Assays For Compounds Which Extend Life Span

ASSAYS FOR COMPOUNDS WHICH EXTEND LIFE SPAN

BACKGROUND OF THE INVENTION

One of the great challenges of modern biology is an explanation of aging at the organismal level. The fundamental property of aging is manifest in organisms as complex as humans and as simple as the single-celled yeast, Saccharomyces cerevisiae . The ability to extend life span and forestall senescence has long been the subject of debate and exploration.

Recent studies of the premature aging disease, Werner's syndrome, provide possible clues about the aging process. Beginning soon after puberty, Werner's syndrome patients display many symptoms of old age, including graying and loss of hair, osteoporosis, cataracts, atherosclerosis, loss of skin elasticity and a propensity for certain cancers. Because cells isolated from Werner's patients divide approximately half as many times in culture as those from normal individuals (Salk et al . , Cytogreπet. Cell . Genet . 30 : 108

(1981); G.M. Martin, Adv. Exp . Med . Biol . 190 : 161

(1985) ) , it is possible that both organismal aging and cellular aging are manifestations of the same process (Lombard and Guarente, Trends Genet . 12 : 283 (1996)). SUMMARY OF THE INVENTION

The premature aging disease, Werner's syndrome, results from mutations in a single recessive gene, WRN.

As described herein, mutation of the yeast WRN homolog, SGS1 , causes premature aging in yeast mother cells. The aging-induced phenotype of sterility and redistribution of the Sir3 silencing protein from telomeres to the nucleolus occurs prematurely in sgsl yeast cells.

Further, the nucleolus is enlarged and fragmented in these cells, a change that also occurs in old wild type cells. These findings suggest a remarkably conserved mechanism of cellular aging which may be related to nucleolar structure. The observation that mutation of the yeast Werner's homolog, SGS1 , results in premature aging suggests that a common mechanism underlies aging in eukaryotes as diverse as yeast and humans. Thus, insight into the aging process in model systems can provide insight into aging in humans.

The subject invention pertains to methods of identifying agents or compounds which inhibit the replication and/or accumulation of DNA circles, e.g., ribosomal DNA (rDNA) circles, comprising an autonomously replicating sequence (ARS) , e.g., rDNA ARS, in cells. The invention also encompasses methods of assessing the ability of a compound to extend life span of a cell, comprising contacting a cell or cells (referred to as a test cell or cells) with a compound which inhibits the replication and/or accumulation of DNA circles comprising an ARS in cells, and assessing the life span of the test cell relative to a comparable cell or cells which was not contacted with the compound (a control cell or cells) . If the life span of the test cell is longer than the life span of the control cell, then the compound extends life span. The invention also relates to methods of extending life span, comprising administering to a cell a compound which inhibits replication and/or accumulation of rDNA circles in the cell, with the result that the life span of the cell is extended (is longer than it would have been in the absence of the compound) . These compounds can be compounds identified by the methods described herein, derivatives (modified forms) of compounds identified by the present methods, or compounds identified by another method (e.g., computer modeling of compounds designed with reference to structures and/or characteristics of compounds identified by the present method) and synthesized by known methods (e.g., chemical synthesis, peptide chemistry) .

As described herein, a mouse gene referred to as mWRN, which is a homolog of Sgslp and WRN, has been discovered. This invention also pertains to isolated mWRN, or an active derivative or fragment thereof; in a particular embodiment, the isolated mWRN protein has the amino acid sequence of SEQ ID NO: 6 (Figure 5) . In one embodiment, the polypeptide is a fragment having mWRN activity, e.g., binding or enzymatic activity. In another embodiment, the polypeptide is a derivative possessing substantial sequence identity with endogenous mWRN. In particular embodiments, the mWRN protein is purified to homogeneity or is substantially free of other proteins .

The invention also pertains to an isolated nucleic acid molecule which encodes mWRN, or an active derivative or fragment thereof. In a particular embodiment, the nucleic acid molecule has the nucleotide sequence of SEQ ID NO: 5 (Figure 4) . In one embodiment, the nucleic acid molecule encodes a polypeptide fragment having mWRN activity. In another embodiment, the nucleic acid molecule encodes a derivative of mWRN possessing substantial sequence identity with endogenous mWRN. In particular embodiments, the isolated nucleic acid molecule encodes mWRN with the same amino acid sequence as endogenous mWRN. In another embodiment, the isolated nucleic acid molecule has the same nucleotide sequence as the endogenous gene encoding mWRN.

The invention also relates to DNA constructs comprising the nucleic acid molecules described above operatively linked to a regulatory sequence, and to recombinant host cells, such as bacterial cells, fungal cells, plant cells, insect cells and mammalian cells, comprising the nucleic acid molecules described above operatively linked to a regulatory sequence. The invention also pertains to an antibody, or an antigen- binding fragment thereof, which selectively binds to mWRN, or an active derivative or fragment thereof; in a particular embodiment, the antibody is a monoclonal antibody.

The invention also pertains to a mouse and its progeny having a suppressed level of expression of the mWRN gene. The invention further relates to a mouse and its progeny in which the mWRN gene is suppressed, either physically or functionally. The invention also relates to embryonic stem cell lines containing a mWRN knockout construct.

In another embodiment, the invention relates to a method of screening a compound for the ability to alter life span comprising administering the compound to a mouse with a suppressed level of mWRN expression and assaying the mouse for altered life span. The invention also relates to compounds identified by assays described herein. BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1A and IB illustrate that mutant sgsl cells have a short life span. Mortality curves of wild type (W303-1A MATa ade2-l canl -100 his3 -ll , 15 leu2 -3 , 112 trpl -1 ura3 -l , from R. Rothstein) and isogenic mutant derivatives, sgsl : : HIS3 , adal : :hisG, and hap5 : :hisG were determined. Figure 1A shows the results for wild type and sgsl : : HIS3 . Figure IB shows the results for wild type, adal : :hisG, and hap5 : :hisG. Average life spans were as follows (sample sizes are given in parentheses) : wild type, 24.5 divisions (39); sgsl , 9.5 divisions

(30); adal , 3.3 divisions (23); and hap5, 16.6 divisions

(28) .

Figures 2A-2D illustrate that mutant sgsl cells age prematurely. Cells of various ages were scored for their ability to undergo cell cycle arrest and schmooing in response to the yeast mating pheromone, -factor. The number of cells in each data set for each age group are shown above the bar. Figure 2A shows results for sgsl cells; Figure 2B shows results for sgsl hmlαΔ cells. Figure 2C shows the results for hap5 cells, and

Figure 2D shows results for adal cells.

Figures 3A and 3B show mWRN genomic clones and targeting construct. Figure 3A illustrates restriction maps of two overlapping genomic clones containing a portion of the helicase domain. The fragment used as a hybridization probe to screen neomycin-resistant colonies is bracketed in the longer genomic clone . Figure 3B illustrates the mWRN targeting construct . The direction of transcription of both the mWRN gene and the βgeo cassette is indicated. In both Figures 3A and 3B, not all Hindlll sites are indicated.

Figures 4A-4I illustrate the nucleic acid sequence (SEQ ID NO: 5) and the amino acid sequence (SEQ ID NO: 6) of the mWRN gene. Stops in the 5' untranslated region are underlined and potential polyadenylation sites in the 3' untranslated region are in bold. Double underlining indicates the exon deleted in the targeting construct .

DETAILED DESCRIPTION OF THE INVENTION

Werner's syndrome results from a recessive mutation in a single gene, WRN, which encodes a protein with substantial similarity to the E. coli RecQ DNA helicase (Yu et al . , Science 272:258 (1996)). Other members of the RecQ helicase family include human BLM (mutations in which cause Bloom's syndrome; Ellis et al . , Cell 83 : 655

(1995)), human RECQL (Puranam and Blackshear, J. Biol .

Chem . 269 : 29838 (1994); Seki et al . , Nucl . Acids Res . 22:4566 (1994)), and SGSl of Saccharomyces cerevisiae

(Gangloff et al . , Mol . Cell . Biol . 14 : 8391 (1994); Watt et al . , Cell 81 : 253 (1995)). Bloom's syndrome is characterized by a high rate of cancers and sunlight sensitivity, but not typical aging phenotypes (German, Medicine 72:393 (1993)). The different symptoms of

Werner's and Bloom's syndromes suggest that WRN has a functional specificity that underlies premature aging. The yeast WRN homolog is known as SGSl . Mutations in SGSl were first identified as suppressors of the slow growth phenotype of cells lacking topoisomerase III ( TOP3 ) activity (Gangloff et al . , Mol . Cell . Biol .

14 : 8391 (1994)). SGSl has since been shown to suppress recombination at the ribosomal DNA (rDNA) array (Christman et al . , Cell 55:413 (1988)) and other loci (Watt et al . , Genetics 144 : 935 (1996)), as well as maintaining the fidelity of chromosome segregation during cell division (Watt et al . , Cell 81:253 (1995)).

Sgslp interacts genetically and physically with both topoisomerases II and III (Gangloff et al . , Mol. Cell.

Biol. 14:8391 (1994); Watt et al . , Cell 81:253 (1995)), suggesting that the DNA helicase and topoisomerase activities are coupled. Based on complementation assays, Sgslp function requires the C-terminus, but surprisingly, not DNA helicase activity (Lu et al . ,

Nature 383:618 (1996)) . Cell division in S. cerevisiae is asymmetric, giving rise to a large mother and a small daughter cell (Hartwell and Unger, J. Cell Biol. 75:4222 (1977);

Kennedy et al . , J. Cell Biol. 127:1985 (1994)). Yeast aging is defined by the relatively fixed number of cell divisions undergone by mother cells (Muller et al . ,

Aging Dev. 22:47 (1980)), as well as characteristic changes during their life span (Jazwinski, Science

273:54 (1996)), such as cell enlargement (Mortimer and

Johnson, Nature 183:1751 (1959)) and sterility (Muller, J. Microbiol. Serol . 51:1 (1985)). This sterility is due to a loss of transcriptional silencing at HMRa and

HMLα. loci, and the resulting expression of both a and α mating-type information (Smeal et al . , Cell 84:633

(1996) ) . Loss of telomeric silencing in old yeast cells has also been observed (Kim et al . , Biochim. Biophys .

Res. Commun. 219:310 (1996)). In young cells, silencing at HM loci and telomeres (Klar et al . , Nature 289:239

(1981); Ivy et al . , Mol. Cell. Biol. 6:688 (1986); Rine and Herskowitz, Genetics 116:9 (1987)) is mediated by the Sir2/3/4 protein complex (Gottschling et al . , Cell

63:151 (1990); Aparicio et al . , Cell 66:1219 (1991)). Sir2p silences marker genes inserted at rDNA (Bryk et al . , Genes Dev. 22:255 (1997); Smith and Boeke, Genes

Dev. 22:241 (1997)) and suppresses recombination between rDNA repeats (Gottleib and Esposito, Cell 56 : 111 (1989)) . The rDNA in yeast consists of a tandem array of about 140 copies of a 9 kb repeat encoding 35S RNA and 5S RNA residing on chromosome 12. This rDNA array is assembled into a crescent-shaped, subnuclear structure termed the nucleolus, in which assembly of ribosomes occurs. The role of Sir3p and Sir4p at the rDNA locus is less clear.

The genes encoding the SIR complex ( SIR2 , SIR3 , and

SIR4) , as well as UTH4, are determinants of life span in yeast (Kennedy et al . , Cell 89 : 381 (1997)). Null mutations in these genes shorten life span (Kennedy et al . , Cell 50:485 (1995)), while over-expression of UTH4 extends life span. It has recently been shown by indirect immunofluorescence that the life span extension by the Sir complex is associated with a redistribution of these factors from telomeres (and HM loci) to the nucleolus in old cells. This redistribution required UTH4 and its yeast homolog YGL023 (Kennedy et al . , Cell

89 : 381 (1997) ) .

As shown herein, deletion of the yeast homolog of human WRN, a gene responsible for the premature aging disease Werner's syndrome, also causes premature aging in yeast. The conclusion that yeast sgsl mutants age prematurely is based on three types of data. First, the life span of mother cells is reduced by about 60% compared to wild type. Second, sgsl mutant cells prematurely assume the aging-specific phenotype of sterility. In contrast, mutations in other yeast genes either did not shorten life span, or did not result in the aging-specific phenotype of sterility. Third, the Sir protein silencing complex redistributes from telomeres to the nucleolus in old sgsl cells, as observed in old wild type cells. It is remarkable that mutation of SGSl and homologs thereof in such diverse organisms as yeast and humans creates a phenocopy of premature aging. This finding suggests that a cellular-based aging mechanism is highly conserved among eukaryotic organisms. The analysis of Sgslp described herein provides a molecular insight into aging. By immuno- localization, it was found that Sgslp is concentrated in the nucleolus in yeast cells. By staining old sgsl cells for Noplp, enlargement and fragmentation of the nucleolus was noted. These changes further validate the conclusion that sgsl mutants age prematurely, because identical morphological changes were also observed in very old wild type cells. Interestingly, the nucleolar fragments were often arrayed in an orderly series of spots around the periphery of the nucleolus. It is possible that this configuration represents membrane attachment of the fragments and promotes their biased segregation into mother cells.

It is unlikely that nucleolar enlargement and fragmentation are simply markers of aging which occur, for example, in response to other cellular damage, for at least two reasons. First, an independent study of the relationship between the Sir silencing complex and aging indicated a central role for the nucleolus in determining life span. Second, the concentration of

Sgslp in the nucleolus suggests that a nucleolar defect resulting from the absence of this DNA helicase may be a direct cause of the premature aging of these mutants .

It is also unlikely that nucleolar enlargement and fragmentation represent counteractive measures employed in response to other cellular damage. Since sir3 mutants display nucleolar enlargement and fragmentation earlier than wild type, and also age prematurely, it does not appear that these changes are part of a longevity response. Rather, it appears that nucleolar changes represent a cause of aging, and that this process is repressed by the redistribution of Sir proteins to the nucleolus.

Enlargement and fragmentation of yeast nucleoli have also been observed under certain conditions, including high levels of the nucleolar protein Nop2p (de Beus et al . , J. Cell Biol . 227:1799 (1994)); inhibition of mRNA export (Kadowaki et al . , Mol . Biol . Cell 5:1253

(1994); Tani et al . , Mol . Cell . Biol . 5:1515 (1995)); and a subthreshold level of RNA polymerase I (Oakes et al . , Mol . Cell . Biol . 23:2441 (1993)). It will be interesting to determine if the fragmented nucleoli in these cases also lead to a short life span and premature sterility, thus strengthening the link between loss of silencing, nucleolar fragmentation, and aging.

Work described herein shows that the age-related enlargement and fragmentation of the nucleolus are due to changes at the rDNA locus that occur with age . One possibility is that aging, in part, results from the inherent instability of the 100 to 200 tandem copies of the 9.1 kb rDNA unit arrayed on chromosome 12 (Warner, Micro . Rev. 53 : 256 (1989)). Homologous recombination between adjacent repeats leads to the excision of unit-sized rDNA circles (Kim and Wang, Cell 57 : 915 (1987) ) that replicate via the autonomously replicating sequence (ARS) present in rDNA (Miller and Kowalski, Mol . Cell . Biol . 13 : 5360 (1993)). A segregation bias in such rDNA circles would result in exponential accumulation in old mother cells and cause senescence by titrating important DNA-replication factors. Consistent with this model, cells containing plasmid-borne rDNA molecules have Noplp staining patterns identical to those described herein in old yeast cells (Nierras et al . , Chromosoma , in press (1997); Palladino et al . , Cell

75:543 (1993)). "Runaway" amplification of extrachromosomal circular DNA is a mechanism of senescence in certain other cases: yeast nibl mutants

(Holm, Cell 29 : 585 (1982); Sweeney and Zakian, Genetics 222:749 (1989)) and the filamentous fungus, Podospora anserina (Jamet-Vierny et al . , Cell 22:189 (1980)).

As shown herein, unit-sized rDNA circles accumulate exponentially in old yeast mother cells; these rDNA circles are responsible for age-related enlargement and fragmentation of the nucleolus, and appear to nucleate the fragmented nucleolus. In sgsl mutants, this process is accelerated, resulting in premature aging and shortened life span. Thus, agents or compounds which inhibit (e.g., reduce or prevent) this process are useful to confer extended life span upon cells treated therewith. One embodiment of the subject invention is an assay, e.g., a colony screen, for agents which inhibit the replication and/or accumulation of DNA circles, e.g., rDNA circles, comprising an ARS, such as an rDNA ARS, in cells.

In one embodiment of the assay, yeast cells which are deficient in a gene which is necessary for growth are transformed with a plasmid containing the corresponding gene (a marker gene) and an ARS. Suitable marker genes include, but are not limited to, ADE2 , LEU2, URA3, HIS3 , TRP1, lacZ, GFP and LYS2. Transformants are able to grow in media deficient in the nutrient encoded by the marker gene; non-transformed cells will not. For example, ade2 - yeast cells transformed with a plasmid comprising the ADE2 gene are able to grow in the absence of adenine . The absence of the ADE2 gene product results in a block in the adenine biosynthetic pathway, which leads to the accumulation of a red pigment (normally yeast colonies are white) . In transformants, the plasmid is either stably integrated into the genome or present as an unstable DNA circle in the cell . The two classes of transformants are distinguishable because of the segregation bias of the plasmid DNA circles containing the ARS and marker gene. These circles preferentially remain with the mother cell, and, thus, offspring are unable to grow in the absence of the necessary nutrient (e.g., adenine) . As a result, colonies in which the plasmid has stably integrated (class I transformants) will grow exponentially, and colonies which contain the plasmid as an unstable DNA circle (class II transformants) will not grow exponentially but rather linearly. The difference between the two classes of transformants will be apparent by colony size in three to four days.

The two classes of transformants can then be used in an assay to assess the ability of compounds to inhibit the replication and/or accumulation of the plasmid DNA circles. Both the class I and class II transformants are grown in the absence of the necessary nutrient encoded by the marker gene. The cells of each class are transferred to separate, duplicate microtiter dishes (also deficient in the necessary nutrient) which contain a compound to be assessed in each well at an appropriate concentration or amount. Growth in each well is assessed, and compounds which inhibit growth are identified. Compounds which inhibit the growth of both class I and class II transformants are likely to be nonspecific inhibitors and are generally not useful for further study. However, compounds which inhibit the growth of class II transformants but do not affect class I transformants are likely to be specific inhibitors of the replication and/or accumulation of DNA circles. Such compounds are useful to inhibit the age-related enlargement and fragmentation of the nucleolus and corresponding aging; thus, these compounds can be used to extend the life span of cells treated therewith.

A similar screening strategy can be adapted for use in mammalian cells. For example, a plasmid comprising a marker gene and an ARS is inserted into the germline cells of a mammal, e.g., a mouse. Any suitable marker gene which allows one to differentiate between cells which contain the plasmid and cells which do not, including, but not limited to, LACZ and GFP, can be used. Preferably, the marker gene produces a phenotypic effect when expressed. In an assay utilizing mammalian cells, stem cells are equivalent to yeast mother cells, and differentiated cells are equivalent to yeast daughter cells, of the yeast-based assay described above. The mammal is treated with an agent to be tested, and the effect of the agent on the accumulation and/or replication of the plasmid in stem cells and differentiated cells is assessed. In one embodiment, the presence and/or amount of the plasmid in stem cells can be assessed by analyzing an organ or portion thereof which has a high concentration of stem cells; for example, the presence and/or amount of the plasmid can be assessed in crypt cells. Agents which inhibit the replication and/or accumulation of the plasmid are useful to extend the life span of the mammal. The ability of compounds identified by the assays described above to confer extended life span can also be assessed by assaying the life span of cells, e.g., yeast cells or mammalian cells, treated with the identified compound. For example, methods for isolating yeast cells with an increased life span are described in U.S. patent application Serial No. 08/396,001 (Issue Fee paid June 13, 1997); the teachings of this application are incorporated herein by reference. These assays, as well as others known in the art, are suitable for use in determining whether cells treated with an identified compound exhibit extended life span relative to untreated cells.

For example, techniques described herein can be used to isolate cells with increased life span from yeast and other cell types (e.g., mammalian cells) . Any cell strain for which the normal life span is known can be utilized. The life span of the strain can be determined by calculating the mean number of generations before senescence in a sample of colonies of the strain of interest. The average life span of normal (wild type) cells is used as a comparison standard (control) against which the life span of test cells, e.g., cells of the same strain which are treated with an agent of interest, can be measured. Test cells are treated with a compound of interest, the life span of the treated test cells is determined, and the life span of the treated test cells is compared with the average life span of normal cells of the same strain. For example, cells with increased life spans can be isolated as follows :

Stress-Resistance Method

Yeast cells that have been treated with a compound of interest are plated with minimal nutrients (including carbon and nitrogen sources, as well as the amino acids and nucleotides that are required by the particular strain for growth) . The minimal plates are replica- plated to plates lacking vital nutrients, such as nitrogen and carbon (the starvation plates) . After incubation of the starvation plates at a temperature appropriate for growth, for several days, the starvation plates are replicated back to rich media plates. The rare colonies containing living cells when plated back onto rich medium (the "starvation resistant" colonies) are then examined to determine whether the life span is extended. Life span is calculated as described above.

Cell Surface Labeling Method

This method takes advantage of the fact that the cell surface (including the cell membrane and cell wall) of a daughter cell in some budding yeast, such as S . cerevisiae, is fabricated entirely of new materials: when the cell surface of the mother cell is labeled, the surface of the daughter cells remains unlabeled. In one embodiment, the cell surface is labeled with biotin. When avidin linked to fluorescence is coupled to the biotin, the cell surface fluoresces . Alternatively, any other method of labelling the cell surface with a fluorescent marker is appropriate. Daughter cells remain unlabeled (will not fluoresce) . Fluorescently- labeled yeast cells are plated and cultured for a period of time greater than the life span of the control cells which have not been treated with a compound of interest (as measured by time necessary for one cell division, multiplied by the number of divisions, or generations, in the life span) . If desired, the yeast cells may be sampled at regular time intervals in order to monitor the plating efficiency of the cells; the efficiency will drop precipitously after the chronological life span has passed. The yeast cells are then subjected to fluorescence-activated cell sorting (FACS) , to isolate the fluorescently labeled cells. The fluorescent cells are then replated; only cells with increased life spans will grow. Temperature-Sensitive Method

A temperature-sensitive strain of yeast, in which the offspring die at the non-permissive temperature, is utilized in this method. For example, yeast cells with a mutation in the mdm2-2 gene (also known as the ole-1 gene) (McDonnell, et al . , J". Cell Biol . 111 : 961 - 916

(1990) ) bud forth living daughter cells at 30°C, but not at 37°C, because of a failure in appropriate organelle segregation at the higher temperature (mitochondria are not put into daughter cells) . In such a temperature- sensitive mutant, the daughter cells bud off from the mother cell and die at the non-permissive temperature; the dead daughter cells remain near the mother cell . Therefore, .each mother cell grown at the non-permissive temperature generates a microcolony of N cells, where N is equal to the number of generations in the life span of the mother cell. Mutant strains will display microcolonies wherein the number of cells is greater than N. To isolate cells having an extended life span, cells are plated at the permissive temperature. A sample of cells from each colony is then transferred to a plate to be grown at the non-permissive temperature. Microcolonies with cell number greater than N are indicative of mutants having an extended life span; cells from the colonies which have been identified as mutant can be selected from the plates grown at the permissive temperature. Alternatively, cells are plated directly at the non-permissive temperature, and grown for a period of time greater than the life span as measured by time necessary for one cell division, multiplied by the number of divisions, or generations, in the life span. If desired, the yeast cells may be sampled at regular time intervals in order to monitor the plating efficiency of the cells; the efficiency will drop precipitously after the chronological life span has passed. After this time, the plates are shifted back to the permissive temperature. Only longer-lived cells will grow after the temperature shift.

The above-described methods for isolating cells with a longer life span can be employed to confirm or test the ability of agents, identified by their ability to inhibit the replication and/or accumulation of DNA circles, to alter the life span of an organism. For example, agents which have been identified by methods described herein as inhibiting the replication and/or accumulation of rDNA circles in an organism can be assessed to determine their ability to extend the life span of treated cells . In one embodiment of the current invention, the cells of interest, for which the life span is known or has been calculated, are exposed to or treated with an agent to be tested, e.g., an agent which inhibits the replication and/or accumulation of rDNA circles in a cell. The cell samples thus exposed or treated are then examined for longer-lived colonies, using any of the methods described above or other appropriate methods. Colonies exhibiting a longer life span in the presence of the agent than in the absence of the agent are indicative of the ability of the agent to increase life span, or to postpone senescence.

Appropriate agents to be tested can include drugs, small molecules, peptides, oligonucleotides, antibodies, and genes encoding proteins that increase life span.

Alternatively, agents identified as inhibiting the replication and/or accumulation of rDNA circles can be assessed to determine their ability to extend life span at the organismal level. For example, a mammal can be treated with an agent identified by its ability to inhibit the replication and/or accumulation of DNA circles, and the mammal can be assessed for the slowing of the normal phenotypes of aging, such as hair loss, graying of hair, osteoporosis, cataracts, atherosclerosis, loss of skin elasticity and a propensity for certain cancers. Compounds identified by the assays described herein which extend life span as described above, can be used to extend the life span of cells, e.g., mammalian cells including human cells. For example, cells to be treated can be contacted with the identified compound, thereby extending their life span relative to untreated cells. The present invention also pertains to pharmaceutical compositions comprising compounds or agents described herein. For instance, a compound of the present invention (e.g., a life-span extending agent) can be formulated with a physiologically acceptable vehicle to prepare a pharmaceutical composition. These compounds can be administered, e.g., parenterally, as a solution, alone or in combination with other compounds dissolved in an acceptable carrier, preferably an aqueous carrier. A variety of appropriate aqueous carriers are known to the skilled artisan, including water, buffered water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), dextrose solution and glycine. These compositions can optionally contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents and toxicity adjusting agents, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride and sodium lactate. The optimum concentration of the active ingredient (s) in the chosen vehicle can be determined empirically, according to procedures well known to the skilled artisan, and will depend on the ultimate pharmaceutical formulation desired. The present invention further relates to an agent, compound or nucleic acid molecule as described herein for use in therapy (including prophylaxis) or diagnosis, and to the use of such an agent, compound or nucleic acid molecule for the manufacture of a medicament for the treatment of an age-related disorder or for the inhibition of aging as described herein.

A variety of routes of administration are possible including, but not limited to, oral, sublingual, intraocular, dietary, topical, parenteral (e.g., intravenous, intraarterial, intramuscular, subcutaneous injection), inhalation (e.g., intrabronchial , intranasal or oral inhalation, intranasal drops) , routes of administration, depending on the disease or condition to be treated. Other suitable methods of introduction can also include rechargeable or biodegradable devices and slow release polymeric devices. The pharmaceutical compositions of this invention can also be administered as part of a combinatorial therapy with other agents . Formulation (e.g., solution, emulsion, capsule) of a compound to be administered will vary according to the route of administration selected. An appropriate composition comprising the compound to be administered can be prepared in a physiologically acceptable vehicle or carrier. For solutions or emulsions, suitable carriers include, for example, aqueous or alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles can include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles can include various additives, preservatives, or fluid, nutrient or electrolyte replenishers (See, generally, Remington ' s Pharmaceutical Science, 16th Edition, Mack, Ed. 1980) . For inhalation, the compound can be solubilized and loaded into a suitable dispenser for administration (e.g., an atomizer, nebulizer or pressurized aerosol dispenser) .

As described herein, it has been determined that there is a mouse homolog of Sgslp and WRN (Imamura et al . , Genomics 42:298-300 (1997); this gene is referred to herein as mWRN. Accordingly, the invention pertains to an isolated nucleotide sequence (nucleic acid molecule) encoding mWRN. In a particular embodiment, the nucleic acid sequence encoding mWRN has the nucleotide sequence of SEQ ID NO: 5. As appropriate, nucleic acid molecules of the present invention can be RNA, for example, mRNA, or DNA, such as cDNA and genomic DNA. DNA molecules can be double-stranded or single- stranded; single stranded RNA or DNA can be either the coding, or sense, strand or the non-coding, or antisense, strand. Preferably, the nucleic acid molecule comprises 'at least about 25 nucleotides, more preferably at least about 50 nucleotides, and even more preferably at least about 200 nucleotides. The nucleotide sequence can be only that which encodes at least a fragment of the amino acid sequence of the mWRN protein; alternatively, the nucleotide sequence can include at least a fragment of the mWRN amino acid coding sequence along with additional non-coding sequences such as introns and non-coding 3' and 5' sequences (including regulatory sequences, for example) . Additionally, the nucleotide sequence can be fused to a marker sequence, for example, a sequence which encodes a polypeptide to assist in isolation or purification of the protein or polypeptide. Such sequences include, but are not limited to, those which encode a glutathione-S- transferase (GST) fusion protein and those which encode a hemaglutin A (HA) peptide marker from influenza.

The term "isolated" is used herein to indicate that the material in question exists in a physical milieu distinct from that in which it occurs in nature. For example, the isolated protein of the invention may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs. In some instances, the isolated material will form part of a composition (for example, a crude extract containing other substances) , buffer system or reagent mix. In other circumstances, the material may be purified to essential homogeneity from other transcribed sequences (as in a cDNA or RNA library) , for example as determined by PAGE or column chromatography such as HPLC . Thus , an isolated gene or nucleotide sequence can include a gene or nucleotide sequence which is synthesized chemically or by recombinant means. Thus, recombinant DNA contained in a vector are included in the definition of "isolated" as used herein. Also, isolated nucleotide sequences include recombinant DNA molecules in heterologous host cells, as well as partially or substantially purified DNA molecules in solution. In vivo and in vi tro RNA transcripts of the DNA molecules of the present invention are also encompassed by "isolated" nucleotide sequences. Such isolated nucleotide sequences are useful in the manufacture of the encoded protein, as probes for isolating homologous sequences (e.g., from other mammalian species), for gene mapping (e.g., by in si tu hybridization with chromosomes) , or for detecting expression of the mWRN gene in tissue (e.g., human tissue), such as by Northern blot analysis. The present invention also pertains to nucleotide sequences which are not necessarily found in nature but which encode mWRN. Thus, DNA molecules which comprise a sequence which is different from the naturally-occurring nucleotide sequence but which, due to the degeneracy of the genetic code, encode mWRN protein of the present invention are the subject of this invention. The invention also encompasses variations of the nucleotide sequences of the invention, such as those encoding portions, analogues or derivatives of mWRN. Such variations can be naturally-occurring, such as in the case of allelic variation, or non-naturally-occurring, such as those induced by various utagens and mutagenic processes. Included variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides which can result in conservative or non-conservative amino acid changes, including additions and deletions. Preferably, the nucleotide or amino acid variations are silent or conserved, respectively; that is, they do not alter the characteristics or activity of mWRN.

The invention described herein also relates to fragments of the isolated nucleic acid molecules described above. For example, fragments which encode antigenic regions of mWRN are useful . The term "fragment" is intended to encompass a portion of a nucleotide sequence described herein which is from at least about 25 contiguous nucleotides to at least about 50 contiguous nucleotides or longer in length; such fragments are useful as probes, e.g., for diagnostic methods and also as primers. Particularly preferred primers and probes selectively hybridize to the nucleic acid molecule encoding mWRN described herein.

The invention also pertains to nucleotide sequences which hybridize under high stringency hybridization conditions (e.g., for selective hybridization) to a portion of a nucleotide sequence described herein or its complement and encode a protein or polypeptide which functions in aging. Appropriate stringency conditions are known to those skilled in the art or can be determined with reference to standard texts such as Current Protocols in Molecular Biology, John Wiley &

Sons, N.Y. (1989), 6.3.1-6.3.6. Such hybridizable nucleotide sequences are useful as probes and primers for diagnostic applications. The invention also relates to nucleotide sequences which share at least about 85% sequence identity with the nucleotide sequence encoding mWRN, preferably at least about 90% sequence identity, and more preferably at least about 95% sequence identity with said mWRN. Sequence identity can be determined using a suitable program, such as the Blastx program (Version 1.4) , using appropriate parameters, such as default parameters. In one embodiment, parameters for Blastx search are scoring matrix BLOSUM62, W=3. In another embodiment, the invention pertains to a nucleic acid sequence which is different from the naturally-occurring nucleic acid molecule but which, due to the degeneracy of the genetic code, encodes mWRN or a portion thereof.

Accordingly, the invention pertains to nucleotide sequences which have a substantial identity with the nucleotide sequences described herein. Particularly preferred in this instance are nucleotide sequences encoding polypeptides having at least one activity of mWRN. For example, preferred nucleotide sequences encoding a polypeptide having the same or similar biological activity as mWRN and nucleotide sequences encoding a polypeptide with the same or similar immunogenic or antigenic properties as mWRN are within the scope of the invention, as well as nucleotide sequences which hybridize to DΝA which encodes mWRN or a protein with mWRN activity. These nucleotide sequences are considered to be "active derivatives" of mWRN. As used herein, activities of mWRN include, but are not limited to, catalytic activity, binding function, antigenic function and oligomerization function.

This invention also pertains to an isolated protein or polypeptide which is mWRN. In a particular embodiment, the protein has the amino acid sequence of SEQ ID NO: 6. The mWRN protein or polypeptide of the invention can be partially or substantially purified (e.g., purified to homogeneity), and/or is substantially free of other proteins. According to the invention, the amino acid sequence of the polypeptide can be that of the naturally-occurring protein or can comprise alterations therein. Such alterations include conservative or non-conservative amino acid substitutions, additions and deletions of one or more amino acids. Such altered or mutant proteins should exhibit at least one activity of mWRN, i.e., the altered or mutant protein should be an active derivative of the naturally-occurring protein. For example, the mutation (s) can preferably preserve the three dimensional configuration of the binding and/or catalytic site of the native protein. The presence or absence of mWRN activity or activities can be determined by various functional assays as described herein. Moreover, amino acids which are essential for the function of mWRN can be identified by methods known in the art. Particularly useful methods include site- directed mutagenesis and alanine-scanning mutagenesis (for example, Cunningham and Wells, Science 244:1081-

1085 (1989) ) , crystallization and nuclear magnetic resonance. The altered polypeptides produced by these methods can be tested for particular biologic activities, including immunogenicity and antigenicity . Specifically, appropriate amino acid alterations can be made on the basis of several criteria, including hydrophobicity, basic or acidic character, charge, polarity, size, the presence or absence of a functional group (e.g., -SH or a glycosylation site), and aromatic character. Assignment of various amino acids to similar groups based on the properties above will be readily apparent to the skilled artisan; further appropriate amino acid changes can also be assessed with reference to Bowie et al . { Science 247 :1306-1310 (1990) ) .

The mWRN polypeptide can also be a fusion protein comprising all or a portion of the mWRN amino acid sequence fused to an additional component. Additional components, such as radioisotopes and antigenic tags, can be selected to assist in the isolation or purification of the polypeptide or to extend the half life of the polypeptide; for example, a hexahistidine tag would permit ready purification by nickel chromatography.

Also included in the invention are polypeptides which are substantially identical to mWRN . However, polypeptides exhibiting lower levels of identity are also useful, particular if they exhibit high, e.g., at least about 40%, identity in one or more particular domains of the protein. For example, polypeptides sharing high degrees of identity in domains necessary for particular activities are included herein. Polypeptides described herein can be isolated from naturally-occurring sources, chemically synthesized or recombinantly produced, and all such polypeptides are encompassed the term "isolated" protein or polypeptide. Polypeptides or proteins of the present invention can be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using art- recognized methods .

The invention also provides expression vectors containing a nucleic acid sequence encoding a polypeptide which is mWRN, operably linked to at least one regulatory sequence. Many such vectors are commercially available, and other suitable vectors can be readily prepared by the skilled artisan. "Operably linked" is intended to mean that the nucleotide sequence is linked to a regulatory sequence in a manner which allows expression of the nucleic acid sequence in an appropriate host cell. Regulatory sequences are art- recognized and are selected to produce a polypeptide which is mWRN. Accordingly, the term "regulatory sequence" includes promoters, enhancers, and other expression control elements which are described, for example, in Goeddel, Gene Expression Technology:

Methods in Enzymology 185, Academic Press, San Diego, CA

(1990) . For example, the native regulatory sequences or regulatory sequences native to the transformed host cell can be employed. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. For instance, the polypeptides of the present invention can be produced by ligating the gene, or a portion thereof, into a vector suitable for expression in either prokaryotic cells, eukaryotic cells or both (see, for example, Broach, et al . , Experimental Manipula tion of Gene Expression, ed. M. Inouye (Academic Press, 1983) p.

83; Molecular Cloning: A Laboratory Manual , 2nd Ed., ed.

Sambrook et al . (Cold Spring Harbor Laboratory Press,

1989) Chapters 16 and 17) . Typically, expression constructs will contain one or more selectable markers, including, but not limited to, the gene that encodes dihydrofolate reductase and the genes that confer resistance to neomycin, tetracycline, ampicillin, chloramphenicol, kanamycin and streptomycin resistance. Prokaryotic and eukaryotic host cells transfected by the described vectors are also provided by this invention. For instance, cells which can be transfected with the vectors of the present invention include, but are not limited to, bacterial cells such as E. coli

(e.g., E . coli K12 strains), Streptomyces , Pseudomonas, Serratia marcescens and Salmonella typhimurium, insect cells (baculovirus) , including Drosophila , fungal cells, such as yeast cells, plant cells and mammalian cells, such as Chinese hamster ovary cells (CHO) , and COS cells . A nucleotide sequence of mWRN described herein can be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes . Ligating the polynucleotide sequence into a gene construct, such as an expression vector, and transforming or transfecting the vector into hosts, either eukaryotic (yeast, avian, insect, plant or mammalian) or prokaryotic (bacterial cells) , are standard procedures used in producing other well known proteins. Similar procedures, or modifications thereof, can be employed to prepare recombinant proteins according to the present invention by microbial means or tissue-culture technology. Accordingly, the invention pertains to the production of mWRN proteins or polypeptides by recombinant technology. The proteins and polypeptides of the present invention can be isolated or purified (e.g., to homogeneity) from recombinant cell culture by a variety of processes. These include, but are not limited to, anion or cation exchange chromatography, ethanol precipitation, affinity chromatography and high performance liquid chromatography (HPLC) . The particular method used will depend upon the properties of the polypeptide and the selection of the host cell; appropriate methods will be readily apparent to those skilled in the art. The present invention also relates to antibodies which bind mWRN. For instance, polyclonal and monoclonal antibodies, including non-human and human antibodies, humanized antibodies, chimeric antibodies and antigen-binding fragments thereof { Current Protocols in Immunology, John Wiley & Sons, N.Y. (1994) ; EP

Application 173,494 (Morrison); International Patent Application WO86/01533 (Neuberger) ; and U.S. Patent No. 5,225,539 (Winters)) which bind to mWRN are within the scope of the invention. A mammal, such as a mouse, rat, hamster or rabbit, can be immunized with an immunogenic form of the protein (e.g., mWRN or a peptide comprising an antigenic fragment of mWRN which is capable of eliciting an antibody response) . Techniques for conferring immunogenicity on a protein or peptide include conjugation to carriers or other techniques well known in the art . The protein or polypeptide can be administered in the presence of an adjuvant. The progress of immunization can be monitored by detection of antibody titers in plasma or serum. Standard ELISA or other immunoassays can be used with the immunogen as antigen to assess the levels of antibody.

Following immunization, anti-peptide antisera can be obtained, and if desired, polyclonal antibodies can be isolated from the serum. Monoclonal antibodies can also be produced by standard techniques which are well known in the art (Kohler and Milstein, Na ture 256 : 495-

497 (1975); Kozbar et al . , Immunology Today 4 : 12 (1983); and Cole et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)). The term "antibody" as used herein is intended to include fragments thereof, such as Fab and F(ab)2. Antibodies described herein can be used to inhibit the activity of mWRN, particularly in vi tro and in cell extracts, using methods known in the art. Additionally, such antibodies, in conjunction with a label, such as a radioactive label, can be used to assay for the presence of the expressed protein in a cell from, e.g., a tissue sample, and can be used in an immunoabsorption process, such as an ELISA, to isolate the protein. Tissue samples which can be assayed include human tissues, e.g., differentiated and non-differentiated cells. Examples include bone marrow, thymus, kidney, liver, brain, pancreas, fibroblasts and epithelium.

A more complete understanding of the role of various genes and proteins in aging can be obtained by studying the effects of these genes and proteins directly in a mammal (i.e., an in vivo system) . Accordingly, mammals have been produced as described herein that have altered levels of expression of certain genes; these mammals are also subjects of the present invention. In particular, as described herein, a "knockout" mouse has been produced in which expression of an endogenous gene, mWRN, has been suppressed through genetic manipulation.

Preparation of a knockout mammal requires first introducing a nucleic acid construct used to suppress expression of a particular gene into an undifferentiated cell type (e.g., an embryonic stem cell) or a fertilized egg. This cell is then injected into a mammalian embryo, where it will be integrated into the developing embryo. The embryo is then typically implanted into a foster mother for the duration of gestation. Knockout mice in which various genes have been suppressed are known in the art (Pfeffer et al . , Cell 73:457-467

(1993); Fung-Leung et al . , Cell 65:443-449 (1991); U.S.

Patent No. 5,616,491 (Mak et al . ) ) . The methodology for producing the knockout animals described herein is known to the skilled artisan. The invention also pertains to non-human transgenic animals and their progeny, such as a mouse and its progeny, having a suppressed level of expression of the mWRN gene. The invention also relates to embryonic stem cell lines containing a mWRN knockout construct. As used herein, the term "knockout" refers to partial or complete suppression of the expression of at least a portion of a protein encoded by an endogenous DNA sequence in a cell. The term "knockout construct" refers to a nucleic acid sequence that is designed to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell. The term "progeny" refers to all future generations derived and descending from a particular mammal, i.e., a mammal containing a knockout construct inserted into its genomic DNA. Thus, progeny of any successive generation are included herein such that the progeny, the FI, F2 , F3 (and so on indefinitely) generations are included in this definition. As used herein, the term "suppress" is intended to encompass both complete and partial suppression of gene expression, including reduced expression as compared with the wild type or naturally- occurring gene .

The nucleic acid sequence used as the knockout construct is typically comprised of DNA from some portion of the gene (e.g., exon sequence, intron sequence and/or promoter sequence) and a marker sequence used to detect the presence of the knockout construct in the cell. The marker sequence is typically a sequence that encodes a protein that confers a detectable trait on the cell, such as an antibiotic resistance gene or an assayable enzyme not typically found in the cell. The knockout construct is inserted into a cell and integrates with the genomic DNA of the cell in s.uch a position as to prevent or interrupt transcription of the native DNA sequence. Preferably the nucleic acid sequence of the knockout construct is inserted into a region of the native DNA sequence and/or the promoter region of the gene so as to decrease or prevent expression of that gene in the cell as compared to the wild type or naturally-occurring sequence of the gene. In another embodiment, the invention relates to a method of screening a compound, such as a compound identified as having the ability to inhibit the replication and/or accumulation of DNA circles, for the ability to affect or alter life span, comprising administering the compound to a mouse, e.g., a mouse with a suppressed level of mWRN expression, and determining whether the mouse's life span is different from (longer or shorter than) that of a comparable mouse to which the compound has not been administered (a control mouse) . As used herein, "ability to affect life span" is intended to encompass both the ability to enhance and inhibit life span. Compounds can be screened to determine their ability to extend or shorten life span; of particular interest are compounds which are able to extend life span. The present invention also relates to novel agents or compounds identified by the assay described above. Agents identified by the assay described herein may enhance or inhibit aging, and the invention also pertains to the use of compounds identified as described herein, particularly to inhibit aging at the cellular or organismal level.

Screening for useful compounds requires administering the compound to be tested over a range of doses to the mouse, and assaying at various time points for the effect on life span. Such assays include, for example, assaying for increased or decreased levels of expression of particular genes involved in aging, and measuring the life span of the treated mouse. A mammal of the present invention can be used to screen a variety of compounds, either alone or in combination, to determine whether partial or total enhancement or inhibition of aging results. Enhancement of aging, or an increase in aging relative to a control, indicates that the agent shortens life span. Similarly, inhibition of aging, or a decrease in aging relative to a control, indicates that the agent extends life span. In addition, mammals of the present invention are useful for evaluating the development of the immune system, and for studying the effects of particular gene mutations. Examples described herein are offered for the purpose of illustrating the present invention and are not to be construed to limit the scope of this invention. The teachings of all references cited herein are hereby incorporated herein by reference.

EXAMPLES

Premature Aging of sgsl Mutants

Life span analysis of the wild type S . cerevisiae

W303-1A {MATa ade2 -l canl -100 his3 -ll , 15 l eu2 -3 , 112 trpl -1 ura3 -l , from R. Rothstein) and isogenic mutant derivatives, sgsl : : HIS3 , adal : :hisG, and hap5 : :hisG were determined by the removal of daughters from at least 40 virgin mothers by micromanipulation until senescence of the mother cell occurred (Muller et al . , Aging Dev.

12 : 41 (1980)) . As described herein, it was determined that the average life span of sgsl cells (9.5 divisions) is about 40% that of the wild type strain (24.5 divisions) (Figure 1A) . The maximum life span of sgsl cells was similarly reduced compared to wild type (18 versus 40 divisions) . This shortening is unlikely to be due to a general sickness, since the growth rate of sgsl strains is indistinguishable from the wild type strain. To determine whether the sgsl mutation indeed aged prematurely and did not simply die early, the age-specific phenotype of sterility was examined. Cells were scored at various stages of their life span for their ability to respond to the mating pheromone, α- factor. After 4 hours of α-factor challenge, cells were moved to fresh medium to complete their life span. Life span is not affected by deletion of HML (Smeal et al . , Cell 84 : 633 (1996)). Cells which failed to respond or divide after α-factor challenge were excluded from the data set. Disruption plasmids pCW9-l, and pDM212 (McNabb et al . , Genes Dev. 5:47 (1995)), pADAIKO

(Horiuchi et al . , Mol . Cell . Biol . , in press (1997)) were used to create hmlαΔ : :LEU2 , hap5 : :hisG and adal : : hi sG strains, respectively (W303-1A background).

As described herein, it was determined that in the sgsl mutant, young cells that had completed less than 50% of their life span were almost always fertile (Figure 2A) . However, over 60% of cells in the last one-fifth of their life span were sterile. As observed previously for wild type cells, this sterility is due to a loss of silencing, since deletion of HMLcx reduces the frequency of sterility in a MATa strain to almost zero (Figure

2B) .

Because it was important to show that the sterility of old sgsl cells was specific to this mutant, other mutant strains were examined to determine whether or not a short life span also led to premature sterility. After examination of a number of strains that did not affect life span, it was determined that mutations in the transcriptional activator HAP5 (McNabb et al . , Genes Dev. 5:47 (1995)) and in the coactivator ADA2 (Horiuchi et al . , Mol . Cell . Biol . , in press (1997)) significantly shortened life span in the isogenic W303 strain background (Figure IB) . However, in contrast to the sgsl mutant, neither the hap5 nor the a a2 strains became sterile at a high frequency as they grew older (Figures 2C and 2D) . Rather, the frequency of sterile cells from these strains was proportional to the fraction of the wild type life span that cells had completed. Thus, sterility is an aging-specific phenotype that occurs prematurely in short-lived sgsl mutants .

Concentration of Sgslp in the Nucleolus The remarkable similarity between the effects of the SGSl mutation in yeast and WRN mutations in humans prompted a molecular analysis of the yeast gene product with a view to gaining some insight into the function of the human protein. In order to raise antibody to Sgslp, the carboxyl terminus (residues 1071 to 1447) was fused to a 6 histidine tag and- expressed in E. coli . Purified recombinant protein was injected into chickens and anti-Sgslp IgY was obtained by affinity purification using recombinant protein. The C-terminal of Sgsl was amplified by PCR (from +3208 to +4344) using the oligonucleotides GGGGGGGATCCAATTGTAGAAATAGCGCCAACG (SEQ ID NO: 1) and GGGGGGAGCTCTCACTTTCTTCCTCTGTAGTGA (SEQ ID NO: 2) . The product was cut with BamHI and SacI then ligated to pET-28a(+) (Novagen Corp., Madison, Wisconsin) cut with the same enzymes to create pET28N-SGSl. BL21(DE3) cells (Studier, J. Mol . Biol .

189 : 113 (1991)) were transformed with pET28N-SGSl and grown in 2 liters incomplete medium to an OD600 of 1. Expression was induced with 1 mM IPTG for 4 hours; cells were resuspended for 1 hour in lysis buffer (20 mM

Tris-HCl [pH 7.9], 500 mM NaCl, 6 M guanidine-HCl , 5 mM imidazole) . Debris was spun down (5,000 x g, 20 minutes) and the supernatant was passed through a Ni-NTA agarose column (10 ml bed volume) , pre-equilibrated with wash buffer (20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 6 M urea, 20 mM imidazole) . The column was washed with 5 volumes wash buffer, and protein was eluted with elution buffer (20 mM Tris-HCl [pH 7.9], 500 mM NaCl, 6 M urea, 300 mM imidazole). The antibody recognized 0.1 ng of recombinant protein and Sgslp in yeast extracts.

Sgslp was visualized by indirect immunofluorescence of fixed yeast cells stained with the purified antibody and FITC-conjugated anti-chicken IgY as previously described (Kennedy et al . , Cell 89 : 381 (1997)). E. coli recombinant 6 histidine-tagged Sgslp (amino acids 1071 to 1447) was affinity purified using Ni-NTA agarose, 200 μ.g of which was injected into chickens; 100 μg of protein was used for subsequent boosts. Anti-Sgslp IgY molecules were purified from chicken serum by affinity purification using recombinant Sgslp. Sgslp staining (green) was predominantly in the nucleus, which is stained with DAPI (blue) ; a concentration of the staining on one side of each nucleus was also observed. Co-staining cells for yeast Noplp (red) , an abundant nucleolar protein (Henriquez et al . , J. Biol . Chem .

265 : 2209 (1990); Tollervey et al . , EMBO J. 10 : 513

(1997) ) , clearly demonstrated that this concentration of Sgslp corresponded to the nucleolus (yellow in a merged image) .

SGSl was amplified by PCR (from +4 to +4344) using the oligonucleotides-

GGGGGGGATCCAGTGACGAAGCCGTCACATAACTTA (SEQ ID NO : 3) and GGGGGGCGGCCGCTTATCACTTTCTTCCTCTGTAGTGACC (SEQ ID NO : 4) . The product, cut with BamHI and NotI , was ligated to the galactose-inducible promoter of yCPIF15 (Foreman and Davis, Gene 144 : 63 (1994)). Overexpression of GALp-SGSl was induced by growing for 4 hours in YPGal (10 g/1 yeast extract, 20 g/1 bactopeptone, 2 g/1 galactose) , and confirmed by Western blot using anti-HA mAb . Images were acquired using the CELLScan imaging system and processed as previously described (Kennedy et al . , Cell

89 : 381 (1997) ) .

Fragmentation of the Nucleolus in Old Cells

Since Sgslp localized predominately to the nucleolus, and movement of Sir proteins to the nucleolus results in an extension of life span, it seemed possible that nucleolar changes might be observed during the life span of sgsl cells. Thus, old sgsl cells were obtained by magnetic sorting as described in Smeal et al . { Cell

84 : 633 (1996)) . By counting bud scars it was determined that, on average, the cells had divided 9 (± 2 standard deviations) times, which is approximately the average life span of the strain. Once again, antibodies directed against Noplp were used to examine the overall structure of the nucleolus . SIR3 was disrupted with pDM42. Starved cells were obtained by growing a culture first in YPD medium to stationary phase, then in 2.4 g/1 yeast nitrogen base without amino acids for 12 hours.

As observed for young wild type cells (Henriquez et al . ,

J. Biol . Chem . 265 : 2209 (1990)), the nucleoli of young sgsl cells were well defined crescent-shaped structures occupying about 20% of the nucleus. Strikingly, in about 50% of the old sgsl cells, the nucleolus was fragmented into several bodies which occupied a large fraction of the nucleus (average bud scar count, ABSC, of magnetic sort: 9 ± 2 standard deviations) . In the fraction of old cell nuclei in which nucleolar fragmentation was not observed, a substantial enlargement of the structure was evident. Interestingly, in young wild type yeast cells expressing SGSl at high levels, a similar pattern of nucleolar fragmentation was observed. These mininucleolar bodies (Oakes et al . , Mol . Cell . Biol . 13:2441 (1993)) structurally resemble the precursors of the interphase nucleolus of higher eukaryotes (Stevens, J". Cell Biol . 23:2455 (1965) ) .

To address the question of whether the enlargement and fragmentation of the nucleolus is due to scaling of a normal aging phenotype, or is merely a consequence of the sgsl mutation per se, very old wild type cells which had divided an average of 26 times, approximately the average life span of the strain, were obtained. Staining for Noplp revealed that a substantial fraction (about 45%) of these had enlarged or fragmented nucleoli, similar to the changes seen in the old sgsl cells. Thus, fragmentation is a novel feature of aging that occurs in wild type as well as sgrs2 cells.

Consistent with a link between normal aging and fragmentation of the nucleolus, ada2 mutants, which die early rather than age prematurely, did not display fragmentation of the nucleolus in young or old cells.

To determine whether enlargement and fragmentation of the nucleolus might be a response to a reduction in protein synthesis, young wild type cells were starved and nucleolar staining was carried out . It was observed that the nucleoli did not enlarge or fragment, rather, they were reduced to approximately 25% the size of wild type nucleoli with a more rounded appearance.

Redistribution of Sir3p to Nucleolar Bodies in Old sgsl

Mutants A key molecular signature of aging in yeast is redistribution of the Sir proteins to the nucleolus in old cells. This redistribution, if observed for sgsl cells, would provide the most compelling evidence that mutation of SGSl resulted in premature aging. It was of particular interest to determine whether the complex would redistribute to the satellite nucleolar bodies in old cells with fragmented nucleoli. Indirect immunofluorescence was performed in young and old sgsl mutant cells using rabbit anti-Sir3p. Noplp was visualized with Cy3 -conjugated anti-mouse IgG (red); DNA was stained with DAPI (blue) ; Sir3p was visualized with FITC-conjugated goat anti-rabbit IgG (green) . Overlap of Sir3p and Noplp staining is observed as yellow. In young cells, Sir3p staining showed characteristic telomere spots (Gotta et al . , EMBO J. in press (1997);

Palladino et al . , Cell 75:543 (1993)) which were separate from the nucleolus. However, in old sgsl cells Sir3p staining was predominantly nucleolar. In old cells with fragmented nucleoli, Sir3p staining coincided with most or all nucleolar bodies.

Nucleolar Enlargement and Fragmentation Do Not Require the Sir Protein Complex Nucleolar enlargement and fragmentation could either represent a cause of aging, or, alternatively, be a response to aging which actually promotes longevity. If fragmentation of the nucleolus is a response in old cells that promotes longevity, it might be caused by redistribution of the Sir complex to the nucleolus. A test of this hypothesis is that fragmentation would not occur in a sir null mutant. Thus, old sgsl sir3 cells were sorted and Noplp staining was performed as described above. Clearly, nucleolar fragmentation occurred at the same high level in the double mutant, showing that the Sir complex is not required for fragmentation . It was still possible that nucleolar enlargement and fragmentation was part of a longevity mechanism, but did not require Sir-protein redistribution for its formation. To test further whether nucleolar fragmentation could be part of a longevity response mechanism, SGSl wild type strains, which were either

SIR3 (wild type) or sir3 , were grown for 12 divisions and sorted for old cells. Young wild type W303-1A and an isogenic sir3 mutant were labeled with biotin, grown for 17 hours and sorted back, as previously described (Smeal et al . , Cell 84 : 633 (1996)). At this age, sir3 cells are approaching senescence because of their shorter life span, but the majority of wild type cells are not. Noplp staining showed that a substantial fraction of the nucleoli in the sir3 mutant were either enlarged or fragmented (38% and 19%, respectively), a proportion much higher than in the age-matched wild type (12% and 6%, respectively) . This finding suggests that the redistribution of the Sir complex to the nucleolus (which can occur in the wild type but not sir3 mutant) represses nucleolar fragmentation. These results are thus consistent with the model that a process leading to nucleolar fragmentation is one of the causes of yeast aging .

Preparation of a mWRN Knockout Mouse

In order to generate constructs necessary to inactivate the mWRN gene in murine ES cells, a mouse genomic lambda phage library derived from the 129 strain was screened with a hybridization probe corresponding to the full-length mWRn cDNA. Seven clones were obtained and plaque-purified. Two clones were chosen for more detailed analysis because hybridization using different probes in the mWRN cDNA indicated that they were the farthest 5 ' regions obtained in this screen and that they contained fragments of the helicase domain.

These genomic fragments were subsequently transferred from lambda phage to the bacterial vector pBR322 for ease of analysis via cloning into the Sail site in this vector, and they were then extensively mapped with restriction enzymes. These clones proved to overlap extensively. DNA sequencing revealed the presence of an exon encompassing the 3 ' region of the helicase domain in a 4.4 kB Hindlll -BamHI fragment. A suitable vector was constructed in the plasmid pSL1190, with a βgeo (β-galactosidase/neomycinr fusion gene) cassette replacing the Hindlll-BamHI fragment. Splicing to the next exon is predicted to introduce a frameshift mutation.

This construct was introduced into JI ES cells by electroporation and neomycin-resistant colonies subcloned. Eighty-eight clones have been examined for appropriate targeting using a hybridization probe lying outside the construct. This probe consists of a

Scal/Nhel fragment at the 3 ' end of one of the genomic fragments and distinguishes between the wild-type and mutant alleles in an Nhel digest. Among the eighty- eight clones screened by Southern blot, eleven clones had undergone the appropriate integration event. Three of these clones have been expanded and injected into C57BL/6 and BALB/c blastocysts, and these blastocysts surgically implanted into pseudopregnant Swiss Webster outbred mothers. Chimeric mice were obtained from all three cell lines and were distinguished by their agouti coats. These chimeras were bred with balb/c and C57BL/6 mice and heterozygotes were obtained from two of three original clones. These heterozygotes or their offspring were intercrossed to obtain homozygotes (Figures 3A and 3B) . EQUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims:

CLAIMS We claim:

1. A method of identifying an agent which inhibits the replication and/or accumulation of ribosomal DNA circles in a cell, comprising the steps of: a) transforming yeast cells deficient in a gene encoding a protein necessary for growth with a plasmid comprising an autonomously replicating sequence and a marker gene encoding the protein necessary for growth, to produce transformed cells; b) identifying transformed cells in which the plasmid has stably integrated into the genome and transformed cells in which the plasmid has not integrated into the genome; c) incubating the transformed cells with a test agent under conditions suitable for growth, to produce test cells; d) assessing growth of the test cells; and e) comparing the growth of test cells in which the plasmid has stably integrated into the genome with the growth of test cells in which the plasmid has not integrated into the genome , wherein reduced growth of the test cells in which the plasmid has not integrated into the genome indicates that the test agent inhibits the replication and/or accumulation of ribosomal DNA circles in a cell.

2. A method according to Claim 1, wherein the marker gene is selected from the group consisting of: ADE2, lacZ, GFP, URA3 , LEU2 , TRP1, HIS3 and LYS2.

3. A method according to Claim 1, wherein the autonomously replicating sequence is a ribosomal DNA autonomously replicating sequence .

4. A method of identifying an agent which inhibits the replication and/or accumulation of DNA circles in a cell, comprising the steps of: a) transforming yeast cells deficient in a gene encoding a protein necessary for growth with a plasmid comprising an autonomously replicating sequence and a marker gene encoding the protein necessary for growth, to produce transformed cells; b) identifying transformed cells in which the plasmid has stably integrated into the genome and transformed cells in which the plasmid has not integrated into the genome; c) incubating the transformed cells with a test agent under conditions suitable for growth, to produce test cells; d) assessing growth of the test cells; and e) comparing the growth of test cells in which the plasmid has stably integrated into the genome with the growth of test cells in which the plasmid has not integrated into the genome, wherein reduced growth of the test cells in which the plasmid has not integrated into the genome indicates that the test agent inhibits the replication and/or accumulation of DNA circles in a cell.

5. A method according to Claim 4, wherein the marker gene is selected from the group consisting of: ADE2, lacZ, GFP, URA3 , LEU2 , TRP1, HIS3 and LYS2.

6. A method of identifying an agent which inhibits the replication and/or accumulation of DNA circles in a mammal, comprising the steps of: a) constructing a transgenic mammal having a plasmid comprising an autonomously replicating sequence and a marker gene; b) administering to the transgenic mammal an agent to be tested; and c) assessing the effect of the agent to be tested on the replication and/or accumulation of the plasmid in stem cells of the transgenic mammal .

7. A method of identifying an agent which inhibits the replication and/or accumulation of DNA circles in a cell, comprising the steps of: a) transforming differentiated mammalian cells with a plasmid comprising an autonomously replicating sequence and a marker gene to produce transformed cells; b) identifying transformed cells in which the plasmid has stably integrated into the genome and transformed cells in which the plasmid has not integrated into the genome; c) incubating the transformed cells with a test agent under conditions suitable for growth, to produce test cells; d) assessing average number of population doublings of the test cells; and e) comparing the average number of population doublings of test cells in which the plasmid has stably integrated into the genome with the average number of population doublings of test cells in which the plasmid has not integrated into the genome, wherein increased number of population doublings of the test cells in which the plasmid has not integrated into the genome indicates that the test agent inhibits the replication and/or accumulation of DNA circles in a cell.

8. A method of assessing the ability of a compound to slow aging, comprising the steps of: a) administering a compound which inhibits the replication and/or accumulation of rDNA. circles to a mammal, thereby producing a treated mammal; and b) assessing the aging of the treated mammal relative to a comparable untreated mammal; whereby if the aging of the treated mammal is slower than the aging of the untreated mammal, then the compound slows aging.

9. A method according to Claim 8, wherein the compound which inhibits the replication and/or accumulation of rDNA circles is identified by a method selected from the group consisting of the method of Claim 1, the method of Claim 4, the method of Claim 6 and the method of Claim 7.

10. A method of extending the life span of a mammal, comprising treating the mammal with an agent which inhibits the replication and/or accumulation of rDNA circles.

11. A method according to Claim 10, wherein the agent is identified by- a method selected from the group consisting of the method of Claim 1, the method of Claim 4, the method of Claim 6, and the method of Claim 7.

12. An isolated mWRN protein, or an active derivative or fragment thereof .

13. Isolated mWRN according to Claim 12, wherein said mWRN has the amino acid sequence of SEQ ID NO: 6.

14. Isolated mWRN according to 12, wherein said mWRN is a derivative which has substantial sequence identity with endogenous mWRN.

15. Isolated mWRN according to Claim 12, wherein said mWRN has the same amino acid sequence as the endogenous mWRN.

16. An isolated nucleic acid molecule which encodes mWRN or an active derivative or fragment thereof.

17. An isolated nucleic acid molecule according to Claim 16, wherein the nucleic acid molecule has the nucleotide sequence of SEQ ID NO: 5.

18. An isolated nucleic acid molecule according to Claim 16, wherein mWRN is a derivative which has substantial sequence identity with the endogenous mWRN.

19. An isolated nucleic acid molecule according to

Claim 16, wherein said mWRN has the same amino acid sequence as the endogenous mWRN.

20. An isolated nucleic acid molecule according to

Claim 16, wherein said nucleic acid molecule has the same nucleotide sequence as the endogenous gene encoding mWRN.

21. A DNA construct comprising an isolated nucleic acid molecule according to Claim 18 operatively linked to a regulatory sequence.

22. A recombinant host cell comprising an isolated nucleic acid molecule according to Claim 16 operatively linked to a regulatory sequence.

23. A method for preparing mWRN , or an active derivative or fragment thereof, comprising culturing the recombinant host cell of Claim 22.

24. An antibody, or an antigen-binding fragment thereof, which selectively binds to isolated mWRN protein.

25. The antibody according to Claim 24, wherein said antibody is a monoclonal antibody.

26. A DNA construct comprising a nucleotide sequence encoding an exon of an mWRN gene, said exon having a drug resistance marker inserted therein.

27. A mouse embryonic stem cell line comprising the DNA construct of Claim 26.

28. A knockout mouse in which expression of the gene encoding mWRN is suppressed.

29. An assay for identifying a compound which extends life span, comprising the steps of: a) administering a compound to be tested to a mammal with a suppressed level of mWRN; and b) identifying slowing of at least one of the normal phenotypes of aging in the mammal .

30. An assay according to Claim 29, wherein the compound to be tested has been identified as inhibiting the replication and/or accumulation of rDNA circles in a cell.

31. An assay according to Claim 29, wherein the mammal is a mouse .

32. A novel agent identified by the assay of Claim 29.

Download Citation


Sign in to the Lens

Feedback