{"search_session":{},"preferences":{"l":"es","queryLanguage":"es"},"patentId":"113-302-950-628-637","frontPageModel":{"patentViewModel":{"ref":{"entityRefType":"PATENT","entityRefId":"113-302-950-628-637"},"entityMetadata":{"linkedIds":{"empty":true},"tags":[],"collections":[{"id":11855,"type":"PATENT","title":"University of Montpellier Patent Portfolio","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":11808,"tags":[],"user":{"id":91044780,"username":"Cambialens","firstName":"","lastName":"","created":"2015-05-04T00:55:26.000Z","displayName":"Cambialens","preferences":"{\"usage\":\"public\",\"beta\":false}","accountType":"PERSONAL","isOauthOnly":false},"notes":[{"id":8467,"type":"COLLECTION","user":{"id":91044780,"username":"Cambialens","firstName":"","lastName":"","created":"2015-05-04T00:55:26.000Z","displayName":"Cambialens","preferences":"{\"usage\":\"public\",\"beta\":false}","accountType":"PERSONAL","isOauthOnly":false},"text":"
Search Applicants and Owners separately:univ* AND Montpellier. Select more for logical variants. Add to collection. Select all patents in the collection and expand by simple families. Add to collection. Total patents: 1289
Search Applicants and Owners separately:univ* AND Montpellier. Select more for logical variants. Add to collection. Select all patents in the collection and expand by simple families. Add to collection. Total patents: 1289
Providing Deinococcus or related bacteria producing said metabolite, recombinant protein, enzyme, drug, vaccine or adjuvant;\n
Testing the size of the genome of said bacteria;\n
Selecting a bacterium having a genome size above 3.9 megabases;\n
Culturing said bacterium; and\n
Collecting the metabolite, recombinant protein, enzyme, drug, vaccine or adjuvant from the culture medium."],"number":1,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, comprising selecting a bacterium having a genome size above 4.0 megabases."],"number":2,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein the genome of said bacterium comprises a genomic diversity greater than 15%, preferably greater than 25%, and more preferably greater than 50%."],"number":3,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said bacterium is obtainable by a method comprising the following steps:\n
a) providing a sample comprising bacteria;\n
b) exposing the sample to an irradiation treatment;\n
c) selecting living bacteria from said exposed sample; and\n
d) selecting, from said living bacteria, a bacterium which has a genome size above 3.9 megabases and/or a genomic diversity above 15%."],"number":4,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said bacterium further comprises a recombinant nucleic acid molecule."],"number":5,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said bacterium is modified by accelerated evolution or by DNA shuffling technologies or by insertion of eukaryote, prokaryote or synthetic non-Deinococcus DNA or by insertion of another Deinococcus strain DNA."],"number":6,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said bacterium is mesophile, viable at a pH between 4 and 9, and/or viable in the presence of 2% ethanol and/or wherein said bacterium can be grown in aerobiosis or in anaerobiosis."],"number":7,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said bacterium can utilize inulin and/or fiber cellulose as carbon source."],"number":8,"annotation":false,"title":false,"claim":true},{"lines":["A method for modifying a biomass comprising inulin and/or fiber cellulose, the method comprising exposing said biomass to a bacterium having a genome size above 3.9 megabases, and (i) containing a 16S rDNA which, upon amplification using primers GTTACCCGGAATCACTGGGCGTA and GGTATCTACGCATTCCACCGCTA, generates a fragment of about 158 base pairs and/or (ii) resisting a UV treatment of 4 mJ/cm2 or to an extract thereof."],"number":9,"annotation":false,"title":false,"claim":true},{"lines":["A method for producing a metabolite, recombinant protein, enzyme, drug, vaccine or adjuvant from a biomass comprising inulin and/or fiber cellulose, the method comprising contacting a Deinococcus bacterium having a genome size above 3.9 megabases with a biomass comprising inulin and/or fiber cellulose and recovering the metabolite, recombinant protein, enzyme, drug, vaccine or adjuvant."],"number":10,"annotation":false,"title":false,"claim":true},{"lines":["A method for isolating a bacterium, the method comprising:\n
a) providing a sample that potentially contains bacteria;\n
b) exposing the sample to an irradiation treatment;\n
c) selecting living bacteria from said exposed sample; and\n
d) selecting, from said living bacteria, a bacterium which has a genome size above 3.9 megabases, and optionally which contains a 16S rDNA which, upon amplification using primers GTTACCCGGAATCACTGGGCGTA and GGTATCTACGCATTCCACCGCTA, generates a fragment of about 158 base pairs."],"number":11,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 11, wherein step b) comprises exposing the sample to a UV treatment of 4 mJ/cm2."],"number":12,"annotation":false,"title":false,"claim":true},{"lines":["A method for isolating a bacterium, the method comprising the following steps:\n
a) providing a sample containing Deinococcus bacteria;\n
b) testing the size of the genome and/or the genomic diversity of bacteria in said sample; and\n
c) selecting, from said sample, one or several Deinococcus bacteria having a genome size above 3.9 megabases and/or having a genomic diversity above 15%."],"number":13,"annotation":false,"title":false,"claim":true}]}},"filters":{"npl":[],"notNpl":[],"applicant":[],"notApplicant":[],"inventor":[],"notInventor":[],"owner":[],"notOwner":[],"tags":[],"dates":[],"types":[],"notTypes":[],"j":[],"notJ":[],"fj":[],"notFj":[],"classIpcr":[],"notClassIpcr":[],"classNat":[],"notClassNat":[],"classCpc":[],"notClassCpc":[],"so":[],"notSo":[],"sat":[]},"sequenceFilters":{"s":"SEQIDNO","d":"ASCENDING","p":0,"n":10,"sp":[],"si":[],"len":[],"t":[],"loc":[]}}