORMATION: /note= "Xaa at position 7 represents Pro or Leu" (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 11 (D) OTHER INFORMATION: /note= "Xaa at position 11 represents His or Ser" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19: LysCysLeuAsnProArgXaaArgLeuLysXaa 1510 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F16 (ix) FEATURE: (A) NAME/KEY: Modified-site (B) LOCATION: 2 (D) OTHER INFORMATION: /note= "Xaa at position 2 represents Ser, Ala, Cys or Gly" (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: LysXaaXaaValLeuCysGluXaaPro 15 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: LysLeuGlnAlaCysGluHisProIle 15 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F3, F17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: LysLeuGlnAlaCysGluHisProIleGlyGluTrpCysMetMetTyr 151015 ProLys (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: LysGluAlaGlyPheValCysLys 15 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: LysGlyProAspGlyGlnCysIleAsnAlaCysLys 1510 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: LysAlaGlyValSerCysAsnGluAsnGluGlnSerGluCysAlaAsp 151015 Lys (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F8 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: LysAspGlnGluAlaAlaTyrLys 15 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: LysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLys 1510 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9, F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9, F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: LysAlaAsnCysGlnCysProProAspThrArgProGlyGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F12 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: AlaGluSerSerIleCysSerAspPheGlyAsnGluPheCysArgAsn 151015 AlaGluCysGluValValProGly 20 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F14 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: LysAlaTyrGluCysThrCysProSerGlySerThrValAlaGluAsp 151015 GlyIleThrCysLys 20 (2) INFORMATION FOR SEQ ID NO:32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F14 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32: LysAlaTyrGluCysThrCysProArgAlaPheThrValAlaGluAsp 151015 GlyIleThrCysLys 20 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: LysAsnLeuLeuGlnArgAspSerArgCysCysGln 1510 (2) INFORMATION FOR SEQ ID NO:34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F16 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: LysGlyThrValLeuCysGluCysPro 15 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: LysCysProCysAspAsnMetTyrPheAsnAlaAlaGluLys 1510 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: LysAlaAsnArgGlnCysProProAspThrArgArgGlyGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: TTACCTGGATCTGGATCCTT20 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 50 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: TTACCAATGGATGTACAAATAGCTTCAAGGACACCATCTTCGTACCACTT50 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 53 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: TTTGGGTACATCATACACCATTCACCAATTGGGTGTTCACAAGCCTGADSCTT53 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40: LysAlaProArgGlnAsnMetTyrPheAsnAlaAlaGluLys 1510 (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: LysCysAsnCysAspCysProProAspThrArgProGlyGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F12 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: LysGluSerSerIleCysXaaAspPheGlyAsnGluPheCysArgAsn 151015 AlaGluCysGluValValProLys 20 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 72 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: TTTAGGTACAACCTCACATTCAGCATTCCTACAAAATTCATTACCGAAATCAAAACAAAT60 ACTACTCTCCTT72 (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: CTTCGACGGATTGGATTCGACGCATCTGCCATAGCTACATTCCCTCGTCTT51 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 63 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: CTTGCAATGGATTCCATCCTCGGCGACAGTGAAAGCTCTAGGGCAAGTGCACTCATAAGC60 CTT63 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 b (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: LysAlaAsnCysGlnCysProProAspThrArgArgGlyGluIleGly 151015 CysIleGlu (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F16 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: LysXaaXaaValLeuCysGluXaaPro 15 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: ATGTCGAAGACAACAAAGAAGTTCAACTCTTTATCGATGGATCCC45 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: GAANNNNTTC10 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: TCGATGGATCAGTTCTGT18 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: CGGTACCCAGTTCTGT16 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: ACAGAACTGGGTACCGAGCT20 (2) INFORMATION FOR SEQ ID NO:53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: AACGAGCTCGGTACCCAGTCC21 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: GAACTGGGTACCGAGCTCGTT21 (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2065 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 7 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 33..1985 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55: CCGCGACAGCTGCGGTGGTTCGACGCAGTGAGATGCGTGGCATCGCTTTGTTC53 MetArgGlyIleAlaLeuPhe 15 GTCGCCGCTGTTTCACTGATTGTAGAGGGCACAGCAGAATCATCCATT101 ValAlaAlaValSerLeuIleValGluGlyThrAlaGluSerSerIle 101520 TGCTCTGACTTCGGGAACGAGTTCTGTCGCAACGCTGAATGTGAAGTG149 CysSerAspPheGlyAsnGluPheCysArgAsnAlaGluCysGluVal 253035 GTGCCTGGTGCAGAGGATGATTTCGTGTGCAAATGTCCGCGAGATAAT197 ValProGlyAlaGluAspAspPheValCysLysCysProArgAspAsn 40455055 ATGTACTTCAATGCTGCTGAAAAGCAATGCGAATATAAAGACACGTGC245 MetTyrPheAsnAlaAlaGluLysGlnCysGluTyrLysAspThrCys 606570 AAGACAAGGGAGTGCAGCTATGGACGTTGCGTTGAAAGTAACCCGAGC293 LysThrArgGluCysSerTyrGlyArgCysValGluSerAsnProSer 758085 AAGGCTAGCTGCGTCTGCGAAGCATCGGACGATCTAACGCTACAATGC341 LysAlaSerCysValCysGluAlaSerAspAspLeuThrLeuGlnCys 9095100 AAAATTAAAAATGACTACGCAACTGACTGCCGAAATCGAGGTGGCACT389 LysIleLysAsnAspTyrAlaThrAspCysArgAsnArgGlyGlyThr 105110115 GCTAAGTTGCGCACGGATGGGTTTATTGGCGCAACGTGTGACTGTGGT437 AlaLysLeuArgThrAspGlyPheIleGlyAlaThrCysAspCysGly 120125130135 GAATGGGGTGCGATGAACATGACCACCCGGAACTGTGTCCCTACCACG485 GluTrpGlyAlaMetAsnMetThrThrArgAsnCysValProThrThr 140145150 TGTCTTCGTCCCGACTTGACCTGCAAAGACCTCTGCGAGAAAAACCTG533 CysLeuArgProAspLeuThrCysLysAspLeuCysGluLysAsnLeu 155160165 CTTCAAAGGGATTCTCGTTGTTGCCAGGGGTGGAACACAGCAAACTGT581 LeuGlnArgAspSerArgCysCysGlnGlyTrpAsnThrAlaAsnCys 170175180 TCAGCCGCTCCTCCAGCTGACTCCTATTGCTCTCCTGGGAGCCCCAAA629 SerAlaAlaProProAlaAspSerTyrCysSerProGlySerProLys 185190195 GGACCGGACGGACAGTGTATAAATGCTTGCAAGACGAAAGAAGCTGGG677 GlyProAspGlyGlnCysIleAsnAlaCysLysThrLysGluAlaGly 200205210215 TTTGTCTGCAAGCATGGATGCAGGTCGACCGGCAAGGCGTACGAGTGC725 PheValCysLysHisGlyCysArgSerThrGlyLysAlaTyrGluCys 220225230 ACGTGCCCGAGTGGCTCTACCGTCGCCGAAGATGGCATTACCTGCAAA773 ThrCysProSerGlySerThrValAlaGluAspGlyIleThrCysLys 235240245 AGTATTTCGCACACAGTCAGCTGCACTGCTGAGCAAAAACAGACCTGC821 SerIleSerHisThrValSerCysThrAlaGluGlnLysGlnThrCys 250255260 CGCCCAACCGAAGACTGTCGTGTGCACAAAGGAACTGTGTTGTGTGAG869 ArgProThrGluAspCysArgValHisLysGlyThrValLeuCysGlu 265270275 TGCCCGTGGAATCAACATCTAGTGGGGGACACGTGCATAAGTGATTGC917 CysProTrpAsnGlnHisLeuValGlyAspThrCysIleSerAspCys 280285290295 GTCGACAAGAAATGCCACGAAGAATTTATGGACTGTGGCGTATATATG965 ValAspLysLysCysHisGluGluPheMetAspCysGlyValTyrMet 300305310 AATCGACAAAGCTGCTATTGTCCATGGAAATCAAGGAAGCCGGGCCCA1013 AsnArgGlnSerCysTyrCysProTrpLysSerArgLysProGlyPro 315320325 AATGTCAACATCAATGAATGCCTACTGAATGAGTATTACTACACGGTG1061 AsnValAsnIleAsnGluCysLeuLeuAsnGluTyrTyrTyrThrVal 330335340 TCATTCACCCCAAACATATCTTTTGATTCTGACCATTGCAAATGGTAT1109 SerPheThrProAsnIleSerPheAspSerAspHisCysLysTrpTyr 345350355 GAGGATCGTGTTTTGGAAGCGATACGGACCAGTATCGGAAAAGAAGTT1157 GluAspArgValLeuGluAlaIleArgThrSerIleGlyLysGluVal 360365370375 TTTAAGGTTGAGATACTTAACTGCACGCAGGACATTAAGGCAAGACTC1205 PheLysValGluIleLeuAsnCysThrGlnAspIleLysAlaArgLeu 380385390 ATAGCAGAGAAACCACTGTCAAAACACGTGCTCAGGAAACTACAAGCA1253 IleAlaGluLysProLeuSerLysHisValLeuArgLysLeuGlnAla 395400405 TGCGAGCATCCAATCGGCGAATGGTGCATGATGTATCCGAAGTTGCTG1301 CysGluHisProIleGlyGluTrpCysMetMetTyrProLysLeuLeu 410415420 ATCAAGAAAAACTCTGCAACAGAAATCGAAGAAGAGAACCTTTGCGAC1349 IleLysLysAsnSerAlaThrGluIleGluGluGluAsnLeuCysAsp 425430435 AGTCTGCTCAAGGATCAGGAAGCTGCCTACAAAGGTCAAAACAAATGC1397 SerLeuLeuLysAspGlnGluAlaAlaTyrLysGlyGlnAsnLysCys 440445450455 GTCAAGGTCGACAACCTCTTCTGGTTCCAGTGCGCTGATGGTTACACA1445 ValLysValAspAsnLeuPheTrpPheGlnCysAlaAspGlyTyrThr 460465470 ACAACTTACGAGATGACACGAGGTCGCCTACGCCGCTCCGTGTGTAAA1493 ThrThrTyrGluMetThrArgGlyArgLeuArgArgSerValCysLys 475480485 GCTGGAGTTTCTTGCAACGAAAACGAGCAGTCGGAGTGTGCTGACAAA1541 AlaGlyValSerCysAsnGluAsnGluGlnSerGluCysAlaAspLys 490495500 GGGCAAATATTTGTTTACGAAAACGGCAAAGCGAATTGCCAATGCCCA1589 GlyGlnIlePheValTyrGluAsnGlyLysAlaAsnCysGlnCysPro 505510515 CCAGACACTAAACCTGGGGAGATTGGCTGCATTGAGCGTACCACATGC1637 ProAspThrLysProGlyGluIleGlyCysIleGluArgThrThrCys 520525530535 AACCCTAAAGAAATACAAGAATGCCAAGACAAGAAGCTGGAGTGCGTT1685 AsnProLysGluIleGlnGluCysGlnAspLysLysLeuGluCysVal 540545550 TACAAAAACCATAAAGCAGAATGCGAGTGTCCTGATGATCACGAGTGT1733 TyrLysAsnHisLysAlaGluCysGluCysProAspAspHisGluCys 555560565 TACAGGGAGCCTGCCAAAGACTCTTGCAGTGAAGAGGATAATGGTAAA1781 TyrArgGluProAlaLysAspSerCysSerGluGluAspAsnGlyLys 570575580 TGTCAAAGCAGTGGGCAGCGTTGTGTAATAGAAAACGGAAAGGCTGTT1829 CysGlnSerSerGlyGlnArgCysValIleGluAsnGlyLysAlaVal 585590595 TGCAAGGAAAAGTCTGAAGCAACAACAGCTGCGACTACAACAACGAAA1877 CysLysGluLysSerGluAlaThrThrAlaAlaThrThrThrThrLys 600605610615 GCGAAAGACAAGGATCCAGATCCTGGAAAGTCAAGTGCTGCAGCAGTA1925 AlaLysAspLysAspProAspProGlyLysSerSerAlaAlaAlaVal 620625630 TCAGCTACTGGGCTCTTGTTACTGCTCGCAGCTACTTCAGTCACCGCA1973 SerAlaThrGlyLeuLeuLeuLeuLeuAlaAlaThrSerValThrAla 635640645 GCATCGTTGTAAGGAAGATGTCCAACTTGAATACGGAACAGCTTGAATA2022 AlaSerLeu 650 TGTATATATACATCACGCTTACATCGAACACCTAGCTTGGTTT2065 (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 650 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: MetArgGlyIleAlaLeuPheValAlaAlaValSerLeuIleValGlu 151015 GlyThrAlaGluSerSerIleCysSerAspPheGlyAsnGluPheCys 202530 ArgAsnAlaGluCysGluValValProGlyAlaGluAspAspPheVal 354045 CysLysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGln 505560 CysGluTyrLysAspThrCysLysThrArgGluCysSerTyrGlyArg 65707580 CysValGluSerAsnProSerLysAlaSerCysValCysGluAlaSer 859095 AspAspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAsp 100105110 CysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIle 115120125 GlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThr 130135140 ArgAsnCysValProThrThrCysLeuArgProAspLeuThrCysLys 145150155160 AspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGln 165170175 GlyTrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyr 180185190 CysSerProGlySerProLysGlyProAspGlyGlnCysIleAsnAla 195200205 CysLysThrLysGluAlaGlyPheValCysLysHisGlyCysArgSer 210215220 ThrGlyLysAlaTyrGluCysThrCysProSerGlySerThrValAla 225230235240 GluAspGlyIleThrCysLysSerIleSerHisThrValSerCysThr 245250255 AlaGluGlnLysGlnThrCysArgProThrGluAspCysArgValHis 260265270 LysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGly 275280285 AspThrCysIleSerAspCysValAspLysLysCysHisGluGluPhe 290295300 MetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrp 305310315320 LysSerArgLysProGlyProAsnValAsnIleAsnGluCysLeuLeu 325330335 AsnGluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAsp 340345350 SerAspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArg 355360365 ThrSerIleGlyLysGluValPheLysValGluIleLeuAsnCysThr 370375380 GlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSerLysHis 385390395400 ValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCys 405410415 MetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIle 420425430 GluGluGluAsnLeuCysAspSerLeuLeuLysAspGlnGluAlaAla 435440445 TyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPhe 450455460 GlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArg 465470475480 LeuArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGlu 485490495 GlnSerGluCysAlaAspLysGlyGlnIlePheValTyrGluAsnGly 500505510 LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 515520525 CysIleGluArgThrThrCysAsnProLysGluIleGlnGluCysGln 530535540 AspLysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysGlu 545550555560 CysProAspAspHisGluCysTyrArgGluProAlaLysAspSerCys 565570575 SerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysVal 580585590 IleGluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThr 595600605 AlaAlaThrThrThrThrLysAlaLysAspLysAspProAspProGly 610615620 LysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeu 625630635640 AlaAlaThrSerValThrAlaAlaSerLeu 645650 (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 688 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: AlaThrAlaAlaValValArgArgSerGluMetArgGlyIleAlaLeu 151015 PheValAlaAlaValSerLeuIleValGluGlyThrAlaGluSerSer 202530 IleCysSerAspPheGlyAsnGluPheCysArgAsnAlaGluCysGlu 354045 ValValProGlyAlaGluAspAspPheValCysLysCysProArgAsp 505560 AsnMetTyrPheAsnAlaAlaGluLysGlnCysGluTyrLysAspThr 65707580 CysLysThrArgGluCysSerTyrGlyArgCysValGluSerAsnPro 859095 SerLysAlaSerCysValCysGluAlaSerAspAspLeuThrLeuGln 100105110 CysLysIleLysAsnAspTyrAlaThrAspCysArgAsnArgGlyGly 115120125 ThrAlaLysLeuArgThrAspGlyPheIleGlyAlaThrCysAspCys 130135140 GlyGluTrpGlyAlaMetAsnMetThrThrArgAsnCysValProThr 145150155160 ThrCysLeuArgProAspLeuThrCysLysAspLeuCysGluLysAsn 165170175 LeuLeuGlnArgAspSerArgCysCysGlnGlyTrpAsnThrAlaAsn 180185190 CysSerAlaAlaProProAlaAspSerTyrCysSerProGlySerPro 195200205 LysGlyProAspGlyGlnCysIleAsnAlaCysLysThrLysGluAla 210215220 GlyPheValCysLysHisGlyCysArgSerThrGlyLysAlaTyrGlu 225230235240 CysThrCysProSerGlySerThrValAlaGluAspGlyIleThrCys 245250255 LysSerIleSerHisThrValSerCysThrAlaGluGlnLysGlnThr 260265270 CysArgProThrGluAspCysArgValHisLysGlyThrValLeuCys 275280285 GluCysProTrpAsnGlnHisLeuValGlyAspThrCysIleSerAsp 290295300 CysValAspLysLysCysHisGluGluPheMetAspCysGlyValTyr 305310315320 MetAsnArgGlnSerCysTyrCysProTrpLysSerArgLysProGly 325330335 ProAsnValAsnIleAsnGluCysLeuLeuAsnGluTyrTyrTyrThr 340345350 ValSerPheThrProAsnIleSerPheAspSerAspHisCysLysTrp 355360365 TyrGluAspArgValLeuGluAlaIleArgThrSerIleGlyLysGlu 370375380 ValPheLysValGluIleLeuAsnCysThrGlnAspIleLysAlaArg 385390395400 LeuIleAlaGluLysProLeuSerLysHisValLeuArgLysLeuGln 405410415 AlaCysGluHisProIleGlyGluTrpCysMetMetTyrProLysLeu 420425430 LeuIleLysLysAsnSerAlaThrGluIleGluGluGluAsnLeuCys 435440445 AspSerLeuLeuLysAspGlnGluAlaAlaTyrLysGlyGlnAsnLys 450455460 CysValLysValAspAsnLeuPheTrpPheGlnCysAlaAspGlyTyr 465470475480 ThrThrThrTyrGluMetThrArgGlyArgLeuArgArgSerValCys 485490495 LysAlaGlyValSerCysAsnGluAsnGluGlnSerGluCysAlaAsp 500505510 LysGlyGlnIlePheValTyrGluAsnGlyLysAlaAsnCysGlnCys 515520525 ProProAspThrLysProGlyGluIleGlyCysIleGluArgThrThr 530535540 CysAsnProLysGluIleGlnGluCysGlnAspLysLysLeuGluCys 545550555560 ValTyrLysAsnHisLysAlaGluCysGluCysProAspAspHisGlu 565570575 CysTyrArgGluProAlaLysAspSerCysSerGluGluAspAsnGly 580585590 LysCysGlnSerSerGlyGlnArgCysValIleGluAsnGlyLysAla 595600605 ValCysLysGluLysSerGluAlaThrThrAlaAlaThrThrThrThr 610615620 LysAlaLysAspLysAspProAspProGlyLysSerSerAlaAlaAla 625630635640 ValSerAlaThrGlyLeuLeuLeuLeuLeuAlaAlaThrSerValThr 645650655 AlaAlaSerLeuXaaGlyArgCysProThrXaaIleArgAsnSerLeu 660665670 AsnMetTyrIleTyrIleThrLeuThrSerAsnThrXaaLeuGlyPhe 675680685 (2) INFORMATION FOR SEQ ID NO:58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2259 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 12 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 52..2004 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: GAATTCGCGGCCGCGAAAGTGCGACAGCTGCGGTGGTTCGACGCAGTCGAGATGCGT57 MetArg GGCATCGCTTTGTTCGTCGCCGCTGTTTCACTGATTGTAGAGGGCACA105 GlyIleAlaLeuPheValAlaAlaValSerLeuIleValGluGlyThr 51015 GCAGAATCATCCATTTGCTCTGACTTCGGGAACGAGTTCTGTCGCAAC153 AlaGluSerSerIleCysSerAspPheGlyAsnGluPheCysArgAsn 202530 GCTGAATGTGAAGTGGTGCCTGGTGCAGAGGATGATTTCGTGTGCAAA201 AlaGluCysGluValValProGlyAlaGluAspAspPheValCysLys 35404550 TGTCCGCGAGATAATATGTACTTCAATGCTGCTGAAAAGCAATGCGAA249 CysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGlnCysGlu 556065 TATAAAGACACGTGCAAAACAAGGGAGTGCAGCTATGGACGTTGCGTT297 TyrLysAspThrCysLysThrArgGluCysSerTyrGlyArgCysVal 707580 GAAAGTAACCCGAGCAAGGCTAGCTGCGTCTGCGAAGCATCGGACGAT345 GluSerAsnProSerLysAlaSerCysValCysGluAlaSerAspAsp 859095 CTAACGCTACAATGCAAAATTAAAAATGACTACGCAACTGACTGCCGA393 LeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAspCysArg 100105110 AACCGAGGTGGCACTGCTAAGTTGCGCACGGATGGGTTTATTGGCGCA441 AsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIleGlyAla 115120125130 ACGTGTGACTGTGGTGAATGGGGTGCGATGAACATGACCACCCGGAAC489 ThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThrArgAsn 135140145 TGTGTCCCTACCACGTGTCTTCGTCCCGACTTGAGCTGCAAAGACCTC537 CysValProThrThrCysLeuArgProAspLeuSerCysLysAspLeu 150155160 TGCGAGAAAAACCTGCTTCAAAGGGATTCTCGTTGTTGCCAGGGGTGG585 CysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGlnGlyTrp 165170175 AACACAGCAAACTGTTCAGCCGCTCCTCCAGCTGACTCCTATTGCTCT633 AsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyrCysSer 180185190 CCTGGGAGCCCCAAAGGACCGGACGGACAGTGTATAAATGCTTGCAAG681 ProGlySerProLysGlyProAspGlyGlnCysIleAsnAlaCysLys 195200205210 ATGAAAGAAGCTGGGTTTGTCTGCAAGCATGGATGCAGGTCGACCGCC729 MetLysGluAlaGlyPheValCysLysHisGlyCysArgSerThrAla 215220225 AAGGCGTACGAGTGCACGTGCCCACGTGCCTTTACCGTCGCGGAAGAT777 LysAlaTyrGluCysThrCysProArgAlaPheThrValAlaGluAsp 230235240 GGCATTACCTGCAAAAGTATTTCGCACACAGTCAGCTGCACTGCTGAG825 GlyIleThrCysLysSerIleSerHisThrValSerCysThrAlaGlu 245250255 CAAAAACAGACCTGCCGCCCAACCGAAGACTGTCGTGTGCACAAAGGA873 GlnLysGlnThrCysArgProThrGluAspCysArgValHisLysGly 260265270 ACTGTGTTGTGTGAGTGCCCGTGGAATCAACATCTAGTGGGGGACACG921 ThrValLeuCysGluCysProTrpAsnGlnHisLeuValGlyAspThr 275280285290 TGCATAAGTGATTGCGTCGACAAGAAATGCCACGAAGAATTTATGGAC969 CysIleSerAspCysValAspLysLysCysHisGluGluPheMetAsp 295300305 TGTGGCGTATATATGAATCGACAAAGCTGCTATTGTCCATGGAAATCA1017 CysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrpLysSer 310315320 AGGAAGCCGGGCCCAAATGTCAACATCAATGGATGCCTACTGAATGAG1065 ArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeuAsnGlu 325330335 TATTACTACACGGTGTCATTCACCCCAAACATATCTTTTGATTCTGAC1113 TyrTyrTyrThrValSerPheThrProAsnIleSerPheAspSerAsp 340345350 CATTGCAAATGGTATGAGGATCGTGTTTTGGAAGCGATACGGACCAGT1161 HisCysLysTrpTyrGluAspArgValLeuGluAlaIleArgThrSer 355360365370 ATCGGAAAAGAAGTTTTTAAGGTTGAGATACTTAACTGCACGCAGGAC1209 IleGlyLysGluValPheLysValGluIleLeuAsnCysThrGlnAsp 375380385 ATTAAGGCAAGACTCATAGCAGAGAAATTACTGTCAAAACACGTGCTC1257 IleLysAlaArgLeuIleAlaGluLysLeuLeuSerLysHisValLeu 390395400 AGGAAACTACAAGCATGCGAGCATCCAATCGGCGAATGGTGCATGATG1305 ArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCysMetMet 405410415 TATCCGAAGTTGCTGATCAAGAAAAACTCTGCAACAGAAATCGAAGAA1353 TyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIleGluGlu 420425430 GAGAACCTTTGCGACAGTCTGCTCAAGGATCAGGAAGCTGCCTACAAA1401 GluAsnLeuCysAspSerLeuLeuLysAspGlnGluAlaAlaTyrLys 435440445450 GGTCAAAACAAATGCGTCAAGGTCGACAACCTCTTCTGGTTCCAGTGC1449 GlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPheGlnCys 455460465 GCTGATGGTTACACAACAACTTACGAGATGACACGAGGTCGCCTACGC1497 AlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArgLeuArg 470475480 CGCTCCGTGTGTAAAGCTGGAGTTTCTTGCAACGAAAACGAGCAGTCG1545 ArgSerValCysLysAlaGlyValSerCysAsnGluAsnGluGlnSer 485490495 GAGTGTGCTGACAAAGGGCAAATATGTGTTTACGAAAACGGCAAAGCG1593 GluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGlyLysAla 500505510 AATTGCCAATGCCCACCAGACACTAAACCTGGGGAGATTGGCTGCATT1641 AsnCysGlnCysProProAspThrLysProGlyGluIleGlyCysIle 515520525530 GAGCGTACCACATGCAACCCTAAAGAGATACAAGAATGCCAAGACAAG1689 GluArgThrThrCysAsnProLysGluIleGlnGluCysGlnAspLys 535540545 AAGCTGGAGTGCGTTTACAAAAACCATAAAGCAGAATSSAAGTGTCCT1737 LysLeuGluCysValTyrLysAsnHisLysAlaGluXaaLysCysPro 550555560 GATGATCACGAGTGTTACAGGGAGCCTGCCAAAGACTCTTGCAGTGAA1785 AspAspHisGluCysTyrArgGluProAlaLysAspSerCysSerGlu 565570575 GAGGATAATGGTAAATGTCAAAGCAGTGGGCAGCGTTGTGTAATAGAA1833 GluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysValIleGlu 580585590 AACGGAAAGGCTGTTTGCAAGGAAAAGTCTGAAGCAACAACAGCTGCG1881 AsnGlyLysAlaValCysLysGluLysSerGluAlaThrThrAlaAla 595600605610 ACTACAACAACGAAAGCGAAAGACAAGGATCCAGATCCTGGAAAGTCA1929 ThrThrThrThrLysAlaLysAspLysAspProAspProGlyLysSer 615620625 AGTGCTGCAGCAGTATCAGCTACTGGGCTCTTGTTACTGCTCGCAGCT1977 SerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeuAlaAla 630635640 ACTTCAGTCACCGCAGCATCGTTGTAAGGAAGATGTCCAACTTGAATACGGAAC2031 ThrSerValThrAlaAlaSerLeu 645650 AGCTTGAATATGTATATATACATCACGCTTACATCGAACACCTAGCTTGGTTTTTGGAAT2091 TTCAATATTGCGCATTGGTACTCACGGCAACATGAATGTATTACTTTAGAATGACAGGGA2151 AGAGGGACGTGAAAGGAGTTTCCTTGTCTGAACATATCAAAGAAAATTTTCCCCTATCCG2211 ACCGATGTCAAATAAAGATAGTTGGGTCTAAACAGCGGCCGCGAATTC2259 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 650 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: MetArgGlyIleAlaLeuPheValAlaAlaValSerLeuIleValGlu 151015 GlyThrAlaGluSerSerIleCysSerAspPheGlyAsnGluPheCys 202530 ArgAsnAlaGluCysGluValValProGlyAlaGluAspAspPheVal 354045 CysLysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGln 505560 CysGluTyrLysAspThrCysLysThrArgGluCysSerTyrGlyArg 65707580 CysValGluSerAsnProSerLysAlaSerCysValCysGluAlaSer 859095 AspAspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAsp 100105110 CysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIle 115120125 GlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThr 130135140 ArgAsnCysValProThrThrCysLeuArgProAspLeuSerCysLys 145150155160 AspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGln 165170175 GlyTrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyr 180185190 CysSerProGlySerProLysGlyProAspGlyGlnCysIleAsnAla 195200205 CysLysMetLysGluAlaGlyPheValCysLysHisGlyCysArgSer 210215220 ThrAlaLysAlaTyrGluCysThrCysProArgAlaPheThrValAla 225230235240 GluAspGlyIleThrCysLysSerIleSerHisThrValSerCysThr 245250255 AlaGluGlnLysGlnThrCysArgProThrGluAspCysArgValHis 260265270 LysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGly 275280285 AspThrCysIleSerAspCysValAspLysLysCysHisGluGluPhe 290295300 MetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrp 305310315320 LysSerArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeu 325330335 AsnGluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAsp 340345350 SerAspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArg 355360365 ThrSerIleGlyLysGluValPheLysValGluIleLeuAsnCysThr 370375380 GlnAspIleLysAlaArgLeuIleAlaGluLysLeuLeuSerLysHis 385390395400 ValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCys 405410415 MetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIle 420425430 GluGluGluAsnLeuCysAspSerLeuLeuLysAspGlnGluAlaAla 435440445 TyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPhe 450455460 GlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArg 465470475480 LeuArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGlu 485490495 GlnSerGluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGly 500505510 LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 515520525 CysIleGluArgThrThrCysAsnProLysGluIleGlnGluCysGln 530535540 AspLysLysLeuGluCysValTyrLysAsnHisLysAlaGluXaaLys 545550555560 CysProAspAspHisGluCysTyrArgGluProAlaLysAspSerCys 565570575 SerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysVal 580585590 IleGluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThr 595600605 AlaAlaThrThrThrThrLysAlaLysAspLysAspProAspProGly 610615620 LysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeu 625630635640 AlaAlaThrSerValThrAlaAlaSerLeu 645650 (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1647 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 13 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1647 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60: GTTGAAAGTAACCCGAGCAAGGCTAGCTGCGTCTGCGAACGATCGGAC48 ValGluSerAsnProSerLysAlaSerCysValCysGluArgSerAsp 151015 GATCTAACGCTACAATGCAAAATTAAAAATGACTACGCAACTGACTGC96 AspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAspCys 202530 CGAAATCGAGGTGGCACTGCTAAGTTGCGCACGGATGGGTTTATTGGC144 ArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIleGly 354045 GCAACGTGTGACTGTGGTGAATGGGGTGCGATGAACATGACCACCCGG192 AlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThrArg 505560 AACTGTGTCCCTACCACGTGTCTTCGTCCCGACTTGACCTGCAAAGAC240 AsnCysValProThrThrCysLeuArgProAspLeuThrCysLysAsp 65707580 CTCTGCGAGAAAAACCTGCTTCAAAGGGATTCTCGTTGTTGCCAGGGG288 LeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGlnGly 859095 TGGAACACAGCAAACTGTTCAGCCGCTCCTCCAGCTGACTCCTATTGC336 TrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyrCys 100105110 TCTCCTGGGAGCCCCAAAGGACCGGACGGACAGTGTATAAATGCTTGC384 SerProGlySerProLysGlyProAspGlyGlnCysIleAsnAlaCys 115120125 AAGATGAAAGAAGCTGGGTTTGTCTGCGAGCATGGATGCAGGTCGACC432 LysMetLysGluAlaGlyPheValCysGluHisGlyCysArgSerThr 130135140 GCCAAGGCGTACGAGTGCACGTGCCCACGTGGCTTTACCGTCGCGGAA480 AlaLysAlaTyrGluCysThrCysProArgGlyPheThrValAlaGlu 145150155160 GATGGCATTACCTGCAAAAGTATTTCGCACACAGTCAGCTGCACTGCT528 AspGlyIleThrCysLysSerIleSerHisThrValSerCysThrAla 165170175 GAGCAAAAACAGACCTGCCGCCCAACCGAAGACTGTCGTGTGCACAAA576 GluGlnLysGlnThrCysArgProThrGluAspCysArgValHisLys 180185190 GGAACTGTGTTGTGTGAGTGCCCGTGGAATCAACATCTAGTGGGGGAC624 GlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGlyAsp 195200205 ACGTGCATAAGTGATTGCGTCGACAAGAAATGCCACGAAGAATTTATG672 ThrCysIleSerAspCysValAspLysLysCysHisGluGluPheMet 210215220 GACTGTGGCGTATATATGAATCGACAAAGCTGCTATTGTCCATGGAAA720 AspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrpLys 225230235240 TCAAGGAAGCCGGGCCCAAATGTCAACATCAATGGATGCCTACTGAAT768 SerArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeuAsn 245250255 GAGTATTACTACACGGTGTCATTCACCCCAAACATATCTTTTGATTCT816 GluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAspSer 260265270 GACCATTGCAAATGGTATGAGGATCGTGTTTTGGAAGCGATACGGACC864 AspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArgThr 275280285 AGTATCGGAAAAGAAGTTTTTAAGGTTGAGATACTTAACTGCACGCAG912 SerIleGlyLysGluValPheLysValGluIleLeuAsnCysThrGln 290295300 GACATTAAGGCAAGACTCATAGCAGAGAAACCACTGTCAAACCACGTG960 AspIleLysAlaArgLeuIleAlaGluLysProLeuSerAsnHisVal 305310315320 CTCAGGAAACTACAAGCATGCGAGCATCCAATCGGCGAATGGTGCATG1008 LeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCysMet 325330335 ATGTATCCGAAGTTGCTGATCAAGAAAAACTCTGCAACAGAAATCGAA1056 MetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIleGlu 340345350 GAAGAGAACCTTTGCGACAGTCTGCTCAAGAATCAGGAAGCTGCCTAC1104 GluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAlaTyr 355360365 AAAGGTCAAAACAAATGCGTCAAGGTCGACAACCTCTTCTGGTTCCAG1152 LysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPheGln 370375380 TGCGCTGATGGTTACACAACAACTTACGAGATGACACGAGGTCGCCTA1200 CysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArgLeu 385390395400 CGCCGCTCCGTGTGTAAAGCTGGAGTTTCTTGCAACGAAAACGAGCAG1248 ArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGluGln 405410415 TTGGAGTGTGCTGACAAAGGGCAAATATGTGTTTACGAAAACGGCAAA1296 LeuGluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGlyLys 420425430 GCGAATTGCCAATGCCCACCAGACACTAAACCTGGGGAGATTGGCTGC1344 AlaAsnCysGlnCysProProAspThrLysProGlyGluIleGlyCys 435440445 ATTGAGCGTACCACATGCAACCCTAAAGAGATACAAGAATGCCAAGAC1392 IleGluArgThrThrCysAsnProLysGluIleGlnGluCysGlnAsp 450455460 AAGAAGCTGGAGTGCGTTTACAAAAACCATAAAGCAGAATGCAAGTGT1440 LysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysLysCys 465470475480 CCTGATGATCACGAGTGTTCCAGGGAGCCTGCCAAAGACTCTTGCAGT1488 ProAspAspHisGluCysSerArgGluProAlaLysAspSerCysSer 485490495 GAAGAGGATAATGGTAAATGTCAAAGCAGTGGGCAGCGTTGTGTAATA1536 GluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysValIle 500505510 GAAAACGGAAAGGCTGTTTGCAAGGAAAAGTCTGAAGCAACAACAGCT1584 GluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThrAla 515520525 GCGACTACAACAACGAAAGCGAAAGACAAGGATCCAGATCCTGGAAAG1632 AlaThrThrThrThrLysAlaLysAspLysAspProAspProGlyLys 530535540 TCAAGTGCTGCAGCA1647 SerSerAlaAlaAla 545 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 549 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61: ValGluSerAsnProSerLysAlaSerCysValCysGluArgSerAsp 151015 AspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAspCys 202530 ArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIleGly 354045 AlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThrArg 505560 AsnCysValProThrThrCysLeuArgProAspLeuThrCysLysAsp 65707580 LeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGlnGly 859095 TrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyrCys 100105110 SerProGlySerProLysGlyProAspGlyGlnCysIleAsnAlaCys 115120125 LysMetLysGluAlaGlyPheValCysGluHisGlyCysArgSerThr 130135140 AlaLysAlaTyrGluCysThrCysProArgGlyPheThrValAlaGlu 145150155160 AspGlyIleThrCysLysSerIleSerHisThrValSerCysThrAla 165170175 GluGlnLysGlnThrCysArgProThrGluAspCysArgValHisLys 180185190 GlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGlyAsp 195200205 ThrCysIleSerAspCysValAspLysLysCysHisGluGluPheMet 210215220 AspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrpLys 225230235240 SerArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeuAsn 245250255 GluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAspSer 260265270 AspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArgThr 275280285 SerIleGlyLysGluValPheLysValGluIleLeuAsnCysThrGln 290295300 AspIleLysAlaArgLeuIleAlaGluLysProLeuSerAsnHisVal 305310315320 LeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCysMet 325330335 MetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIleGlu 340345350 GluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAlaTyr 355360365 LysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPheGln 370375380 CysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArgLeu 385390395400 ArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGluGln 405410415 LeuGluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGlyLys 420425430 AlaAsnCysGlnCysProProAspThrLysProGlyGluIleGlyCys 435440445 IleGluArgThrThrCysAsnProLysGluIleGlnGluCysGlnAsp 450455460 LysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysLysCys 465470475480 ProAspAspHisGluCysSerArgGluProAlaLysAspSerCysSer 485490495 GluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysValIle 500505510 GluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThrAla 515520525 AlaThrThrThrThrLysAlaLysAspLysAspProAspProGlyLys 530535540 SerSerAlaAlaAla 545 (2) INFORMATION FOR SEQ ID NO:62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2308 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 14 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 58..2010 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62: CCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTCCGCCGGCCGCCGAG57 ATGCGTGGCATCGCTTTGTTCGTCGCCGCTGTTTCACTGATTGTAGAG105 MetArgGlyIleAlaLeuPheValAlaAlaValSerLeuIleValGlu 151015 TGCACAGCAGAATCATCCATTTGCTCTGACTTCGGGAACGAGTTCTGT153 CysThrAlaGluSerSerIleCysSerAspPheGlyAsnGluPheCys 202530 CGCAACGCTGAATGTGAAGTGGTGCCTGGTGCAGAGGATGATTTCGTG201 ArgAsnAlaGluCysGluValValProGlyAlaGluAspAspPheVal 354045 TGCAAATGTCCGCGAGATAATATGTACTTCAATGCTGCTGAAAAGCAA249 CysLysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGln 505560 TGCGAATATAAAGACACGTGCAAGACAAGGGAGTGCAGCTATGGACGT297 CysGluTyrLysAspThrCysLysThrArgGluCysSerTyrGlyArg 65707580 TGCGTTGAAAGTAACCCGAGCAAGGCTAGCTGCGTCTGCGAAGCATCG345 CysValGluSerAsnProSerLysAlaSerCysValCysGluAlaSer 859095 GACGATCTAACGCTACAATGCAAAATTAAAAATGACTACGCAACTGAC393 AspAspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAsp 100105110 TGCCGAAATCGAGGTGGCACTGCTAAGTTGCGCACGGATGGGTTTATT441 CysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIle 115120125 GGCGCAACGTGTGACTGTGGTGAATGGGGTGCGATGAACATGACCACC489 GlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThr 130135140 CGGAACTGTGTCCCTACCACGTGTCTTCGTCCCGACTTGACCTGCAAA537 ArgAsnCysValProThrThrCysLeuArgProAspLeuThrCysLys 145150155160 GACCTCTGCGAGAAAAACCTGCTTCAAAGGGATTCTCGTTGTTGCCAG585 AspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGln 165170175 GGGTGGAACACAGCAAACTGTTCAGCCGCTCCTCCAGCTGACTCCTAT633 GlyTrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyr 180185190 TGCTCTCCTGGGAGCCCCAAAGGACCGGACGGACAGTGTATAAATGCT681 CysSerProGlySerProLysGlyProAspGlyGlnCysIleAsnAla 195200205 TGCAAGATGAAAGAAGCTGGGTTTGTCTGCGAGCATGGATGCAGGTCG729 CysLysMetLysGluAlaGlyPheValCysGluHisGlyCysArgSer 210215220 ACCGCCAAGGCGTACGAGTGCACGTGCCCACGTGGCTTTACCGTCGCG777 ThrAlaLysAlaTyrGluCysThrCysProArgGlyPheThrValAla 225230235240 GAAGATGGCATTACCTGCAAAAGTATTTCGCACACAGTCAGCTGCACT825 GluAspGlyIleThrCysLysSerIleSerHisThrValSerCysThr 245250255 GCTGAGCAAAAACAGACCTGCCGCCCAACCGAAGACTGTCGTGTGCAC873 AlaGluGlnLysGlnThrCysArgProThrGluAspCysArgValHis 260265270 AAAGGAACTGTGTTGTGTGAGTGCCCGTGGAATCAACATCTAGTGGGG921 LysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGly 275280285 GACACGTGCATAAGTGATTGCGTCGACAAGAAATGCCACGAAGAATTT969 AspThrCysIleSerAspCysValAspLysLysCysHisGluGluPhe 290295300 ATGGACTGTGGCGTATATATGAATCGACAAAGCTGCTATTGTCCATGG1017 MetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrp 305310315320 AAATCAAGGAAGCCGGGCCCAAATGTCAACATCAATGGATGCCTACTG1065 LysSerArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeu 325330335 AATGAGTATTACTACACGGTGTCATTCACCCCAAACATATCTTTTGAT1113 AsnGluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAsp 340345350 TCTGACCATTGCAAATGGTATGAGGATCGTGTTTTGGAAGCGATACGG1161 SerAspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArg 355360365 ACCAGTATCGGAAAAGAAGTTTTTAAGGTTGAGATACTTAACTGCACG1209 ThrSerIleGlyLysGluValPheLysValGluIleLeuAsnCysThr 370375380 CAGGACATTAAGGCAAGACTCATAGCAGAGAAACCACTGTCAAACCAC1257 GlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSerAsnHis 385390395400 GTGCTCAGGAAACTACAAGCATGCGAGCATCCAATCGGCGAATGGTGC1305 ValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCys 405410415 ATGATGTATCCGAAGTTGCTGATCAAGAAAAACTCTGCAACAGAAATC1353 MetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIle 420425430 GAAGAAGAGAACCTTTGCGACAGTCTGCTCAAGAATCAGGAAGCTGCC1401 GluGluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAla 435440445 TACAAAGGTCAAAACAAATGCGTCAAGGTCGACAACCTCTTCTGGTTC1449 TyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPhe 450455460 CAGTGCGCTGATGGTTACACAACAACTTACGAGATGACACGAGGTCGC1497 GlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArg 465470475480 CTACGCCGCTCCGTGTGTAAAGCTGGAGTTTCTTGCAACGAAAACGAG1545 LeuArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGlu 485490495 CAGTTGGAGTGTGCTGACAAAGGGCAAATATGTGTTTACGAAAACGGC1593 GlnLeuGluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGly 500505510 AAAGCGAATTGCCAATGCCCACCAGACACTAAACCTGGGGAGATTGGC1641 LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 515520525 TGCATTGAGCGTACCACATGCAACCCTAAAGAGATACAAGAATGCCAA1689 CysIleGluArgThrThrCysAsnProLysGluIleGlnGluCysGln 530535540 GACAAGAAGCTGGAGTGCGTTTACAAAAACCATAAAGCAGAATGCAAG1737 AspLysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysLys 545550555560 TGTCCTGATGATCACGAGTGTTCCAGGGAGCCTGCCAAAGACTCTTGC1785 CysProAspAspHisGluCysSerArgGluProAlaLysAspSerCys 565570575 AGTGAAGAGGATAATGGTAAATGTCAAAGCAGTGGGCAGCGTTGTGTA1833 SerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysVal 580585590 ATAGAAAACGGAAAGGCTGTTTGCAAGGAAAAGTCTGAAGCAACAACA1881 IleGluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThr 595600605 GCTGCGACTACAACAACGAAAGCGAAAGACAAGGATCCAGATCCTGGA1929 AlaAlaThrThrThrThrLysAlaLysAspLysAspProAspProGly 610615620 AAGTCAAGTGCTGCAGCAGTATCAGCTACTGGGCTCTTGTTACTGCTC1977 LysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeu 625630635640 GCAGCTACTTCAGTCACCGCAGCATCGTTGTAAGGAAGMTGTCCAACTNC2027 AlaAlaThrSerValThrAlaAlaSerLeu 645650 AATACGGAACAGCTTGAATATGTATATATACATCACGCTTACATCGAACACCTAGCTTGG2087 TTTTTGGAATTTCAATATTGCGCATTGGTACTCACNGCAACATGAATGTATTACTTTAGA2147 ATGACAGGGAAGAGGGACGTGAAAGGAGTTTCCTTGTCTGAACATATCAAAGAAAATTTT2207 CCCCTATCCGACCGATGTCAGCGGCCGCGAATTCCTGCAGCCCGGGGGATCCACTAGTTC2267 TAGAGCGGGCGGCCGCGTTAACCACCGCGGTGGAGCTCCAG2308 (2) INFORMATION FOR SEQ ID NO:63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 650 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63: MetArgGlyIleAlaLeuPheValAlaAlaValSerLeuIleValGlu 151015 CysThrAlaGluSerSerIleCysSerAspPheGlyAsnGluPheCys 202530 ArgAsnAlaGluCysGluValValProGlyAlaGluAspAspPheVal 354045 CysLysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGln 505560 CysGluTyrLysAspThrCysLysThrArgGluCysSerTyrGlyArg 65707580 CysValGluSerAsnProSerLysAlaSerCysValCysGluAlaSer 859095 AspAspLeuThrLeuGlnCysLysIleLysAsnAspTyrAlaThrAsp 100105110 CysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIle 115120125 GlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnMetThrThr 130135140 ArgAsnCysValProThrThrCysLeuArgProAspLeuThrCysLys 145150155160 AspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGln 165170175 GlyTrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyr 180185190 CysSerProGlySerProLysGlyProAspGlyGlnCysIleAsnAla 195200205 CysLysMetLysGluAlaGlyPheValCysGluHisGlyCysArgSer 210215220 ThrAlaLysAlaTyrGluCysThrCysProArgGlyPheThrValAla 225230235240 GluAspGlyIleThrCysLysSerIleSerHisThrValSerCysThr 245250255 AlaGluGlnLysGlnThrCysArgProThrGluAspCysArgValHis 260265270 LysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGly 275280285 AspThrCysIleSerAspCysValAspLysLysCysHisGluGluPhe 290295300 MetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrp 305310315320 LysSerArgLysProGlyProAsnValAsnIleAsnGlyCysLeuLeu 325330335 AsnGluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAsp 340345350 SerAspHisCysLysTrpTyrGluAspArgValLeuGluAlaIleArg 355360365 ThrSerIleGlyLysGluValPheLysValGluIleLeuAsnCysThr 370375380 GlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSerAsnHis 385390395400 ValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCys 405410415 MetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIle 420425430 GluGluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAla 435440445 TyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPhe 450455460 GlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArg 465470475480 LeuArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGlu 485490495 GlnLeuGluCysAlaAspLysGlyGlnIleCysValTyrGluAsnGly 500505510 LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 515520525 CysIleGluArgThrThrCysAsnProLysGluIleGlnGluCysGln 530535540 AspLysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysLys 545550555560 CysProAspAspHisGluCysSerArgGluProAlaLysAspSerCys 565570575 SerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysVal 580585590 IleGluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThr 595600605 AlaAlaThrThrThrThrLysAlaLysAspLysAspProAspProGly 610615620 LysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeu 625630635640 AlaAlaThrSerValThrAlaAlaSerLeu 645650 (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2131 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 15 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1863 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: TTCTGTCGCAACGCTGAATGCGAAGAGGTGCCTGGTGCCGAGGATGAT48 PheCysArgAsnAlaGluCysGluGluValProGlyAlaGluAspAsp 151015 TTCGTGTGCAAATGTCCGCGATATAATATGTACTTCAATGCTGCTGAA96 PheValCysLysCysProArgTyrAsnMetTyrPheAsnAlaAlaGlu 202530 AAACAATGCGAATATAAAGATACGTGCAAGACAAGAGAGTGCAGCTAT144 LysGlnCysGluTyrLysAspThrCysLysThrArgGluCysSerTyr 354045 GGCCGTTGCGTTCAAAGTAACCCGAGCAAGGCTAGCTGTGTCTGCGAA192 GlyArgCysValGlnSerAsnProSerLysAlaSerCysValCysGlu 505560 GCATCTGACACTCTAACGCTACAATGCAACATTAACAATGACTACGCA240 AlaSerAspThrLeuThrLeuGlnCysAsnIleAsnAsnAspTyrAla 65707580 ACTGACTGCCGAAACAGGGGTGGTACCGCTAAGTTGCGCACGGATGGG288 ThrAspCysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGly 859095 TTTATTGGCGCAACGTGTGACTGTGGTGAATGGGGCGCAATGAACAAA336 PheIleGlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnLys 100105110 ACCACCCGGAACTGTGTCCCTACCACGTGTCTTCGTCCCGACTTGACC384 ThrThrArgAsnCysValProThrThrCysLeuArgProAspLeuThr 115120125 TGCAAAGACCTCTGCGAGAAAAACCTGCTTCAAAGGGATTCTCGTTGT432 CysLysAspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCys 130135140 TGCCAGGGGTGGAACACAGCAAACTGTTTAGCCGCTCCTCCAGCTGAC480 CysGlnGlyTrpAsnThrAlaAsnCysLeuAlaAlaProProAlaAsp 145150155160 TCCTATTGCTCTCCTGGGAGCCCCAAAGGACCGGACGGACAGTGTAAA528 SerTyrCysSerProGlySerProLysGlyProAspGlyGlnCysLys 165170175 AATGCTTGCAGGACGAAAGAAGCTGGGTTTGTCTGCAAGCATGGATGC576 AsnAlaCysArgThrLysGluAlaGlyPheValCysLysHisGlyCys 180185190 AGGTCCACCGACAAGGCGTACGAGTGCACGTGCCCGAGTGGCTCTACC624 ArgSerThrAspLysAlaTyrGluCysThrCysProSerGlySerThr 195200205 GTCGCCGAAGATGGCATTACCTGCAAAAGTATTTCGTACACAGTCAGC672 ValAlaGluAspGlyIleThrCysLysSerIleSerTyrThrValSer 210215220 TGCACTGTTGAGCAAAAACAGACCTGCCGCCCAACCGAAGACTGTCGT720 CysThrValGluGlnLysGlnThrCysArgProThrGluAspCysArg 225230235240 GTGCAGAAAGGAACTGTGTTGTGTGAGTGCCCGTGGAATCAACATCTA768 ValGlnLysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeu 245250255 GTGGGGGACAAGTGCATAAGTGATTGCGTCGACAAGAAATGTCACGAA816 ValGlyAspLysCysIleSerAspCysValAspLysLysCysHisGlu 260265270 GAATTTATGGACTGTGGCGTATATATGAATCGACAAAGCTGCTATTGT864 GluPheMetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCys 275280285 CCATGGAAATCAAGGAAGCCGGGCCCAAATGTCAACATCAATGAATGC912 ProTrpLysSerArgLysProGlyProAsnValAsnIleAsnGluCys 290295300 CTACTGAATGAGTATTACTACACGGTGTCATTCACCCCGAACATATCT960 LeuLeuAsnGluTyrTyrTyrThrValSerPheThrProAsnIleSer 305310315320 TTTGATTCTGACCATTGCAAACGGTATGAGGATCGTGTTTTGGAAGCG1008 PheAspSerAspHisCysLysArgTyrGluAspArgValLeuGluAla 325330335 ATACGGACCAGTATCGGAAAAGAAGTTTTTAAGGTTGAGATACTTAAC1056 IleArgThrSerIleGlyLysGluValPheLysValGluIleLeuAsn 340345350 TGCACGCAGGACATTAAGGCAAGACTCATAGCAGAGAAACCACTGTCA1104 CysThrGlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSer 355360365 AAATACGTGCTCAGGAAACTACAAGCATGCGAGCATCCAATCGGCGAA1152 LysTyrValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGlu 370375380 TGGTGCATGATGTATCCGAAGTTGCTGATCAAGAAAAACTCTGCAACA1200 TrpCysMetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThr 385390395400 GAAATTGAAGAAGAGAACCTTTGCGACAGTCTGCTCAAGAATCAGGAA1248 GluIleGluGluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGlu 405410415 GCTGCCTACAAAGGTCAAAACAAATGCGTCAAGGTCGACAACCTCTTC1296 AlaAlaTyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPhe 420425430 TGGTTCCAGTGCGCTGATGGTTACACAACAACTTACGAGATGACACGA1344 TrpPheGlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArg 435440445 GGTCGCCTACGCCGCTCCGTGTGTAAAGCTGGAGTTTCTTGCAACGAA1392 GlyArgLeuArgArgSerValCysLysAlaGlyValSerCysAsnGlu 450455460 AACGAGCAGTTGGAGTGTGCTAACAAAGGTCAAATATGTGTCTACGAA1440 AsnGluGlnLeuGluCysAlaAsnLysGlyGlnIleCysValTyrGlu 465470475480 AACGGCAAAGCGAATTGCCAATGCCCACCAGACACTAAACCAGGGGAG1488 AsnGlyLysAlaAsnCysGlnCysProProAspThrLysProGlyGlu 485490495 ATTGGCTGCATTGAGCGTACCACATGCAACCCTAAAGAGATACAAGAA1536 IleGlyCysIleGluArgThrThrCysAsnProLysGluIleGlnGlu 500505510 TGCCAAGACAAGAAGCTCGAGTGCGTTTACAAAAACCATAAAGCAGAA1584 CysGlnAspLysLysLeuGluCysValTyrLysAsnHisLysAlaGlu 515520525 TSSAAGTGTCCTGATGATCACGAGTGTTCTAGGGAGCCTGCCAAAGAC1632 XaaLysCysProAspAspHisGluCysSerArgGluProAlaLysAsp 530535540 TCTTGCAGTGAAGAAGATAATGGTAAATGTCAAAGCAGTGGGCAGCGT1680 SerCysSerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArg 545550555560 TGTGTAATGGAAAACGGAAATGCTGTTTGCAAAGAGAAGTCTGATGCA1728 CysValMetGluAsnGlyAsnAlaValCysLysGluLysSerAspAla 565570575 ACAACAGCTTCGACTACAACAACGAAAGCGAAAGACAAGGATCCAGAT1776 ThrThrAlaSerThrThrThrThrLysAlaLysAspLysAspProAsp 580585590 CCTGAAAAGTCAAGTGCTGCAGCAGTATCAGCTACTGGGCTCTTGTTA1824 ProGluLysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeu 595600605 CTGCTCGCAGCTACTTCAGTCACCGCAGCATCGTTGTAATGAAGAT1870 LeuLeuAlaAlaThrSerValThrAlaAlaSerLeu 610615620 GTCCAACTTGAATACGGAACAGCTTGAAAATGTATATATACATCACGCTTACATCGAACA1930 TCTAGCTTGGTCTTTGGAATTTAAATATTGCACATGGGTACTCACGGCAAAATGGACGTA1990 TTATTTTAGAATGACAGGGAAGATGGACGTGAAAGGAGTTTCCTTGTCTGAAAATATCAA2050 AGAAAAACTTTCCCTATCTGAATGATGTCAAATAAAGATAGTTGGGTCTAAACAAAAAAA2110 AAAAAAAAAAAAAAGCGGCCG2131 (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 620 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: PheCysArgAsnAlaGluCysGluGluValProGlyAlaGluAspAsp 151015 PheValCysLysCysProArgTyrAsnMetTyrPheAsnAlaAlaGlu 202530 LysGlnCysGluTyrLysAspThrCysLysThrArgGluCysSerTyr 354045 GlyArgCysValGlnSerAsnProSerLysAlaSerCysValCysGlu 505560 AlaSerAspThrLeuThrLeuGlnCysAsnIleAsnAsnAspTyrAla 65707580 ThrAspCysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGly 859095 PheIleGlyAlaThrCysAspCysGlyGluTrpGlyAlaMetAsnLys 100105110 ThrThrArgAsnCysValProThrThrCysLeuArgProAspLeuThr 115120125 CysLysAspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCys 130135140 CysGlnGlyTrpAsnThrAlaAsnCysLeuAlaAlaProProAlaAsp 145150155160 SerTyrCysSerProGlySerProLysGlyProAspGlyGlnCysLys 165170175 AsnAlaCysArgThrLysGluAlaGlyPheValCysLysHisGlyCys 180185190 ArgSerThrAspLysAlaTyrGluCysThrCysProSerGlySerThr 195200205 ValAlaGluAspGlyIleThrCysLysSerIleSerTyrThrValSer 210215220 CysThrValGluGlnLysGlnThrCysArgProThrGluAspCysArg 225230235240 ValGlnLysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeu 245250255 ValGlyAspLysCysIleSerAspCysValAspLysLysCysHisGlu 260265270 GluPheMetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCys 275280285 ProTrpLysSerArgLysProGlyProAsnValAsnIleAsnGluCys 290295300 LeuLeuAsnGluTyrTyrTyrThrValSerPheThrProAsnIleSer 305310315320 PheAspSerAspHisCysLysArgTyrGluAspArgValLeuGluAla 325330335 IleArgThrSerIleGlyLysGluValPheLysValGluIleLeuAsn 340345350 CysThrGlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSer 355360365 LysTyrValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGlu 370375380 TrpCysMetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThr 385390395400 GluIleGluGluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGlu 405410415 AlaAlaTyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPhe 420425430 TrpPheGlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArg 435440445 GlyArgLeuArgArgSerValCysLysAlaGlyValSerCysAsnGlu 450455460 AsnGluGlnLeuGluCysAlaAsnLysGlyGlnIleCysValTyrGlu 465470475480 AsnGlyLysAlaAsnCysGlnCysProProAspThrLysProGlyGlu 485490495 IleGlyCysIleGluArgThrThrCysAsnProLysGluIleGlnGlu 500505510 CysGlnAspLysLysLeuGluCysValTyrLysAsnHisLysAlaGlu 515520525 XaaLysCysProAspAspHisGluCysSerArgGluProAlaLysAsp 530535540 SerCysSerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArg 545550555560 CysValMetGluAsnGlyAsnAlaValCysLysGluLysSerAspAla 565570575 ThrThrAlaSerThrThrThrThrLysAlaLysAspLysAspProAsp 580585590 ProGluLysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeu 595600605 LeuLeuAlaAlaThrSerValThrAlaAlaSerLeu 610615620 (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2147 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 16 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 49..2001 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66: CAGGATCCGTGGAAAGTGCGACAGCTGCGGTGGTTCGACGCAGTCGAGATGCGTGGC57 MetArgGly 1 ATCGCTTTGTTCGTCGCCGCTGTTTCACTGATTGTAGAGTGCACAGCA105 IleAlaLeuPheValAlaAlaValSerLeuIleValGluCysThrAla 51015 GAATCATCCATTTGCTCTGACTTCGGGAACGAGTTCTGTCGCAACGCT153 GluSerSerIleCysSerAspPheGlyAsnGluPheCysArgAsnAla 20253035 GAATGTGAAGTGGTGCCTGGTGCAGAGGATGATTTCGTGTGCAAATGT201 GluCysGluValValProGlyAlaGluAspAspPheValCysLysCys 404550 CCGCGAGATAATATGTACTTCAATGCTGCTGAAAAGCAATGCGAATAT249 ProArgAspAsnMetTyrPheAsnAlaAlaGluLysGlnCysGluTyr 556065 AAAGATACGTGCAAGACAAGGGAGTGCAGCTATGGACGTTGCGTTGAA297 LysAspThrCysLysThrArgGluCysSerTyrGlyArgCysValGlu 707580 AGTAACCCGAGCAAGGGTAGCTGCGTCTGCGAAGCATCGGACGATCTA345 SerAsnProSerLysGlySerCysValCysGluAlaSerAspAspLeu 859095 ACGCTACAATGCAAAATTAAAAATGACTTCGCAACTGACTGCCGAAAC393 ThrLeuGlnCysLysIleLysAsnAspPheAlaThrAspCysArgAsn 100105110115 CGAGGTGGCACTGCTAAGTTGCGCACGGATGGGTTTATTGGCCCAACG441 ArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIleGlyProThr 120125130 TGTGACTGTGGTGAATGGGGTGCGATGAACAAGACCACACGGAACTGT489 CysAspCysGlyGluTrpGlyAlaMetAsnLysThrThrArgAsnCys 135140145 GTCCCTACCACGTGTCTTCGTCCCGACTTGACCTGCAAAGACCTCTGC537 ValProThrThrCysLeuArgProAspLeuThrCysLysAspLeuCys 150155160 GAGAAAAACCTGCTTCAAAGGGATTCTCGTTGTTGTCAGGGGTGGAAC585 GluLysAsnLeuLeuGlnArgAspSerArgCysCysGlnGlyTrpAsn 165170175 ACAGCAAACTGTTCAGCCGCTCCTCCAGCTGACTCCTATTGCTCTCCT633 ThrAlaAsnCysSerAlaAlaProProAlaAspSerTyrCysSerPro 180185190195 GGGAGCCCCAAAGGACCGGACGGACAGTGTAAAAATGCTTGCAGGACG681 GlySerProLysGlyProAspGlyGlnCysLysAsnAlaCysArgThr 200205210 AAAGAAGCTGGGTTTGTCTGCAAGCATGGATGCAGGTCCACCGACAAG729 LysGluAlaGlyPheValCysLysHisGlyCysArgSerThrAspLys 215220225 GCGTACGAGTGCACGTGCCCGAGTGGCTCTACCGTCGCCGAAGATGGC777 AlaTyrGluCysThrCysProSerGlySerThrValAlaGluAspGly 230235240 ATTACCTGCAAAAGTATTTCGTACACAGTCAGCTGCACTGTTGAGCAA825 IleThrCysLysSerIleSerTyrThrValSerCysThrValGluGln 245250255 AAACAGACCTGCCGCCCAACCGAAGACTGTCGTGTGCAGAAAGGAACT873 LysGlnThrCysArgProThrGluAspCysArgValGlnLysGlyThr 260265270275 GTGTTGTGTGAGTGCCCGTGGAATCAACATCTAGTGGGGGACACGTGC921 ValLeuCysGluCysProTrpAsnGlnHisLeuValGlyAspThrCys 280285290 ATAAGTGATTGCGTCGACAAGAAATGTCACGAAGAATTTATGGACTGT969 IleSerAspCysValAspLysLysCysHisGluGluPheMetAspCys 295300305 GGCGTATATATGAATCGACAAAGCTGCTATTGTCCATGGAAATCAAGG1017 GlyValTyrMetAsnArgGlnSerCysTyrCysProTrpLysSerArg 310315320 AAGCCGGGCCCAAATGTCAACATCAATGAATGCCTACTGAATGAGTAT1065 LysProGlyProAsnValAsnIleAsnGluCysLeuLeuAsnGluTyr 325330335 TACTACACGGTGTCATTCACCCCGAACATATCTTTTGATTCTGACCAT1113 TyrTyrThrValSerPheThrProAsnIleSerPheAspSerAspHis 340345350355 TGCAAACGGTATGAGGATCGTGTTTTGGAAGCGATACGGACCAGTATC1161 CysLysArgTyrGluAspArgValLeuGluAlaIleArgThrSerIle 360365370 GGAAAAGAAGTTTTTAAGGTTGAGATACTTAACTGCACGCAGGACATT1209 GlyLysGluValPheLysValGluIleLeuAsnCysThrGlnAspIle 375380385 AAGGCAAGACTCATAGCAGAGAAACCACTGTCAAAATACGTGCTCAGG1257 LysAlaArgLeuIleAlaGluLysProLeuSerLysTyrValLeuArg 390395400 AAACTACAAGCATGCGAGCATCCAATCGGCGAATGGTGCATGATGTAT1305 LysLeuGlnAlaCysGluHisProIleGlyGluTrpCysMetMetTyr 405410415 CCGAAGTTGCTGATCAAGAAAAACTCTGCAACAGAAATTGAAGAAGAG1353 ProLysLeuLeuIleLysLysAsnSerAlaThrGluIleGluGluGlu 420425430435 AACCTTTGCGACAGTCTGCTCAAGAATCAGGAAGCTGCCTACAAAGGT1401 AsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAlaTyrLysGly 440445450 CAAAACAAATGCGTCAAGGTCGACAACCTCTTCTGGTTCCAGTGCGCT1449 GlnAsnLysCysValLysValAspAsnLeuPheTrpPheGlnCysAla 455460465 GATGGTTACACAACAACTTACGAGATGACACGAGGTCGCCTACGCCGC1497 AspGlyTyrThrThrThrTyrGluMetThrArgGlyArgLeuArgArg 470475480 TCCGTGTGTAAAGCTGGAGTTTCTTGCAACGAAAACGAGCAGTTGGAG1545 SerValCysLysAlaGlyValSerCysAsnGluAsnGluGlnLeuGlu 485490495 TGTGCTAACAAAGGTCAAATATGTGTCTACGAAAACGGCAAAGCGAAT1593 CysAlaAsnLysGlyGlnIleCysValTyrGluAsnGlyLysAlaAsn 500505510515 TGCCAATGCCCACCAGACACTAAACCAGGGGAGATTGGCTGCATTGAG1641 CysGlnCysProProAspThrLysProGlyGluIleGlyCysIleGlu 520525530 CGTACCACATGCAACCCTAAAGAGATACAAGAATGCCAAGACAAGAAG1689 ArgThrThrCysAsnProLysGluIleGlnGluCysGlnAspLysLys 535540545 CTCGAGTGCGTTTACAAAAACCATAAAGCAGAATGCAAGTGTCCTGAT1737 LeuGluCysValTyrLysAsnHisLysAlaGluCysLysCysProAsp 550555560 GATCACGAGTGTTCTAGGCAGCCTGCCAAAGACTCTTGCAGTGAAGAG1785 AspHisGluCysSerArgGlnProAlaLysAspSerCysSerGluGlu 565570575 GATAATGGTAAATGTCAAAGCAGTGGGCAGCGTTGTGTAATGGAAAAC1833 AspAsnGlyLysCysGlnSerSerGlyGlnArgCysValMetGluAsn 580585590595 GGAAAGGCTGTTTGCAAAGAGAAGTCTGAAGCAACAACAGCTGCGACT1881 GlyLysAlaValCysLysGluLysSerGluAlaThrThrAlaAlaThr 600605610 ACAACAACGAAAGCGAAAGACAAGGATCCAGATCCTGGAAAGTCAAGT1929 ThrThrThrLysAlaLysAspLysAspProAspProGlyLysSerSer 615620625 GCTGCAGCAGTATCAGCTACTGGGCTCTTGTTACTGCTCGCAGCTACT1977 AlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeuAlaAlaThr 630635640 TCAGTCACCGTAGCATCGTTGTAATGAAGATGTCCAACTTGAATACGGAAC2028 SerValThrValAlaSerLeu 645650 AGCTTGAAAATGTATATATACATCGCGCTTACATCGAACACCTAGCTTGGTTTTTGGGAT2088 TTCAATATTGCGCATGGGTACTCACGTCAACATGGGATGTATTATTTGAGAATGACAAG2147 (2) INFORMATION FOR SEQ ID NO:67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 650 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: MetArgGlyIleAlaLeuPheValAlaAlaValSerLeuIleValGlu 151015 CysThrAlaGluSerSerIleCysSerAspPheGlyAsnGluPheCys 202530 ArgAsnAlaGluCysGluValValProGlyAlaGluAspAspPheVal 354045 CysLysCysProArgAspAsnMetTyrPheAsnAlaAlaGluLysGln 505560 CysGluTyrLysAspThrCysLysThrArgGluCysSerTyrGlyArg 65707580 CysValGluSerAsnProSerLysGlySerCysValCysGluAlaSer 859095 AspAspLeuThrLeuGlnCysLysIleLysAsnAspPheAlaThrAsp 100105110 CysArgAsnArgGlyGlyThrAlaLysLeuArgThrAspGlyPheIle 115120125 GlyProThrCysAspCysGlyGluTrpGlyAlaMetAsnLysThrThr 130135140 ArgAsnCysValProThrThrCysLeuArgProAspLeuThrCysLys 145150155160 AspLeuCysGluLysAsnLeuLeuGlnArgAspSerArgCysCysGln 165170175 GlyTrpAsnThrAlaAsnCysSerAlaAlaProProAlaAspSerTyr 180185190 CysSerProGlySerProLysGlyProAspGlyGlnCysLysAsnAla 195200205 CysArgThrLysGluAlaGlyPheValCysLysHisGlyCysArgSer 210215220 ThrAspLysAlaTyrGluCysThrCysProSerGlySerThrValAla 225230235240 GluAspGlyIleThrCysLysSerIleSerTyrThrValSerCysThr 245250255 ValGluGlnLysGlnThrCysArgProThrGluAspCysArgValGln 260265270 LysGlyThrValLeuCysGluCysProTrpAsnGlnHisLeuValGly 275280285 AspThrCysIleSerAspCysValAspLysLysCysHisGluGluPhe 290295300 MetAspCysGlyValTyrMetAsnArgGlnSerCysTyrCysProTrp 305310315320 LysSerArgLysProGlyProAsnValAsnIleAsnGluCysLeuLeu 325330335 AsnGluTyrTyrTyrThrValSerPheThrProAsnIleSerPheAsp 340345350 SerAspHisCysLysArgTyrGluAspArgValLeuGluAlaIleArg 355360365 ThrSerIleGlyLysGluValPheLysValGluIleLeuAsnCysThr 370375380 GlnAspIleLysAlaArgLeuIleAlaGluLysProLeuSerLysTyr 385390395400 ValLeuArgLysLeuGlnAlaCysGluHisProIleGlyGluTrpCys 405410415 MetMetTyrProLysLeuLeuIleLysLysAsnSerAlaThrGluIle 420425430 GluGluGluAsnLeuCysAspSerLeuLeuLysAsnGlnGluAlaAla 435440445 TyrLysGlyGlnAsnLysCysValLysValAspAsnLeuPheTrpPhe 450455460 GlnCysAlaAspGlyTyrThrThrThrTyrGluMetThrArgGlyArg 465470475480 LeuArgArgSerValCysLysAlaGlyValSerCysAsnGluAsnGlu 485490495 GlnLeuGluCysAlaAsnLysGlyGlnIleCysValTyrGluAsnGly 500505510 LysAlaAsnCysGlnCysProProAspThrLysProGlyGluIleGly 515520525 CysIleGluArgThrThrCysAsnProLysGluIleGlnGluCysGln 530535540 AspLysLysLeuGluCysValTyrLysAsnHisLysAlaGluCysLys 545550555560 CysProAspAspHisGluCysSerArgGlnProAlaLysAspSerCys 565570575 SerGluGluAspAsnGlyLysCysGlnSerSerGlyGlnArgCysVal 580585590 MetGluAsnGlyLysAlaValCysLysGluLysSerGluAlaThrThr 595600605 AlaAlaThrThrThrThrLysAlaLysAspLysAspProAspProGly 610615620 LysSerSerAlaAlaAlaValSerAlaThrGlyLeuLeuLeuLeuLeu 625630635640 AlaAlaThrSerValThrValAlaSerLeu 645650 (2) INFORMATION FOR SEQ ID NO:68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 441 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: Figure 17 (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..441 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68: GCCCTTGTTTTGGACGCGATAAAGACCAGTATCGGAAGCGAAGTTTCT48 AlaLeuValLeuAspAlaIleLysThrSerIleGlySerGluValSer 151015 AAACTTGAGATACTGAACTGCACGCAGGATATTAAGGCAAGGCTCATA96 LysLeuGluIleLeuAsnCysThrGlnAspIleLysAlaArgLeuIle 202530 GTACCGAAACCGCTATCAAAGCACGTGCTCAAGAAGCTTCAAGCATGC144 ValProLysProLeuSerLysHisValLeuLysLysLeuGlnAlaCys 354045 GAGCATCCCGTCGGGGACTTGTGTATGCTGTATCCGAAGTTGCCGATC192 GluHisProValGlyAspLeuCysMetLeuTyrProLysLeuProIle 505560 AAGAAAAACTCTGCGACAGAAATTGAAGAAGAGAACCTTTGCGACAGC240 LysLysAsnSerAlaThrGluIleGluGluGluAsnLeuCysAspSer 65707580 CTCCTCAAGCGTCAGGAAGCTGCCTACAAGGGTCAGAACAAATGCGTC288 LeuLeuLysArgGlnGluAlaAlaTyrLysGlyGlnAsnLysCysVal 859095 AAGGTCGGTAACATTTTCTGGTTCCAGTGCGCTGATGGTTACAGATCA336 LysValGlyAsnIlePheTrpPheGlnCysAlaAspGlyTyrArgSer 100105110 GTTTACGACATCACACAAGGTCGCCTACGCCGCTCCGTGTGCGAACGT384 ValTyrAspIleThrGlnGlyArgLeuArgArgSerValCysGluArg 115120125 GGAATTTCTTGCAGTGATAATGAACAGTTGGAGTGTGCCAAGAAAGGA432 GlyIleSerCysSerAspAsnGluGlnLeuGluCysAlaLysLysGly 130135140 CAAATATGT441 GlnIleCys 145 (2) INFORMATION FOR SEQ ID NO:69: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 147 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69: AlaLeuValLeuAspAlaIleLysThrSerIleGlySerGluValSer 151015 LysLeuGluIleLeuAsnCysThrGlnAspIleLysAlaArgLeuIle 202530 ValProLysProLeuSerLysHisValLeuLysLysLeuGlnAlaCys 354045 GluHisProValGlyAspLeuCysMetLeuTyrProLysLeuProIle 505560 LysLysAsnSerAlaThrGluIleGluGluGluAsnLeuCysAspSer 65707580 LeuLeuLysArgGlnGluAlaAlaTyrLysGlyGlnAsnLysCysVal 859095 LysValGlyAsnIlePheTrpPheGlnCysAlaAspGlyTyrArgSer 100105110 ValTyrAspIleThrGlnGlyArgLeuArgArgSerValCysGluArg 115120125 GlyIleSerCysSerAspAsnGluGlnLeuGluCysAlaLysLysGly 130135140 GlnIleCys 145 (2) INFORMATION FOR SEQ ID NO:70: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F9 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70: LysAlaAsnArgGlnCysProProAspThrArgArgGlyLys 1510 (2) INFORMATION FOR SEQ ID NO:71: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (vii) IMMEDIATE SOURCE: (B) CLONE: F10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71: LysCysAsnCysAspCysProProAspThrArgProGlyLys 1510 __________________________________________________________________________
(57)

We claim:

1. An isolated and purified DNA molecule, free of homologous chromosomal DNA, comprising SEQ ID NO:55.
2. An isolated and purified polynucleotide sequence, free of homologous chromosomal DNA, encoding amino acids 1-650 of the polypeptide of SEQ ID NO:56.
3. An isolated and purified polynucleotide sequence free of homologous chromosomal DNA, which hybridizes to an isolated polynucleotide sequence encoding amino acids 1-650 of the polypeptide of SEQ ID NO:56 under conditions consisting of hybridization at 68° C. for 20 hours, followed by washing, wherein said washing comprises washing in 2X SSC, 0.1% SDS, twice for 30 minutes at 55° C. and three times for 15 minutes at 60° C.
4. An isolated polynucleotide sequence according to claim 3, wherein said polynucleotide sequence encodes a polypeptide that produces an immune response against tick infestation in a mammalian host when said polypeptide is administered to said mammalian host.
5. An isolated polynucleotide free of homologous chromosomal DNA, encoding a fragment of a polypeptide having the sequence of amino acids 1-650 of (SEQ ID NO:56), wherein said fragment is at least 193 amino acids in length.
6. An isolated polynucleotide according to claim 5, wherein said fragment encodes a polypeptide selected from the group consisting of amino acids 31 to 629, amino acids 31 to 406, amino acids 31 to 223, or amino acids 351 to 576 of the polypeptide having the sequence (SEQ ID NO:56).
7. A recombinant cloning vector comprising the DNA sequence according to claim 1.
8. A vector according to claim 7 wherein said vector further comprises phage, viral or plasmid DNA.
9. A vector according to claim 8 wherein said phage, viral, or plasmid DNA comprises lambda gt11, pUR290, pUR291, pUR282, pUK270, pUC8, pUC9, baculovirus, pZipNeo, an SV40 based vector, λgt10, an EMBL vector, pB327, pB329 or pBR329 containing a par locus.
10. Plasmid pBTA 707.
11. A vector according to claim 7 additionally comprising an expression control sequence operatively linked to said DNA sequence.
12. A vector according to claim 11 wherein said expression control sequence comprises a promoter and a translation start signal.
13. A transformed cell comprising a vector according to claim 7.
14. A transformed cell according to claim 13 wherein said cell is a bacterial, yeast, mammalian or insect cell.
15. A transformed cell according to claim 14 wherein said cell is Y 1090, Y 1089, or JM 101.
16. A transformed host cell accorded accession number ATCC 67548.
*****

Download Citation


Sign in to the Lens

Feedback