System For Packaging High-capacity Adenoviruses

SISTEMA PARA EMPAQUETAMIENTO DE ADENO VIRUS DE ALTA

CAPACIDAD

CAMPO TÉCNICO DE LA INVENCIÓN La invención se encuadra dentro del campo de la biotecnología y, más concretamente, en el campo de vectores para la expresión de genes heterólogos en células diana. En particular, la invención se refiere a un sistema para la producción y empaquetamiento de vectores adenovirales de alta capacidad útiles para transferencia génica.

ANTECEDENTES

Los adenovirus de alta capacidad (HC), conocidos también como adenovirus gutless o adenovirus /ze//?er-dependientes, tienen un gran atractivo como vectores para terapia génica porque in vivo presentan una inmunogenicidad asociada muy reducida y poseen una alta eficiencia de transducción y amplio tropismo, tanto en roedores como en primates. Estos vectores se caracterizan por contener solamente las secuencias de ADN necesarias para su replicación y empaquetamiento y carecer del resto de genes adenovirales, lo que hace que puedan acomodar secuencias de hasta 36 kb. Para la replicación del ADN viral y su empaquetamiento en partículas virales, las únicas secuencias adenovirales requeridas en cis por estos vectores son las secuencias ITR (inverted terminal repeats), localizadas en ambos extremos del ADN lineal, y la señal de empaquetamiento (ψ) (Gráble y Hearing, 1992, J. Virol, 66: 723-731; Hearing y Shenk, 1983, CeIl, 33: 695-703).

Dado que los adenovirus de alta capacidad carecen de todas las regiones virales codificantes, su propagación sólo es posible si las células se co-infectan con un segundo virus denominado virus helper o auxiliar, es decir, un virus capaz de codificar todas las proteínas necesarias para la replicación de un virus defectivo y su encapsidación en partículas virales con capacidad infectiva. En el caso de la producción de vectores adenovirales de alta capacidad, el virus helper se caracteriza por tener delecionada la región El adenoviral y proporcionar, in trans, todo el repertorio de proteínas virales necesarias para la replicación y ensamblaje de la progenie del virus gutless. Para la propagación de este último también es necesaria la utilización de líneas celulares capaces de complementar la deleción de dicha región El en el virus helper, como son la línea 293 (Graham, et al, 1977, J. Gen. Virol., 36: 59-74) o la línea PerC6 (Fallaux et al, 1998, Hum. Gene Ther., 9: 1909-1917).

Sin embargo con este sistema de propagación se generan también partículas virales indeseables que encapsidan genomas de virus helper y contaminan las preparaciones finales de los adenovirus de alta capacidad. Hasta la fecha se han desarrollado y descrito diferentes sistemas para tratar de eliminar dichas contaminaciones bloqueando el proceso de empaquetamiento del virus helper. En general, estos sistemas están basados en la incorporación de mutaciones en la señal de empaquetamiento del virus helper, en el aumento del tamaño de su genoma y, más particularmente, en una eliminación específica de la señal de empaquetamiento durante el proceso de producción viral.

Parks et al. (1996, Proc. Nati. Acad. ScL USA, 93: 13565-13570) han descrito la eliminación de la señal de empaquetamiento ψ del virus helper mediante un sistema de recombinación Cre-loxP. En este sistema la señal ψ está flanqueada por sitios loxP y la propagación del virus se lleva a cabo en células 293 que expresan la recombinasa Cre

(células 293Cre). Cuando el virus helper entra en la célula, la recombinasa escinde la señal ψ impidiendo que pueda ser empaquetado pero manteniendo su capacidad de replicación y, por tanto, la expresión de las secuencias codificantes necesarias para el empaquetamiento del adenovirus de alta capacidad.

Groth et al. (Proc. Nati. Acad. Sci. USA, 2000, 97: 5995-6000) han propuesto la utilización de una recombinasa unidireccional, en particular la recombinasa Φ C31, utilizando las secuencias attBIattP de reconocimiento específico para flanquear la señal ψ. Cuando la recombinasa PhiC31 escinde la secuencia flanqueada por los sitios attBIattP, modifica las secuencias de reconocimiento y las convierte en secuencias attRlattL evitando que vuelva a producirse el reconocimiento y, por tanto, la reintroducción de la señal ψ.

Ng et al. (2001, Mol. Ther., 3: 809-815) proponen un sistema de recombinación alternativo FLP/frt, en el que la propagación del adenovirus de alta capacidad se lleva a cabo en células 293 capaces de expresar la recombinasa FLP de levaduras (línea 293FLP y 293CreFLP) y en el que la señal ψ del virus helper está flanqueada por sitios frt reconocidos específicamente por dicha recombinasa FLP. La eficiencia de amplificación del virus gutless (108 bfu/ml en el pase 3), así como los niveles de contaminación de virus helper (0.5% previa purificación en gradiente CsCl), son muy similares a los obtenidos con el sistema Cre-loxP anterior.

Para tratar de mejorar estos sistemas, Palmer y Ng (2003, Mol. Ther., 8: 846-852) han desarrollado un sistema derivado del sistema Cre-loxP, donde se ha incluido la inversión de la señal de empaquetamiento del virus helper.

Por otra parte, Sargent et al. (2004, Gene Ther. , 11 : 504-511) han propuesto un sistema de restricción por tamaño, en el que se utiliza un virus helper de más de 35 kb y delecionado en el gen de la proteína IX, así como una línea celular 293 capaz de complementar dicha deleción.

Sin embargo, a pesar de las mejoras, hasta el momento ninguno de estos sistemas ha conseguido evitar las recombinaciones entre las secuencias de los dos virus incluidos en el proceso de producción y, por consiguiente, la contaminación de la muestra con adenovirus replicativos. En una reciente revisión Alba et al. (2005, Gene Ther., 12 Supp l 1 : S 1 8-27) recogen que los niveles de contaminación pueden oscilar, dependiendo del sistema utilizado, entre un 0.02% y un 1% respecto al número de partículas virales de adenovirus de alta capacidad producidas. Estos niveles de contaminación se consideran demasiado altos para su posible utilización en procedimiento clínicos de terapia génica.

Adicionalmente, otra limitación importante para el uso clínico de los adenovirus de alta capacidad está relacionada con la dificultad para producirlos a gran escala. Actualmente este tipo de producción es compleja, presenta una eficiencia baja y requiere de numerosos ciclos sucesivos de co-infección con el virus helper. Por todo ello es necesario perfeccionar los procedimientos, desarrollando también sistemas alternativos, para producir vectores adenovirales de alta capacidad en las cantidades y con la calidad (libres de partículas virales contaminantes) requeridas para su uso clínico.

La solución ideal a este problema sería el desarrollo de una línea celular específica para la producción a gran escala de vectores adenovirales de alta capacidad. Sin embargo, los sistemas de producción independientes de la participación de un virus helper, plantean el problema de la citotoxicidad derivada de altos niveles de expresión de los genes adenovirales lo cual, hasta el momento, ha limitado enormemente el desarrollo de este tipo de sistemas de producción. A esto hay que sumarle el hecho de que resulta extremadamente complicado reproducir la secuencia correcta de los eventos necesarios para coordinar la replicación del ADN con la expresión de las proteínas estructurales que permitan la producción masiva de partículas virales durante la fase tardía de la infección (Farley, et al, 2004, J. Virol, 78: 1782-1791).

WO0072887 describe un sistema de producción de adenovirus de alta capacidad independiente de adenovirus helper basado en un sistema binario formado por (i) una línea celular empaquetadora que comprende de forma estable un episoma circular en un número reducido de copias y basado en elementos replicativos del virus de Epstein-Barr (EBV) junto con un genoma adenoviral delecionado en las regiones El, E3, E4 y en los genes pTP y DBP, y (ii) un vector que comprende los elementos necesarios para la replicación y empaquetamiento del genoma adenoviral y que están ausentes en el episoma (región E4, gen pTP y DBP) así como el gen heterólogo. En este sistema el episoma no se empaqueta en viriones puesto que (i) carece de la señal de empaquetamiento y (ii) su tamaño supera la capacidad de empaquetamiento de los adenovirus.

Por otra parte, WO0042208 describe un sistema de producción de adenovirus independiente de virus helper que comprende (i) un vector adenoviral delecionado en las regiones El, E3 y el gen codifica la proteína de la fibra (L5), la cual está implicada en el proceso de ensamblaje de los viriones, y (ii) una línea celular específica capaz de complementar la replicación y el empaquetamiento de dicho vector. Todos los genes necesarios para los procesos de replicación y empaquetamiento de las partículas virales están incluidos dentro de la secuencia del vector adenoviral.

Por último, recientemente el sistema descrito por Catalucci et al. (2005, J. Virol, 79: 6400-6409) plantea la utilización de un plásmido episomal compuesto por el origen de replicación del virus Epstein-Barr, lo que permite su mantenimiento en el núcleo de una línea celular 293 modificada para la expresión estable del antígeno nuclear EBNAl (293EBNA). Este episoma incluye las secuencias ITR del Adeno virus serotipo 5, los genes de la región temprana (E2) y la ORF6 incluida en la región E4 del genoma adenoviral. La transcripción de estos genes adenovirales se encuentran bajo el control de un promotor inducible mientras que el resto de los genes necesarios para la formación de la cápside están incluidos dentro de la secuencia del adenovirus de alta capacidad.

En general, todos estos sistemas de producción de vectores adenovirales independientes de helper se encuentran limitados por el tamaño de la secuencia de ADN a insertar en el vector, ya que en todos ellos el vector adenoviral incluye uno o más genes adenovirales necesarios para los procesos de replicación o empaquetamiento de dicho vector. A esto hay que sumarle el hecho de que la presencia de estos genes adenovirales conlleva el riesgo de posibles efectos inmunogénicos a la hora de su aplicación en clínica.

Por todo ello, se establece la existencia de una necesidad en la técnica de obtener sistemas de producción de adenovirus de alta capacidad que no requieran el uso de vectores adenovirales auxiliares y que superen los inconvenientes de los sistemas independientes de estos vectores auxiliares conocidos hasta la fecha.

COMPENDIO DE LA INVENCIÓN

En un primer aspecto, la invención se relaciona con un polinucleótido (primer polinucleótido de la invención) o un vector de expresión que comprende: (a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional;

(b) un segundo cásete de expresión que comprende a secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional co dificado por el polinucleótido definido en (a).

En un segundo aspecto, la invención se relaciona con un polinucleótido (segundo polinucleótido de la invención) o vector de expresión que comprende:

(a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional;

(b) un segundo cásete de expresión que comprende a secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a) y

(c) un tercer cásete de expresión que comprende una secuencia nucleotídica que codifica la proteína adenoviral seleccionada ElA o las proteínas adenovirales ElA y ElB, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a).

En otro aspecto, la invención se relaciona con un polinucleótido (tercer polinucleótido de la invención) o vector de expresión que comprende una secuencia nucleotídica que comprende el genoma de un adenovirus recombinante que carece de, al menos, la secuencia ψ de empaquetamiento y la secuencia que codifica la proteína E lA o El A/E IB, en donde dicha secuencia que comprende el genoma de un adenovirus recombinante se encuentra flanqueada por secuencias de reconocimiento específico para una endonucleasa de restricción.

En otro aspecto, la invención se relaciona con una célula hospedadora que comprende uno o varios polinucleótidos o vectores de expresión de la invención. En otro aspecto, la invención se relaciona con un método para la producción de células adecuadas para la producción y empaquetamiento de partículas infectivas de un adeno virus de alta capacidad que comprende (i) transfectar una célula con un primer polinucleótido o con un vector que comprende dicho polinucleótido, o con un segundo polinucleótido o con un vector que comprende dicho polinucleótido y (ii) transfectar dicha célula con un tercer polinucleótido o con un vector que comprende dicho polinucleótido en donde las etapas (i) y (ii) pueden llevarse a cabo en cualquier orden o de forma simultánea y en donde si las células se transfectan en la etapa (i) con un polinucleótido según cualquiera de las reivindicaciones 1 a 4, entonces se utilizan células que comprenden la secuencia que codifica la proteína adeno viral ElA y, opcionalmente, la proteína adeno viral ElB.

En otro aspecto, la invención se relaciona con una célula obtenible por un método de acuerdo a la invención.

En otro aspecto, la invención se relaciona con un sistema para la producción de adenovirus de alta capacidad que comprende

(a) una célula de acuerdo a la invención y

(b) un adenovirus de alta capacidad.

En otro aspecto, la invención se relaciona con un método para la producción de vectores adeno virales de alta capacidad, que comprende las etapas de:

(a) transfectar o infectar una célula hospedadora con un polinucleótido que comprende el genoma del adenovirus de alta capacidad que se desea producir o con un vector de expresión que comprende dicho polinucleótido, (b) cultivar las células transfectadas/infectadas en condiciones que permitan la replicación y empaquetamiento del adenovirus de alta capacidad, (c) recuperar las partículas virales del adenovirus de alta capacidad y, opcionalmente,

(d) repetir las etapas (a) a (c) en donde las partículas virales de alta capacidad obtenidas en la etapa (c) se utilizan para infección en la etapa (a) del siguiente ciclo, en donde la célula hospedadora usada en la etapa (a) se selecciona del grupo de

(i) una célula que comprende el primer polinucleótido de la invención y la secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un tercer polinucleótido y/o un vector de expresión que comprende dicho polinucleótido,

(ii) una célula que comprende el segundo polinucleótido de la invención, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con el tercer polinucleótido de la invención y/o un vector de expresión que comprende dicho polinucleótido,

(iii) una célula que comprende un el tercer polinucleótido de la invención, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un primer polinucleótido y en donde la célula comprende una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB,

(iv) una célula que comprende el tercer polinucleótido de la invención, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con el segundo polinucleótido de la invención y/o un vector de expresión que comprende dicho polinucleótido,

(v) una célula que comprende el primer polinucleótido de la invención, el tercer polinucleótido de la invención y una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB, y (vi) una célula que comprende el segundo polinucleótido de la invención y el tercer polinucleótido de la invención. BREVE DESCRIPCIÓN DE LAS FIGURAS

Figura 1. A. Representación esquemática del plásmido pGal4-2RU-El-SceI que comprende un polinucleótido A2 según la invención. A1: secuencia nucleotídica que codifica un regulador transcripcional, en este caso GAL4-hPR-p65. An: secuencia nucleotídica que codifica las proteínas adeno virales E 1A/E1B. Am: secuencia nucleotídica que codifica una endonucleasa de restricción, en este caso I-Scel de Sacharomyces cerevisiae. rPπ y rPm: promotores regulables por el regulador transcripcional, GAL4-hPR-p65, que dirigen la transcripción y expresión de las proteínas El A/E IB y de la endonucleasa I-Scel respectivamente. En esta realización cada región promotora comprende una secuencia de la caja TATA del gen EIb (PEUO adeno viral, asociada a secuencias UAS (upstream activating sequences) de GAL4, y donde ambos promotores comparten las mismas secuencias de unión UAS. En este caso la región promotora que dirige la transcripción y expresión del regulador transcripcional GAL4-hPR-p65 comprende un promotor mínimo de la timidina quinasa (Ptk) también asociado a secuencias UAS {upstream activating sequences) de GAL4. Cada una de las 3 unidades transcripcionales (GAL4-hPR-p65, E1A/E1B y I-Scel) se completa con una señal de poliadenilación (pA). pUCori: origen de replicación del plásmido pGeneV5- HisA utilizado como base para la construcción del plásmido pGal4-2RU-El-SceI. Amp: gen de resistencia a ampicilina para la selección de clones resistentes en bacterias. Zeo: gen de resistencia al antibiótico Zeocina para la selección de clones resistentes en células eucariotas. SV40: promotor SV40 que dirige la expresión del gen de resistencia Zeor. B. Representación esquemática del plásmido pRc/Ad2 que comprende un polinucleótido B según la invención. B1: secuencia nucleotídica que codifica el genoma del adeno virus, en este caso serotipo 5, a excepción de la región que codifica las proteínas El A/E IB y la señal de empaquetamiento (ψ). La secuencia nucleotídica está delimitada por las secuencias ITR (inverted terminal repeats). Bn: Secuencias dianas específicas para una endonucleasa de restricción, en este caso I-Scel. Bin: secuencia nucleotídica attB que facilita la integración del plásmido en el genoma de la célula eucariota. Este proceso está mediado por la recombinasa específica y unidireccional PhiC31. colEl : origen de replicación del plásmido pRC/RSV utilizado como base para la construcción del plásmido pRcAd2. Amp: gen de resistencia a ampicilina para la selección de clones resistentes en bacterias; Neo: gen de resistencia al antibiótico Neomicina para la selección de clones resistentes en células eucariotas; SV40: promotor SV40 que dirige la expresión del gen de resistencia Neor. pA: señal de poliadenilación.

Figura 2: Sistema comercial GeneSwitchΥM (Invitrogen) para el control transcripcional de la expresión génica inducida por mifepristona. A. Plásmido pSwitch de expresión de la proteína de fusión compuesta por el dominio de unión a ADN (GAL4-DBD) de la proteína GAL4 de levadura, el dominio de unión a ligando del receptor de progesterona humano (hPR-LBD) y el dominio de activación de la proteína NF-κB humana (p65- AD). La expresión del activador transcripcional GAL4-hPR-p65 está bajo el control del promotor mínimo de la timidina quinasa (Ptk). La unión de la forma activa de la proteína a las secuencias GAL4-UAS asociadas al promotor regula su propia expresión. B. Plásmido pGeneV5-HisA diseñado para el clonaje del gen de interés. La expresión del gen clonado queda bajo el control del promotor constituido por la caja TATA de EIb (PEib) y las secuencias de unión al activador transcripcional (GAL4-UAS). C. Mecanismo de activación del sistema GeneSwitch™ . La presencia del inductor provoca un cambio conformacional de la proteína de fusión que actúa como activador transcripcional y que es expresada de forma constitutiva por el plásmido pSwitch. Este cambio conformacional consiste en la dimerización de la molécula que pasa de un estado inactivo a su forma activa. El homodímero tiene capacidad de unirse a secuencias específicas (GAL4-UAS) localizadas en la región promotora del gen de interés activando su expresión (plásmido pGeneV5-HisA) y en la región promotora que controla la propia expresión del regulador transcripcional (plásmido pSwitch) iniciando en este caso una reacción de retroalimentación positiva.

Figura 3. Esquema de los sistemas de regulación diseñados para el control transcripcional de los genes EIa, EIb y I-Scel a partir del sistema GeneSwitch™. Las construcciones pGene-El-Scel y p2RU-El-SceI requieren la presencia del plásmido pSwitch para la expresión del regulador transcripcional GAL4-hPR-p65. Por su parte las construcciones pRU-El-Scel y pGal4-2RU-SceI-El incluyen, en una única construcción, los genes de la región El (EIa, EIb), el gen I-Scel y el gen que codifica la proteína de fusión reguladora con su región promotora específica. Todos los genes se encuentran bajo el control de promotores (flechas blancas) con secuencias de unión al activador transcripcional (UAS). Cada una de las unidades transcripcionales se completa con una señal de poliadenilación (pA).

Figura 4: Integración específica de ADN exógeno mediada por la integrasa PhiC31 del fago de Streptomyces. En las células de mamífero esta integrasa se utiliza para promover la recombinación entre la secuencia attB insertada en el vector con el gen de interés y una secuencia pseudo-α^P presente en el cromosoma de la célula. Como resultado se pierden las secuencias de recombinación originales y el vector integrado queda flanqueado por las regiones attR y attL.

Figura 5. Proceso de recombinación entre secuencias homologas del genoma del Adeno virus serotipo 5, purificado a partir del plásmido pTG3602 mediante digestión con Pací (P), y la construcción pRC/A6-A7, linealizada con Xbal (X). Los números indican la posición dentro del genoma adeno viral de cada una de las regiones homologas. Dentro del plásmido pRC/A6-A7 la secuencia adenoviral se encuentra flanqueada por secuencias diana para la endonucleasa de restricción I-Scel (S), mientras que en el extremo 5 ' se ha insertado una secuencia attB para la integración del plásmido en el genoma de la célula de mamífero. El plásmido pRcAd2 resultante del proceso de recombinación incluye el genoma adenoviral delecionado entre las posiciones 190 y 3528, región correspondiente a la secuencia codificante de EIa y EIb. ITR: Secuencias terminales de repetición invertidas (inverted terminal repeats). colE l : origen de replicación del plásmido pRC/RSV utilizado como base para la construcción del plásmido pRcAd2. Amp: gen de resistencia a ampicilina para la selección de clones resistentes en bacterias. Neo: gen de resistencia al antibiótico Neomicina utilizado en la selección de clones resistentes en células eucariotas. SV40: promotor SV40. pA: señal de poliadenilación.

Figura 6. A. Integración estable del plásmido pRcAd2 en la línea celular eucariota mediada por la recombinasa PhiC31. El inserto queda flanqueado por las secuencias attL y attR, producto de la recombinación entre la región attB del plásmido y la secuencia pseudo-attP del genoma celular. S: diana para la endonucleasa I-Scel; Zeo: gen de resistencia a Zeomicina. B. Detección por Nested-PCR de los genes adenovirales Illa, IV, la proteasa (Pr) y el gen que codifica la polimerasa viral (PoI) a partir del ADN genómico purificado del clon estable pRc-1. El resultado de la electroforesis corresponde al análisis de las reacciones de amplificación con los cebadores internos diseñados específicamente para cada gen. El clon pRc-1 también se ensayó por PCR para la detección de la secuencia attB. El resultado negativo de dicha amplificación confirma la integración específica mediada por la recombinasa PhiC31. (-): control negativo de PCR; (+) control positivo de PCR; M: marcador de peso molecular (1 Kb Plus DNA Ladder; Invitrogen).

Figura 7: RT-PCR de los genes adenovirales IVa2, III y la ORF de 34 Kd de la región E4. El cADN se obtuvo a partir de muestras de RNA total extraído de células incubadas en ausencia (1) y presencia (2) del inductor RU486. (+): control positivo de PCR. M: marcador de peso molecular (1 Kb Plus DNA Ladder, Invitrogen).

Figura 8: Detección del gen que codifica el regulador transcripcional GAL4, la endonucleasa de restricción I-Scel y los genes de la región El del adenovirus (EIa y EIb) mediante amplificación por PCR a partir del ADN genómico del clon estable GaI- 13. (-): control negativo de PCR; (+): control positivo de PCR; M: marcador de peso molecular (1 Kb Plus DNA Ladder, Invitrogen).

Figura 9: Ensayo de Western Blot para la detección de la proteína ElA (A) y la endonucleasa I-Scel (B). Los extractos de proteínas se recogieron a partir de células incubadas en ausencia (-) y presencia (+) del inductor RU486. Como control positivo de la proteína ElA se ensayó la línea celular 293S. GADPH: Control positivo del ensayo de Western Blot.

Figura 10: Detección por Nested-PCR de los genes adenovirales Illa, IV, la proteasa

(Pr) y el gen que codifica la polimerasa viral (PoI) a partir del ADN genómico purificado de los clones estables GAd-I y GAd-6. El resultado de la electroforesis corresponde al análisis de las reacciones de amplificación con los cebadores internos diseñados específicamente para cada gen. (-): control negativo de PCR; (+) control positivo de PCR; M: marcador de peso molecular (1 Kb Plus DNA Ladder; Invitrogen).

Figura 11: Producción de adeno virus gutless KCZ a Pase 0 utilizando como línea empaquetadora el clon estable pRc-1. Los extractos se recogieron a las 48, 72, 96 y 120 horas, post-transfección, y se titularon en la línea celular 293 S. Los niveles de virus obtenidos son la media de tres experimentos independientes y se expresan en unidades infectivas (UI)/ml.

Figura 12: Producción de adeno virus gutless KCZ a Pase 0 utilizando como línea empaquetadora los clones estables GAd-I y GAd-6. Los extractos de virus se recogieron a las 48, 72, 96 y 120 horas, post-transfección, y se titularon en la línea 293 S. Los niveles de virus obtenidos son la media de tres experimentos independientes y se expresan en unidades infectivas (UI)/ml.

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN

Los autores de la presente invención han diseñado un nuevo sistema de producción y empaquetamiento (encapsidación) para vectores adenovirales de alta capacidad que no requiere de la utilización de virus helper y que se caracteriza porque integra los genes adenovirales necesarios para el control, replicación y empaquetamiento de las partículas virales dentro del genoma de una célula hospedadora, lo cual mejora la estabilidad del sistema de producción a largo plazo. Asimismo el vector adeno viral de alta capacidad utilizado tan sólo incluye las secuencias necesarias para la replicación y empaquetamiento de los viriones (secuencias ITR y señal ψ) de modo que la capacidad de clonaje del vector es superior a la mostrada en otros sistemas de producción independientes de virus helper u otros vectores auxiliares. Por último, la ausencia de estos genes adenovirales en el vector de alta capacidad elimina el riesgo de cualquier respuesta inmune contra el vector durante su aplicación en clínica.

Primer polinucleótido de la invención (polinucleótido Al) En un primer aspecto, la invención se relaciona con un polinucleótido (en adelante polinucleótido Al de la invención) o un vector de expresión que comprende:

(a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional; (b) un segundo cásete de expresión que comprende una secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional codificado por el polinucleótido definido en (a).

Por "regulador transcripcional" o "transactivador" se entiende indistintamente, en el contexto de la presente invención, una proteína que es capaz de activar la transcripción de un determinado gen mediante su unión a regiones específicas de reconocimiento para dicha proteína en la región no codificante de dicho gen. En una forma de realización particular, el transactivador o regulador transcripcional es un regulador transcripcional regulable. Por "regulador transcripcional regulable" se entiende, en el contexto de la presente invención, un regulador transcripcional cuya actividad puede ser modulada por medio de factores adicionales que pueden ser aportados o eliminados en función de la necesidad de promover transcripción de los genes que comprenden sitios de unión específicos para tales reguladores. El experto en la materia apreciará que la invención contempla cualquier método para regular la expresión del regulador transcripcional siempre que permita la expresión de forma regulada y con un mínimo de transcripción basal regulada. Así, es posible regular la expresión del activador transcripcional mediante el uso de promotores inducibles que responden a un agente inductor, que muestran una expresión basal nula o despreciable en ausencia de agente inductor y que son capaces de promover la activación del gen localizado en posición 3 '. En función del tipo de agente inductor, los promotores inducibles se clasifican en promotores Tet on/off (Gossen y Bujard, 1992, Proc. Nati. Acad. Sd. USA, 89:5547-5551; Gossen et al., 1995, Science 268:1766-1769; Rossi y Blau, 1998, Curr. Opin. Biotechnol. 9:451- 456); promotores Pip on/off (US6287813); promotores dependientes de antiprogestin (US2004132086), promotores dependientes de ecdisona (Christopherson et al, 1992, Proc. Nati. Acad. Sci. USA, 89:6314-6318; No et al, 1996, Proc. Nati. Acad. Sic. USA, 93:3346-3351, Suhr et al, 1998, Proc. Nati. Acad. Sci. USA, 95:7999-8004; y WO9738117), un promotor dependiente de metalotioneina (WO8604920) y promotores dependientes de rapamicina (Rivera et al., 1996, Nat. Med. 2:1028-32).

Alternativamente, la invención contempla el uso de reguladores transcripcionales cuya inducción tiene lugar no mediante un aumento de los niveles de expresión sino mediante un agente inductor que provoca un aumento de la actividad transcripcional, normalmente, originada por una translocación del regulador del citoplasma al núcleo. En este tipo de reguladores transcripcionales suelen estar formados por un dominio de unión a ADN o DBD (DNA binding domaiή), un dominio de unión a un ligando o LBD (ligand binding domaiή), y un dominio de activación de la transcripción o AD (activating domaiή).

El dominio de unión de ADN puede ser cualquier dominio para el que exista un elemento de unión específico conocido, incluyendo dominios de unión a ADN sintéticos, quiméricos o análogos. Dominios de unión a ADN adecuados para la presente invención incluyen (i) homeodominios (Scott et al., 1989, Biochim. Biophys. Acta 989:25-48; Rosenfeld et al, 1991, Genes Dev. 5 :897-907) formados, por regla general, por una cadena de aproximadamente 61 amino ácidos que presenta una estructura secundaria compuesta por tres hélices alfa, (ii) dedos de zinc formados por dos a tres docenas de dedos de ADN de fórmula general CyS2HiS2 organizados en tándem (por ejemplo TFIIIA, Zif268, GIi, and SRE-ZBP) en donde cada módulo comprende una hélice alfa capaz de contactar con una región de ADN de 3 a 5 pares de bases siendo necesarios al menos 3 dedos de zinc para generar un sitio de unión a ADN de alta afinidad y al menos dos dedos de zinc para generar sitios de unión a ADN de baja afinidad, (iii) los dominios de unión a ADN denominados hélice-giro-hélice o HLH (helix-turn-helix) tales como MATl, MAT2, MATaI, Antennapedia, Ultrabithorax, Engrailed, Paired, Fushi tarazu, HOX, Unc86, Octl, Oct2 y Pit-1, (iv) dominios de unión a ADN del tipo cremalleras de leucina (leucine zipper) tales como GCN4, C/EBP, c-Fos/c-Jun y JunB. Ejemplos de dominios de unión a ADN adecuados en la presente invención incluyen el dominio de unión a ADN de GAL4, de LexA, de factores de transcripción, de receptores nucleares del grupo H, receptores nucleares de la superfamilia de las esteroides/hormonas tiroideas. El experto en la materia apreciará que la invención contempla el uso de dominios de unión a ADN híbridos formados por varios motivos de unión a ADN que pueden reconocer sitios de unión a ADN distintos a los de los elementos que los componen. Así, es posible el uso de dominios de unión de ADN formados por la unión de un dedo de zinc y un homeobox. En una forma preferida de realización, el dominio de unión a ADN es el procedente de la proteína GAL4 de S. cerevisiae.

Las secuencias de unión a ligando capaces de promover la localización nuclear de un activador transcripcional que los contienen, adecuadas para el uso en la presente invención, incluyen la secuencia de localización derivada de PPAR (receptores activados por activadores peroxisomales), que se translocan al núcleo en presencia de 15-desoxy-[Delta]-prostaglandina J2, receptores del ácido retinoico que se translocan al núcleo en presencia de los isómeros alfa, beta o gamma del ácido 9-cis-retinoico, receptores de farnesoid X, activables por ácido retinoico y TTNPB, receptores X hepáticos activables por 24-hidroxicolesterol, receptores de benzoato X, activables por 4-amino-butilbenzoato, receptor constitutivo de androstano, receptores de pregnano, inducibles por pregnolono-16-carbonitrilo, receptores de esteroides y xenobióticos, inducibles por rifampicina, receptores de progesterona, inducibles por medroxiprogesterona así como por agonistas y antagonistas de mifepristona y derivados de 19-nortestosterona, receptores de glucocorticoides actibables por glucocorticoides, receptores de hormonas tiroideas, activables por T3 y/o T4, y receptores de estrógenos, activables por estrógenos y sus derivados tales como el 17-betaestradiol y el estradiol, transactivadores tTA inducibles por tetraciclina/doxiciclina "tet-off ' (Gossen y Bujard, 1992, Proc. Nati. Acad. Sci. USA, 89: 5547-5551), transactivadores rtTA inducibles por tetraciclinas "tet-on" (Gossen et al., 1995, Science, 268: 1766-1769), transactivador inducible por muristerona A o ligandos análogos del receptor de la ecdisona (No et al., 1996, Proc. Nati. Acad. Sci. USA, 93: 3346-3351), transactivadores inducibles por el ligando RSLl, como el sistema RheoSwitch inicialmente descrito por Palli et al. (2003, Eur. J. Biochem., 270: 1308-1315), un transactivador inducible por rapamicina o análogos de la rapamicina (Ho et al., 1996, Nature, 382: 822-826; Amara et al., 1997, Proc. Nati. Acad. Sci. USA, 94: 10618-10623), y un transactivador inducible por coumermicina/novobiocina, que actúan competitivamente como inductor y represor respectivamente (Zhao et al., 2003, Hum. Gene Ther., 14: 1619-1629). En una forma preferida de realización, el LBD es un dominio de unión a ligando del receptor de la progesterona humana que puede ser activado con antiprogestinas sintéticas incluyendo derivados de la progesterona tales como RU486 o mifepristona y que no muestran efecto alguno en pacientes tal y como ha sido descrito por Wang et al., (Proc. Nati. Acad. Sci. USA. 1994, 91 : 8180-4).

Por último, el dominio de activación transcripcional puede ser el dominio de activación de los receptores nucleares del grupo H, de los receptores nucleares de hormonas tiroideas o esteroideas, el dominio de activación de VP 16, de GAL4, de NF-κB, de B42, de BP64, o de p65. En una forma preferida de realización, el activador transcripcional es del derivado de la proteína NF-κB humana.

En una forma preferida de realización, el activador transcripcional es la proteína de fusión denominada GAL4-hPR-p65 que comprende el dominio de unión a ADN de GAL4 de Saccharomyces cerevisiae (Laughon y Gesteland, 1984, Mol. CeIl Biol., 4: 260-267; Marmorstein et al., 1992, Nature, 356: 408-414), el dominio de unión a ligando del receptor de progesterona humano (Kastner et al., 1990, Embo J, 9: 1603- 1614; Wang et al., 1994, Proc. Nati. Acad. Sci. USA, 91 : 8180-8184) y el dominio de activación de la proteína NF-κB humana (Burcin et al., 1999, Proc. Nati. Acad. Sci. USA, 96: 355-360; Deloukas y van Loon, 1993, Hum. Mol. Genet., 2: 1895-1900). Este regulador transcripcional es inducible por mifepristona o su análogo RU487. En ausencia de mifepristona, se expresa la proteína de fusión reguladora de forma constitutiva a partir del promotor mínimo de la timidina quinasa. Esta proteína se localiza predominantemente en el núcleo y en una forma inactiva. En el momento de la adición del inductor mifepristona, o su análogo RU486, éste se une con alta afinidad a la región hPR-LBD de GAL4-hPR-p65, provocando un cambio conformacional que resulta en la dimerización de la proteína y su conversión a la forma activa. Estos homodímeros son capaces de unirse a sitios específicos (UAS: upstream activating sequences) promoviendo la transcripción de genes localizados en orientación 3 ' con respecto a dichas secuencias de activación y activando así la transcripción del gen de interés y del gen que codifica el propio factor de transcripción (Fig. 2C).

El experto en la materia apreciará que este tipo de reguladores transcripcionales, cuya actividad se regula mediante la adición de compuestos exógenos que promueven la translocación de los reguladores al núcleo o su cambio conformacional a una forma activa, no requieren que su transcripción esté sujeta a un control transcripcional particularmente fino. De forma general, la secuencia que codifica el transactivador o regulador transcripcional está asociada a un promotor apropiado que dirige su transcripción y expresión, y también a una señal de poliadenilación. Dado que no es imprescindible controlar de forma exacta la transcripción de este tipo de reguladores, éstos pueden encontrarse bajo el control de un promotor mínimo constitutivo. Sin que esto suponga una limitación, el promotor mínimo puede ser, entre otros, un promotor constitutivo de virus, como CMV o RSV, o un promotor constitutivo de células eucariotas, como PGK o EFl. Alternativamente, es posible incluir en la región promotora del gen que codifica el regulador transcripcional un elemento de respuesta al propio regulador transcripcional, de forma que la expresión de éste provoque un aumento en la expresión de si mismo mediante un ciclo de retroalimentación positiva. En una forma de realización, el regulador transcripcional está regulado por una región formada por uno o varios elementos de unión al dominio de unión a ADN de GAL4, preferiblemente 4 elementos de unión al dominio de unión de ADN de GAL4, acoplados al promotor mínimo del gen timidina quinasa (Ptk) del Virus Herpes Simplex.

El segundo elemento del polinucleótido Al comprende un cásete de expresión que codifica una endonucleasa de restricción que se encuentra bajo control operativo del regulador transcripcional codificado en el primer cásete de expresión presente en el primer polinucleótido de la invención. La endonucleasa de restricción es un enzima que corta el ADN de doble cadena mediante reconocimiento y rotura en sitios específicos de dicho ADN. La endonucleasa a la que se refiere la invención es una endonucleasa que no reconoce sitios específicos en el genoma o ADN de células humanas y que, por tanto, no produce roturas en el genoma nativo de dichas células. Sin que esto suponga limitación alguna, la endonucleasa de restricción puede ser, entre otras, I-Scel, Pl-Scel, I-Ppol, I-Dmol o PI-TIiI. En una realización particular, la endonucleasa de restricción codificada por el polinucleótido Al es I-Scel de Saccharomyces cerevisiae. El polinucleótido que contiene la secuencia codificante de la endonucleasa de restricción se encuentra bajo control operativo de una secuencia de unión al regulador transcripcional codificado por el primer elemento del polinucleótido de la invención. De esta manera, el promotor responde a la unión con el trans activador activando o reprimiendo la transcripción y expresión de la endonucleasa. Sin embargo, la capacidad del transactivador para unirse e interactuar con el promotor se modifica dependiendo de si el factor de regulación está unido a un ligando o agente inductor. En consecuencia, es posible regular la transcripción del gen de interés mediante el control de la disponibilidad del agente inductor. En unos casos el agente inductor actúa activando y favoreciendo la transcripción y expresión del gen, mientras que en otros casos la presencia del agente inductor reprime su expresión. En la forma de realización preferida en la que el regulador transcripcional es GAL4-hPR-p65, el polinucleótido que codifica la endonucleasa de restricción se encuentra en posición 3 ' con respecto a un número variable de secuencias de unión al dominio de unión a ADN de GAL4. En una forma de realización aún más preferida, el gen que codifica la endonucleasa de restricción se encuentra en posición 3 ' con respecto a un elemento regulador compuesto por 6 secuencias de unión del factor de transcripción GAL4 y la secuencia de la Caja TATA del gen EIb (Pmb) de adenovirus (Lillie y Green, 1989, Nature, 338: 39-44).

En una realización concreta del polinucleótido Al, el regulador transcripcional es GAL4-hPR-p65 y la endonucleasa de restricción es I-Scel.

Segundo polinucleótido de la invención (polinucleótido A2)

En un segundo aspecto, la invención se relaciona con un polinucleótido (en adelante el polinucleótido A2) o vector de expresión que comprende:

(a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional;

(b) un segundo cásete de expresión que comprende una secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a) y (c) un tercer cásete de expresión que comprende una secuencia nucleotídica que codifica la proteína adenoviral seleccionada ElA o las proteínas adenovirales ElA y ElB, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a).

Los elementos (a) y (b) del polinucleótido A2 corresponden esencialmente a los que forman parte del primer polinucleótido de la invención y han sido descritos con detalle con anterioridad.

El componente (c) del polinucleótido A2 comprende un cásete de expresión que comprende una secuencia nucleotídica que codifica la proteína adenoviral seleccionada ElA o las proteínas adenovirales ElA y ElB. Los genes ElA y, opcionalmente, ElB pueden proceder del genoma de adenovirus de cualquier variedad o serotipo adenoviral humano (que haya sido aislado en humanos), por ejemplo los serotipos 2 (Ad2), 5 (Ad5), 11 (AdI 1) ó 3 (Ad3). En una realización concreta, dicho componente incluye la secuencia delimitada entre las posiciones 505 y 3511 del genoma del adenovirus serotipo 5 (GenBank: AC000008). Esta secuencia se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a). De esta manera, el promotor responde a la unión con el transactivador activando o reprimiendo la transcripción y expresando los genes estructurales ElA y ElB. Sin embargo, la capacidad del transactivador para unirse e interactuar con el promotor se modifica dependiendo de si el factor de regulación está unido a un ligando o agente inductor. En consecuencia, es posible regular la transcripción de los genes ElA y, opcionalmente, ElB mediante el control de la disponibilidad del agente inductor. En una forma de realización preferida, el componente (c) del polinucleótido A2 de la invención se encuentra bajo control de un promotor híbrido compuesto por 6 secuencias de unión al factor de transcripción GAL4 y la secuencia de la caja TATA del gen EIb (PE1I3) de adenovirus (Lillie y Green, 1989, Nature, 338: 39-44). El experto en la materia apreciará que la orientación de los genes en el polinucleótido A2 que responden al activador transcripcional no es esencial para el funcionamiento del mismo. Así, en una forma preferida de realización, el segundo y tercer cásete se transcriben en sentido contrario. En otra forma preferida de realización, las secuencias reguladoras de la transcripción que controlan el segundo y tercer cásete comparten el mismo sitio de unión para el regulador transcripcional (a). En una forma preferida de realización, los genes que codifican la endonucleasa de restricción y las proteínas adenovirales se encuentran bajo el control de un mismo promotor híbrido compuesto por 6 secuencias de unión al factor de transcripción GAL4 y la secuencia de la caja TATA del gen EIb (Pmb) de adenovirus (Lillie y Green, 1989, Nature, 338: 39-44). En una forma de realización aún más preferida, el segundo y tercer cásete del polinucleótido A2 de la invención se transcriben en dirección opuesta y comparten las secuencias de unión al dominio de unión de ADN del factor de transcripción GAL4.

En una realización concreta del polinucleótido A2, el primer cásete de expresión (a) comprende la secuencia que codifica el regulador transcripcional GAL4-hPR-p65, el segundo cásete de expresión (b) comprende la secuencia que codifica la endonucleasa de restricción I-Scel bajo el control de uno o varios sitios de unión de la proteína GAL4 y el tercer cásete de expresión (c) comprende las secuencias de los genes ElA y ElB bajo el control de uno o varios sitios de unión de la proteína GAL4. En una forma de realización aún más preferida, los promotores regulables que dirigen la expresión de la secuencia que codifica la endonucleasa de restricción I-Scel y de las secuencias de los genes ElA y ElB comparten los mismos elementos de respuesta para GAL4-hPR-p65.

Tercer polinucleótido de la invención (polinucleótido B)

En otro aspecto, la invención se relaciona con un polinucleótido (en adelante el polinucleótido B) o vector de expresión que comprende una secuencia nucleotídica que comprende el genoma de un adenovirus recombinante y que carece de, al menos, la secuencia ψ de empaquetamiento y la secuencia que codifica la proteína E lA o E1A/E1B, en donde dicha secuencia que comprende el genoma de un adenovirus recombinante se encuentra flanqueada por secuencias de reconocimiento específico para una endonucleasa de restricción. La secuencia del genoma adenoviral puede obtenerse a partir de un genoma de un adenovirus de cualquier variedad o serotipo adenoviral humano (que haya sido aislado en humanos), por ejemplo los serotipos 2 (Ad2), 5 (Ad5), 11 (AdI l) ó 3 (Ad3).

Preferiblemente, las secuencias de reconocimiento de la endonucleasa de restricción se encuentran flanqueando el genoma adenoviral en posición 5 ' y 3 ' respecto a las secuencias ITR de los extremos, donde se encuentran las regiones adecuadas para la replicación y transcripción de dicho genoma. El experto en la materia apreciará que las dianas de restricción utilizadas en el polinucleótido B dependerán de la endonucleasa de restricción codificada en los polinucleótidos Al y A2 de la invención. Así, las secuencias diana que flanquean el genoma adenoviral son secuencias de reconocimiento específico para una endonucleasa de restricción con las mismas características y requerimientos indicados anteriormente al describir la endonucleasa codificada por los polinucleótidos AI y A2. Sin que esto suponga limitación alguna, las secuencias pueden ser específicas para su reconocimiento, entre otras, por la endonucleasa I-Scel, Pl-Scel, I-Ppol, I-Dmol o PI-TIiI. En una realización particular, son específicas para reconocimiento por la endonucleasa I-Scel.

Adicionalmente, en otra forma preferida de realización, el polinucleótido B de acuerdo a la invención comprende secuencias que facilitan la inserción de dicho polinucleótido en el genoma de la célula empaquetadora. En una forma aún más preferida de realización, dicha secuencias favorecedoras de la integración en el genoma son secuencias de reconocimiento específico para una integrasa. Preferiblemente, la secuencia diana de la integrasa se encuentra en posición 5 ' respecto de la primera secuencia de reconocimiento para la endonucleasa.

Secuencias diana de integrasas adecuadas para la realización de la invención incluyen, sin limitación, la secuencia diana de la recombinasa Cre del fago P l (LoxP), la secuencia diana de la recombinasa FLP de S. cerevisiae (Frt), la secuencia diana de la integrasa del fago de Streptomyces ΦC31 (attB, attP), la secuencia diana de la recombinasa TP901-1, y la secuencia diana de la recombinasa R4, o la secuencia diana de la integrasa lambda. En una forma preferida de realización, las secuencias diana de la invención incluyen secuencias específicas para una integrasa de fagos que media la recombinación unidireccional entre dos sitios o secuencias específicas del ADN. Más particularmente, la integrasa pertenece a la familia de integrasas de la serina, que se caracterizan porque para la rotura de la cadena de ADN utilizan un residuo de serina catalítico (Thorpe y Smith, 1998, Proc. Nati. Acad. ScL USA, 95: 5505-5510). Los sitios de recombinación reconocidos por estas integrasas (attB y attP) presentan secuencias diferentes y son de menor longitud que las secuencias de recombinación reconocidas por otras recombinasas. La integración mediada por este tipo de integrasas es un proceso unidireccional y estrictamente controlado por las secuencias de recombinación (Thorpe et al, 2000, Mol. Microbiol, 38: 232-241). Otra característica importante es que la recombinación entre attP y attB en el huésped, no requiere de otros cofactores para operar. Estas integrasas se utilizan actualmente en procedimientos de manipulación génica en células de mamíferos y se ha comprobado que pueden mediar la integración eficiente de material genético en sitios attP introducidos exógenamente o en secuencias nativas que tienen una identidad parcial con dichos sitios attP (pseudo-attP). Sin que esto suponga limitación alguna, la secuencia diana de integrasa puede ser una secuencia de reconocimiento específico para la integrasa PhiC31, TP901-1 o R4, entre otras. En una realización particular, la secuencia diana de integrasa es attB, correspondiente al sitio de anclaje en el ADN de bacterias específico para la integrasa del fago PhiC31. Esta integrasa puede mediar la recombinación unidireccional entre esta secuencia attB y secuencias pseudo-attP localizadas en el genoma de células humanas.

Así, en otra forma preferida de realización, el polinucleótido B incluye, en dirección 5 ' a 3 ' : opcionalmente, la secuencia de reconocimiento para la integrasa; la primera secuencia de reconocimiento para la endonucleasa; el genoma del adenovirus (cuyos límites están definidos por los ITR del propio adenovirus); y la segunda secuencia para la endonucleasa de restricción.

Vectores y células hospedadoras de la invención y métodos para su obtención Los polinucleótidos de la invención pueden encontrarse aislados o formando parte de vectores que permitan la propagación de dichos polinucleótidos en células huésped adecuadas. Por tanto, en otro aspecto, la invención se relaciona con un vector, tal como un vector de expresión, que comprende el polinucleótido Al, A2 o B de la invención.

Vectores adecuados para la inserción de los polinucleótidos de la invención incluyen vectores de expresión en procariotas tales como pUC18, pUC 19, Bluescript y sus derivados, mpl8, mpl9, pBR322, pMB9, CoIEl , pCRl , RP4, fagos y vectores "shuttle" tales como pSA3 and pAT28, vectores de expresión en levaduras tales como vectores del tipo de plásmidos de 2 mieras, plásmidos de integración, vectores YEP, plásmidos centroméricos y similares, vectores de expresión en células de insectos tales como los vectores de la serie pAC y de la serie pVL, vectores de expresión en plantas tales como vectores de la serie pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE y similares y vectores de expresión en células eucariotas superiores bien basados en vectores virales (adeno virus, virus asociados a los adeno virus, así como retrovirus y, en particular, lentivirus) así como vectores no virales tales como pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1 , pEFl/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1 , pML2d y pTDTl. Vectores particularmente apropiados para la inserción de dichos polinucleótidos son vectores de expresión en células eucariotas superiores, bien basados en vectores virales (tales como virus adenoasociados, retrovirus, lentivirus, herpesvirus, SV40 y alfavirus) o también basados en vectores no virales (tales como plásmidos), capaces de ser mantenidos y/o replicados y/o expresados en la célula hospedadora. En una realización más particular dicho vector de expresión es adecuado para transfectar o infectar células de mamífero ex vivo, particularmente células humanas.

Típicamente, los vectores de expresión eucariota incluyen, por ejemplo, uno o más genes clonados y bajo el control transcripcional de secuencias reguladoras localizadas en 5 ' y 3 ', así como un marcador de selección. Sin que ello suponga una limitación, dentro de las secuencias de control se incluye un promotor (incluyendo el sitio de inicio de la transcripción) capaz de expresarse en células eucariotas, un sitio de unión a ribosomas, una señal de procesamiento de RNA, un sitio de terminación de la transcripción y/o una señal de poliadenilación.

Preferiblemente los vectores comprenden algún gen reportero o de selección que confiere un fenotipo a la célula que lo expresa y que facilita la identificación y/o selección de aquellas células que han incorporado el vector tras haber sido puestas en contacto con éste. Es preferente que el fenotipo de selección no sea expresado en la célula eucariota previa a su transfección o infección. Genes reporteros útiles en el contexto de la presente invención incluyen lacZ, luciferasa, timidina quinasa, GFP y similares. Genes de selección útiles en el contexto de la presente invención incluyen por ejemplo el gen de resistencia a la neomicina, que confiere resistencia al aminoglucósido G418, el gen de la higromicina fosfotransferasa que confiere resistencia a higromicina, el gen ODC, que confiere resistencia al inhibidor de la ornitina descarboxilasa (2- (difluorometil)-DL-ornitina: DFMO), el gen de la dihidrofolato reductasa que confiere resistencia a metrotexato, el gen de la puromicina-N-acetil transferasa, que confiere resistencia a puromicina, el gen ble que confiere resistencia a zeocina, el gen de la adenosina deaminasa que confiere resistencia a 9-beta-D-xilofuranosil adenina, el gen de la citosina deaminasa, que permite a las células crecer en presencia de N- (fosfonacetil)-L-aspartato, el gen de la timidina quinasa, que permite a las células crecer en presencia de aminopterina, el gen de Xantina-guanina fosforribosiltransferasa, que permite a las células crecer en presencia de xantina y ausencia de guanina, el gen trpB de E. coli que permite a las células crecer en presencia de indol en lugar de triptófano, el gen hisD de E. coli, que permite a las células usar el histidinol en lugar de histidina. El gen de selección se incorpora en un plásmido que puede incluir, adicionalmente, un promotor adecuado para la expresión de dicho gen en células eucariotas (por ejemplo, los promotores CMV o SV40), un sitio optimizado de iniciación de la traducción (por ejemplo un sitio que sigue las denominadas reglas de Kozak o un IRES), un sitio de poliadenilación como, por ejemplo, el sitio de poliadenilación del SV40 o de la fosfoglicerato quinasa, o intrones como, por ejemplo, el intrón del gen de la beta- globulina. Alternativamente es posible usar una combinación de gen reportero y gen de selección simultáneamente en el mismo vector. Los polinucleótidos de la invención y los vectores de expresión que los contienen puede obtenerse por técnicas convencionales de biología molecular e ingeniería genética conocidas por cualquier persona del oficio, y que aparecen recogidas en compendios y manuales tales como "Molecular Cloning: a Laboratory manual", de J. Sambrook y D. W. Russel, Eds., Publisher: CoId Spring Harbor Laboratory Press, tercera edición, 2001 (ISBN 978-0879695774). Existen igualmente sistemas comerciales que pueden facilitar la construcción de vectores de expresión para los polinucleótidos de la invención. Así por ejemplo, la construcción de un vector de expresión para células de mamíferos que incluya el polinucleótido A se vería facilitada si se utilizan sistemas como el sistema de expresión inducible GeneSwitch™ (Invitrogen, Carlsbad CA92008 USA, Catalog nos. Kl 060-01 y Kl 060-2), que permite la construcción de un vector para la expresión de un gen de interés de manera inducible por mifepristona; el sistema de expresión inducible RheoSwitch™ (New England Biolabs, Beverly, MA01915-5599 USA), que permite la expresión de un gen de interés de manera inducible por el ligando RLSl; o cualquier otro sistema comercial equivalente.

Los polinucleótidos y vectores de la invención pueden encontrarse formando parte de células hospedadoras que sirven tanto como vehículo de propagación de los vectores como de células empaquetadoras para la producción de adeno virus recombinantes. Así, en otro aspecto, la invención se relaciona con una célula hospedadora que comprende un polinucleótido Al, A2 o B de la invención o un vector de expresión que comprende cualquiera de los polinucleótidos anteriormente citados. En el caso de que las células se utilicen como células empaquetadoras para la producción de adenovirus, éstas han de ser capaces de soportar la producción e infección de adenovirus. Según esta realización, será una célula eucariota adecuada cualquier célula permisiva para la infección y replicación de adenovirus.

En una forma preferida de realización, la línea celular será una línea celular estable. Sin que esto suponga limitación alguna, las células hospedadoras pueden ser células HeLa, A549, KB, HuH7, o cualquier otra célula eucariota capaz de soportar el ciclo de vida del adenovirus. En el caso de que los polipéptidos ElA o El A/E IB sean aportados por la propia célula (en los casos en los que se utilizan el polinucleótido Al de la invención), su expresión puede estar bajo el control de un promotor regulable a través de un agente inductor, para un mayor control del inicio de la expresión de los genes adenovirales incluidos en el polinucleótido B y así limitar al máximo el riesgo de los posibles efectos citotóxicos derivados del exceso de expresión proteínas virales. En este caso no será adecuada una célula que exprese dichas proteínas de modo constitutivo, por ejemplo una célula 293 o PerC6.

En una realización particular, la célula hospedadora es originaria de mamífero, preferentemente de primate y especialmente de humano. En una forma preferida de realización, la línea celular es una línea de carcinoma de pulmón. En una forma de realización aún más preferida, las células hospedadoras son células de la línea A549. Esta línea celular iniciada por Giard et al. (1973, J. Nati. Cáncer Inst., 51 : 1417-1423) y posteriormente caracterizada en profundidad por Lieber et al. (1976, Int. J. Cáncer., 17: 62-70), presenta una gran sensibilidad a la infección por adenovirus lo que le confiere un elevado potencial como línea de producción de virus (Smith et al., 1986, J. Clin. Microbiol, 24: 265-268).

En una forma preferida de realización, la invención se relaciona con una célula hospedadora que comprende el polinucleótido Al de la invención o un vector que comprende dicho polinucleótido. En una forma de realización aún más preferida, la célula comprende, adicionalmente una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, una secuencia que codifica la proteína adenoviral ElB.

En otra forma preferida de realización, la invención se relaciona con una célula hospedadora que comprende el polinucleótido A2 de la invención o un vector que comprende dicho polinucleótido.

En otra forma de realización, la invención se relaciona con una célula hospedadora que comprende el polinucleótido B de la invención o un vector que comprende dicho polinucleótido. En otra forma de realización, la invención se relaciona con una célula hospedadora que comprende el polinucleótido Al y el polinucleótido B de la invención. En una forma de realización aún más preferida, dicha célula comprende, adicionalmente una secuencia que codifica la pro teína adeno viral ElA y, opcionalmente, una secuencia que codifica la proteína adeno viral ElB.

En otra forma de realización, la invención se relaciona con una célula hospedadora que comprende el polinucleótido A2 y el polinucleótido B de la invención.

Tanto las células que comprenden los polinucleótidos Al y B de la invención como las células que comprenden los polinucleótidos A2 y B son particularmente adecuados para la producción y empaquetamiento de vectores adenovirales de alta capacidad por lo que tanto las células que comprenden los polinucleótidos Al y B de la invención como las células que comprenden los polinucleótidos A2 y B pueden usarse en procedimientos y sistemas para la producción y empaquetamiento de dichos vectores. Sin embargo, particularmente útiles para la producción de adenovirus son aquellas en las que los sitios diana que flanquean el genoma adenoviral defectivo en el polinucleótido B se corresponden con la endonucleasa de restricción codificada por los polinucleótidos AI y A2, ya que, de otra manera, la endonucleasa de restricción codificada por los polinucleótidos Al o A2 no podrían actuar sobre el polinucleótido B liberando el genoma adenoviral, lo cual es esencial para la replicación y transcripción de dicho genoma.

Las células hospedadoras de la invención pueden obtenerse bien mediante la introducción de los polinucleótidos o vectores de la invención de forma transitoria o bien, preferiblemente, mediante la introducción de dichos polinucleótidos o vectores de forma estable. Para ello, es necesario poner en contacto los vectores de la invención con las células hospedadoras en condiciones adecuadas para la entrada del ADN en la célula. Los vectores de la invención se introducen en las células objeto de estudio usando cualquiera de los métodos de transfección conocidos para el experto en la materia (véase secciones 9.1 a 9.5 en Ausubel, F. M. et al., "Current Protocols in

Molecular Biology", John Wiley & Sons Inc; ringbou edition 2003). En particular, las células se pueden transfectar mediante co-precipitación de ADN con fosfato calcico, DEAE-dextrano, polibreon, electroporación, microinyección, fusión mediada por liposomas, lipofección, infección por retrovirus y transfección biolística.

Así, en otro aspecto, la invención se relaciona con un método para la producción de células adecuadas para la producción y empaquetamiento de partículas infectivas de un adenovirus de alta capacidad que comprende

(i) transfectar una célula con el polinucleótido Al de la invención y (ii) transfectar dicha célula con el polinucleótido B de la invención en donde las etapas (i) y (ii) pueden llevarse a cabo en cualquier orden o de forma simultánea y en donde se utilizan células que comprenden la secuencia que codifica la proteína adeno viral ElA y, opcionalmente, la proteína adeno viral ElB.

Así, en otro aspecto, la invención se relaciona con un método para la producción de células adecuadas para la producción y empaquetamiento de partículas infectivas de un adenovirus de alta capacidad que comprende

(i) transfectar una célula con el polinucleótido A2 de la invención y (ii) transfectar dicha célula con el polinucleótido B de la invención en donde las etapas (i) y (ii) pueden llevarse a cabo en cualquier orden o de forma simultánea.

El experto en la materia apreciará que las etapas (i) y (ii) en los métodos descritos anteriormente pueden llevarse a cabo de forma que los polinucleótidos o vectores se encuentren de forma transitoria en la célula o, alternativamente, pueden llevarse a cabo de forma que se obtenga una expresión estable de los polinucleótidos A1/A2 y/o B. En el caso de que se desee obtener expresión estable de los vectores de la invención en las células hospedadoras, es necesario incluir durante la etapa de transfección o infección un gen que codifique para resistencia a un determinado antibiótico, de forma que se puedan seleccionar aquellas líneas celulares que han incorporado el ADN en el genoma de aquellas líneas celulares en las que el ADN se encuentra en posición extracromosómica. El gen que permite seleccionar las células se puede aportar formando parte del mismo vector que contiene la construcción objeto de la invención o, alternativamente, se puede aportar separadamente mediante co-transfección con un segundo plásmido que contiene dicho gen de resistencia. En este último caso, el plásmido que contiene la construcción de ADN se aporta a la mezcla de transfección en un exceso molar con respecto al gen de resistencia de forma que por cada evento de integración del gen de resistencia exista una alta probabilidad de integración del gen que contiene el promotor objeto de estudio. Preferiblemente, el plásmido que contiene la construcción de ADN se aporta en un exceso de al menos 5 veces con respecto al vector que contiene el gen reportero de resistencia. Preferiblemente, el gen de resistencia se incluye dentro de los propios vectores de la invención. Los genes de resistencia adecuados para la transfección han sido descritos con anterioridad. Por tanto, en una forma preferida de realización, el método de obtención de células que comprenden los polinucleótidos AI y B o A2 y B de acuerdo a la invención incluyen una etapa adicional de selección en la que se seleccionan células que han integrado de forma estable el primer y/o el segundo polinucleótido en base a marcadores de selección presentes en los polinucleótidos utilizados en las etapas (i) y (ii).

Por una parte, la transfección con un vector de expresión que comprende el polinucleótido A2 ha permitido seleccionar clones de células que integran el polinucleótido de modo estable (mantenimiento de las células hasta 4 meses en cultivo). Ventajosamente, se ha comprobado que la expresión de las proteínas E1A/E1B y de la endonucleasa de restricción está reprimida, manteniendo unos niveles básales de expresión que no resultan perjudiciales para la célula, y que dicha expresión puede ser inducida y activada mediante la adición al cultivo de una cantidad adecuada de un agente inductor apropiado para la construcción concreta empleada.

Adicionalmente, en el caso particular de que se utilice una variante del polinucleótido B que comprende un sitio de reconocimiento de una integrasa, es necesario llevar a cabo la etapa (ii) mediante una co-transfección del vector de expresión que comprende el polinucleótido B junto con un plásmido que codifica y expresa una integrasa y que reconoce la secuencia de reconocimiento de la integrasa, para permitir así la integración del polinucleótido B en el genoma de la célula. Preferiblemente, en el caso de que el sitio de reconocimiento de la integrasa sea el sitio attB, la etapa (ii) implica una co- transfección con un plásmido que codifica la integrasa del fago PhiC31 , lo que permite la integración del polinucleótido B o del vector que contiene dicho polinucleótido en el genoma de la célula mediante una recombinación entre la secuencia attB y secuencias pseudo-α^P presentes en los cromosomas de células humanas. Esta recombinación e integración unidireccional está mediada por la integrasa PhiC31. Para la expresión de las diferentes regiones virales y la posterior replicación del genoma viral presente en el polinucleótido B es necesario que los extremos ITR del virus estén libres además de ser necesaria también la presencia de las proteínas El A/E IB virales. Consecuentemente, las células generadas portan el genoma del adenovirus defectivo pero este no se puede expresar ni replicar. Si bien es posible que se produzcan también integraciones del polinucleótido B de modo aleatorio, la integración en secuencias pseudo-α^P es mayoritaria y sin pérdidas de material genético.

Los métodos descritos anteriormente permiten la obtención de líneas celulares adecuadas para el empaquetamiento de vectores adeno virales de alta capacidad. Así, en otro aspecto, la invención se relaciona con células obtenidas mediante cualquiera de los métodos descritos anteriormente. En particular, la invención contempla células que comprenden los polinucleótidos AI y B o los polinucleótidos A2 y B, en donde dichos polinucleótidos pueden encontrarse integrados de forma estable en el genoma de la célula o pueden encontrarse de forma transitoria.

Sistemas y métodos para la producción y empaquetamiento de vectores adenovirales de la invención

Las células empaquetadores obtenidas mediante la introducción en líneas celulares de los polinucleótidos de la invención o de los vectores que las comprenden pueden ser utilizadas para la generación de vectores adenovirales de alta capacidad mediante la introducción en dichas células de genomas adenovirales que comprenden el gen de interés, bien mediante transfección con polinucleótidos que comprenden el genoma adeno viral o bien mediante infección con adenovirus recombinantes que comprenden dicho gen. Tras la infección/transfección con el adenovirus/polinucleótido que comprende el genoma adenoviral y que comprende a su vez el gen de interés, y la puesta en contacto de las células con el agente que promueve la expresión de los genes incluidos en el polinucleótido Al o A2, se comienza a producir en la célula el regulador transcripcional que, a su vez, activa la transcripción del gen que codifica la endonucleasa de restricción. Ésta, a su vez, actúa sobre los sitios diana que flanquean el genoma adenoviral deficiente comprendido en el polinucleótido B, provocando la escisión de éste del genoma celular, lo que es condición necesaria para la posterior transcripción de los genes adenovirales que forman parte de dicho genoma. La transcripción de los genes adenovirales a partir del polinucleótido B requiere también de la expresión de los genes tempranos ElA y ElB que se encuentran codificados bien por el polinucleótido A2, en cuyo caso responden a la activación del regulador transcripcional, o bien en la propia célula empaquetadora, también bajo el control del regulador transcripcional.

En otro aspecto, la invención se relaciona con un sistema para la producción de adeno virus de alta capacidad que comprende

(a) una célula de acuerdo a la invención y

(b) un adenovirus de alta capacidad

En otro aspecto, la invención se relaciona con un método para la producción y empaquetamiento de vectores adenovirales de alta capacidad, que comprende las etapas de:

(a) transfectar o infectar una célula hospedadora con un polinucleótido que comprende el genoma del adenovirus de alta capacidad que se desea multiplicar y empaquetar o con un vector de expresión que comprende dicho polinucleótido,

(b) cultivar las células transfectadas/infectadas en condiciones que permitan la replicación y empaquetamiento del adenovirus de alta capacidad, y

(c) recuperar las partículas virales del adenovirus de alta capacidad y, opcionalmente, (d) repetir las etapas (a) a (c) en donde las partículas virales de alta capacidad obtenidas en la etapa (c) se utilizan para infección en la etapa (a) del siguiente ciclo, en donde la célula hospedadora usada en la etapa (a) se selecciona del grupo de (i) una célula que comprende el polinucleótido Al de la invención y la secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con el polinucleótido B de la invención o un vector de expresión que comprende dicho polinucleótido,

(ii) una célula que comprende el polinucleótido A2 de la invención, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con el polinucleótido B de la invención o con un vector de expresión que comprende dicho polinucleótido,

(iii) una célula que comprende el polinucleótido B de la invención, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con el polinucleótido Al de la invención y en donde la célula comprende una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB,

(iv) una célula que comprende el polinucleótido B de la invención, en cuyo caso la etapa (a) va precedida de una etapa de transfección o se lleva a cabo simultáneamente con el polinucleótido A2 de la invención o con un vector de expresión que comprende dicho polinucleótido,

(v) una célula que comprende el polinucleótido Al de la invención, el polinucleótido B de la invención y una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB, y (vi) una célula que comprende los polinucleótido A2 y B de la invención.

La etapa (a) del método para la producción y empaquetamiento de vectores adenovirales de alta capacidad comprende la puesta en contacto de una célula empaquetadora con un adenovirus de alta capacidad o con un polinucleótido o vector que comprende el genoma de dicho adenovirus.

Por "adenovirus de alta capacidad" se entiende, según la invención, adenovirus recombinantes de los denominados dependientes de auxiliar o gutless, caracterizados porque carecen de todos los genes del genoma adenoviral excepto las regiones ITR 5 ' y 3 ' y la región de empaquetamiento ψ, tal y como se ha descrito, por ejemplo, por Alba et al. (2005, Gene Therapy, 12 :S 18-S27). Estos adenovirus admiten secuencias heterólogas de hasta 36 kb puesto que carecen de secuencias propias del genoma adenoviral. Genes heterólogos que pueden incorporarse en los vectores gutless de acuerdo con los métodos de la invención incluyen los genes que codifican eritropoietina (EPO), leptinas, hormona liberadora de hormona adrenocorticotropa (CRH), hormona liberadora de hormona somatotropa (GHRH), hormona liberadora de gonado tro finas (GnRH), hormona liberadora de tirotropina (TRH), hormona liberadora de prolactina (PRH), hormona liberadora de melatonina (MRH), hormona inhibidora de pro lactina (PIH), somato statina, hormona adrenocorticotropa (ACTH), hormona somatotropa o del crecimiento (GH), hormona luteinizante (LH), hormona folículo estimulante (FSH), tirotropina (TSH u hormona estimulante del tiroides), prolactina, oxitocina, hormona antidiurética (ADH o vasopresina), melatonina, factor inhibidor Mülleriano, calcitonina, hormona paratifoidea, gastrina, colecistoquinina (CCK), secretina, PBGD, factor de crecimiento de tipo insulina tipo I (IGF-I), factor de crecimiento de tipo insulina tipo II (IGF-II), péptido natriurético atrial (PNA), gonadotrofina coriónica humana (GCH), insulina, glucagón, somatostatina, polipéptido pancreático (PP), leptina, neuropéptido Y, renina, angiotensina I, angiotensina II, factor VIII, factor IX, factor tisular, factor VII, factor X, trombina, factor V, factor XI, factor XIII, interleukina 1 (IL-I), interleuquina 2 (IL-2), factor de necrosis tumoral Alfa (TNF-α), interleuquina 6 (IL-6), interleuquina 8 (IL-8 y chemoquinas), interleuquina 12 (IL- 12), interleuquina 16 (IL- 16), interleuquina 15 (IL- 15), interleuquina 24 (IL-24), interferones alfa, beta, gamma, CD3, ICAM-I, LFA-I, LFA-3, quimioquinas incluyendo RANTES lα, MIP- lα, MIP- l β, factor de crecimento neuronal (NGF), factor de crecimiento derivado de las plaquetas (PDGF), factor de crecimiento transformante beta (TGF-beta), proteínas morfogenéticas del hueso (BMPs), factores de crecimiento de los fibroblastos (FGF y KGF), factor de crecimiento epidérmico (EGF y relacionados), factor de crecimiento endotelial vascular (VEGF), factor estimulante de colonias de granulocitos (G-CSF), factor de crecimiento glial (GDNF), factor de crecimiento de quer atino cito s, factor de crecimiento endotelial, antitripsina 1 alfa, factor de necrosis tumoral, factor estimulante de colonias de granulocito y macró fagos (GM-CSF), cardiotrofina 1 (CT-I), oncostatina M (OSM), anfíregulina (AR), ciclosporina, fibrinógeno, lactoferrina, activador de plasminógeno tipo tisular (tPA), quimotripsina, inmunoglobinas, hirudina, superóxido dismutasa, imiglucerasa, β-Glucocerebrosidasa, glucosidasa-α , α-L-iduronidasa, iduronato-2-sulfatasa, galsulfasa, α-galactosidasa A humana, inhibidor de la proteinasa α-1, lactasa, enzimas pancreáticas (lipasa, amilasa, proteasa), adenosina deaminasa, inmunoglobulinas, albúmina, toxinas botulínicas de tipo A y B, colagenasa, deoxirribonucleasa I humana, hialouronidasa, papaina, L-asparaginasa, lepirudin, estreptoquinasa, péptidos inhibidores del factor de transformación celular beta (TGF-β) tales como los descritos en WO0331 155, WO200519244 y WO0393293, cuyo contenido se incorpora en la presente invención por referencia, casetes de expresión apropiados para la transcripción de moléculas de RNA de interferencia (shRNA, siRNA, miRNA, RNA de ribonucleoproteínas Ul modificadas). Además de dichos genes heterólogos, los adenovirus gutless utilizados en la invención pueden contener regiones de relleno o stuffer, tales como la secuencias de relleno derivadas del genoma del fago lambda descritas por Parks et al. (1999, J. ViroL, 73:8027-8034) o el ADN de relleno que aparece en pSTK120 según ha sido descrito por Sandig et al. (2000, Proc. Nati. Acad. Sd. USA, 97:1002-1007). Estas regiones contienen habitualmente secuencias presentes en el genoma humano y capaces de aumentar la expresión de los genes heterólogos con respecto a los adenovirus controles que en lugar de dicho ADN de relleno humano comprenden el fragmento de 22 kb del fago lambda descrito en Parks et al. (1999, J. ViroL, 73:8027-8034). La longitud total del ADN de relleno humano puede variar pero oscila entre 20 y 30 kb, preferiblemente de 20 a 25 kb o, aún más preferiblemente, de 21 a 23 kb, por ejemplo 22 kb. El número de secuencias que actúan en cis en dicho ADN de relleno puede variar entre 2, 3, 4 o más e incluye, sin limitación, el dominio repetido alfoide de 16.2 kb (descrito en Smith et al., 1995, Mol. CeIl. Biol, 15:5165-5172); regiones de adhesión a la matriz (MAR) como por ejemplo el fragmento de 4.2 kb que contiene el extremo izquierdo del adenovirus de tipo 6 o dos copias de la región de adhesión a la matriz de la inmunoglobulina K (según fue descrito por Betz et al, 1994, CeIl, 77:239-248); una región de control de hepatocitos (HCR) tales como el fragmento de 1.2 kb que comprende dicho HCR (según fue descrito por Miao et al., 2000, Molecular Therapy, 1 :522-532); u otra región de adhesión a matriz tales como el la región de 2.8 kb de la lisozima de pollo (según ha sido descrito por Phi- Van et al, 1990, Mol. CeIl. Biol. 10:2302-2307, región de adhesión a matriz de la región 5' del interferón β (según ha sido descrito por Bode et al. 1992, Science, 10:195- 197) u otras secuencias humanas no codificantes tales como secuencias teloméricas o centroméricas.

La puesta en contacto de las células hospedadoras con el polinucleótido que comprende el genoma adenoviral se lleva a cabo usando técnicas conocidas para el experto en la materia, tales como transfección de dicho polinucleótido o de un vector que lo comprende mediante transfección mediante co-precipitación de ADN con fosfato calcico, DEAE-dextrano, polibreon, electroporación, microinyección, fusión mediada por liposomas, lipofección, infección por retrovirus y transfección biolística. Alternativamente, es posible poner en contacto las células con el adenovirus que se desea amplificar, en cuyo caso la propia capacidad del adenovirus de infectar células permite la introducción en la célula de dicho genoma.

Por "célula empaquetadora" se entiende cualquiera de las células descritas en la presente invención y que contienen, al menos el polinucleótido A1/A2 o el polinucleótido B de la invención. El experto en la materia apreciará que es posible el uso de distintas células empaquetadoras. Sin embargo, dependiendo de la presencia o no en la célula empaquetadora de uno o más de los polinucleótidos de la invención, la etapa (a) debe ir precedida de o llevarse a cabo simultáneamente con una etapa de transfección en la que las células se ponen en contacto con aquellos polinucleótidos de la invención que no aparezcan en las células empaquetadoras y que son necesarias para aportar los elementos esenciales para la replicación del genoma adenoviral así como para la producción en las células de los polipéptidos necesarios para el ensamblaje de los adenovirus. Así, es posible utilizar como célula empaquetadora una célula que comprenda el polinucleótido Al de la invención y una secuencia que codifique la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB. Sin embargo, el uso de esta célula empaquetadora requiere de una etapa previa o simultánea a la etapa (a) consistente en la transfección de dicha célula con el polinucleótido B de la invención o un vector de expresión que comprende dicho polinucleótido. En el caso de que se utilice una célula que comprenda el polinucleótido A2 de la invención, la etapa (a) debe ir precedida de o llevarse a cabo de forma simultánea con una etapa de transfección con el polinucleótido B de la invención o con un vector de expresión que comprende dicho polinucleótido.

En el caso de que se utilice como célula empaquetadora una célula que comprende el polinucleótido B de la invención, la etapa (a) debe ir precedida de o llevarse a cabo de forma simultánea con una etapa de transfección con el polinucleótido Al de la invención y, en cuyo caso, la célula debe comprender, adicionalmente, una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB.

En el caso de que se utilice una célula que comprende el polinucleótido B de la invención, la etapa (a) debe ir precedida de o llevarse a cabo de forma simultánea con una etapa de transfección con el polinucleótido A2 de la invención o con un vector de expresión que comprende dicho polinucleótido.

También es posible utilizar una célula que comprenda el polinucleótido Al de la invención, el polinucleótido B de la invención y una secuencia que codifique la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB o, alternativamente, una célula que comprenda los polinucleótidos A2 y B de la invención.

La etapa (b) del método de la invención comprende el mantener las células transfectadas/infectadas obtenidas en la etapa (a) en condiciones que permitan la replicación y empaquetamiento del adenovirus de alta capacidad. Para ello, es necesario que dichas condiciones permitan la expresión del regulador transcripcional codificado por el polinucleótido Al o A2, de forma que éste actúe sobre sus sitios de unión en la región reguladora del gen de la endonucleasa presente en el polinucleótido Al y A2 y sobre sus sitios de unión en la región reguladora de los genes adenovirales ElA y ElB, presentes en el polinucleótido A2. Para ello, en los casos en los que el regulador transcripcional codificado por el polinucleótido Al o A2 sea un regulador activable, la etapa (b) implica poner en contacto las células con el agente capaz de activar el regulador transcripcional. En una forma preferida de realización, el regulador transcripcional codificado por el polinucleótido Al o A2 es GAL4-hPR-p65, según se ha descrito anteriormente, en cuyo caso, el agente inductor es mifepristona.

La etapa (b) se lleva a cabo durante el tiempo necesario para que la concentración de partículas virales sea lo suficientemente alta, según se determina mediante medios estándar tales como el método Resource Q basado en HPLC, según ha sido descrito por Shabram et al., (1997, Hum. Gene Ther., 8:453-465), o de modo indirecto mediante inspección visual del efecto citopático en las células. Opcionalmente, el cultivo de las células puede incluir la adición de medio de cultivo fresco.

En la etapa (c), los adenovirus generados durante la etapa (b) son recuperados del cultivo celular. Para ello será necesario separar las células del medio de cultivo por cualquier método conocido por los expertos en la técnica (tripsinización y centrifugación o filtración), romper las células en solución inerte (ciclos de congelación/descongelación, homogenización, sonicación, cavitación, uso de detergentes y similares) y purificar las partículas de adenovirus por métodos conocidos como pueden ser la ultracentrifugación en gradiente de CsCl o mediante distintos tipos de cromatografía tales como una combinación de cromatografía de intercambio iónico y cromatografía de afinidad con quelatos metálicos (Huyghe et al., 1996, Hum. Gene Ther., 6: 1403-1416), una combinación de cromatografía de intercambio iónico y cromatografía de fraccionamiento en gel (WO07059473), cromatografía en dietilaminoetil (DEAE) celulosa (Haruna et a l, 1961, Virology 13, 264-267), cromatografía en hidroxiapatito (US2002/0064860) y cromatografía en otras resinas tales como geles blandos (agarosa), polímeros macroporosos basados en polímeros sintéticos que incluyen cromatografía de permisión (fractogel) y materiales basados en un gel blando en una cápsula dura (por ejemplo, Ceramic HyperD® F) (Rodrigues, 1997, J. Chromatogr. B Biomed. Sci. Appl, 699:47-61).

La etapa (d), que es opcional, consiste en repetir las etapas de (a) a (c) una o varias veces. Para ello, en cada etapa (a) del ciclo, se utiliza como material de partida partículas adenovirales obtenidas en la etapa (c) del ciclo anterior. De esta manera se puede repetir el proceso de la invención sucesivas veces obteniendo un número mayor de partículas adeno virales en cada ciclo.

La invención se ilustra a continuación en base a los siguientes ejemplos que se proporcionan a modo ilustrativo y no limitativo del alcance de la invención.

EJEMPLOS

Ejemplo 1: Construcción del plásmido pGal4-2RU-El-SceI para la expresión inducible de los genes adenovirales EIa y EIb y de la enzima de restricción I-Scel.

En la presente realización, el plásmido pGal4-2RU-El-SceI, que contiene el polinucleótido A2 según se define en la invención (Fig. IA), se ha diseñado específicamente para el control, a nivel transcripcional, de la expresión de los genes adenovirales EIa y EIb. Dentro de esta construcción, y bajo el mismo sistema de control transcripcional, se ha incluido el gen que codifica la endonucleasa de restricción I-Scel. El regulador transcripcional que controla la expresión de los genes EIa, EIb y I- Scel, se expresa de manera constitutiva a partir de una secuencia nucleotídica incluida dentro del mismo polinucleótido A2.

El mecanismo de regulación de la transcripción, incluido en la presente invención, está mediado por el sistema de la antiprogestina mifepristona (Burcin et al., 1999, Proc. Nati. Acad. Sd. USA, 96: 355-360). Dicha regulación tiene lugar a través de una proteína de fusión insensible a hormonas endógenas humanas pero activa en presencia de antiprogestinas sintéticas (RU486) a dosis suficientemente bajas como para evitar efectos secundarios en humanos.

Como base de la construcción del plásmido pGal4-2RU-El-SceI se ha utilizado el sistema comercial GeneSwitch™ (Invitrogen, Carlsbad CA92008 USA, Catalog nos. Kl 060-01 y Kl 060-2) . Este sistema proporciona todos los componentes genéticos necesarios para el diseño del plásmido que incluye el polinucleótido A2. El primer componente del sistema GeneSwitch™ es el vector pSwitch (Fig. 2A), el cual codifica la proteína de fusión GAL4-hPR-p65 que actúa como activador transcripcional. La proteína se divide en un dominio de unión a ADN (DBD) de la proteína GAL4 de Saccharomyces cerevisiae (Laughon y Gesteland, 1984, Mol. CeIl Biol, 4: 260-267; Marmorstein, et al., 1992, Nature, 356: 408-414), un dominio truncado de unión a ligando del receptor de progesterona humano (hP R-LBD) (Kastner, et al., 1990, Embo J, 9: 1603-1614; Wang, et al., 1994, Proc. Nati. Acad. Sci. USA, 91 : 8180-8184) y el dominio de activación de la proteína NF-κB humana (AD) (Burcin, et al., 1999, Proc. Nati. Acad. Sci. USA, 96: 355-360; Deloukas y van Loon, 1993, Hum. Mol. Genet., 2: 1895-1900). La expresión de la proteína reguladora se encuentra bajo el control de un promotor híbrido derivado de la unión de las secuencias de activación de GAL4 de Saccharomyces cerevisiae (UAS: upstream activating sequences) (Giniger et al., 1985, CeIl, 40: 767-774; Wang et al, 1994, Proc. Nati. Acad. Sci. USA, 91 : 8180-8184) y el promotor mínimo del gen timidina quinasa (Ptk) del Virus Herpes Simplex. La región de activación del promotor incluye 4 copias de la secuencia 5 '-(T/C)GGAGT ACTGTCCTCCG-3 ' (SEQ ID NO: 1). Cada una de ellas sirve como sitio de unión para dos moléculas del dominio de unión a ADN del factor de transcripción GAL4 (Marmorstein, et al., 1992, Nature, 356: 408-414).

El segundo componente del sistema GeneSwitch™ es el plásmido pGene/V5-HisA (Fig. 2B), que controla la expresión del gen de interés. En este caso el promotor híbrido que controla la transcripción se compone de 6 secuencias de unión del factor de transcripción GAL4 y la secuencia de la Caja TATA del gen EIb (PEIIO de adenovirus (Lillie y Green, 1989, Nature, 338: 39-44).

El sistema en ausencia de mifepristona va a expresar constitutivamente la proteína de fusión reguladora GAL4-hPR-p65 a partir del promotor mínimo de la timidina quinasa. Esta proteína se localiza predominantemente en el núcleo y en una forma inactiva. En el momento de la adición del inductor mifepristona, o su análogo RU486, éste se une con alta afinidad a la región hPR-LBD de GAL4-hPR-p65, provocando un cambio conformacional que resulta en la dimerización de la proteína y su conversión a la forma activa. Estos homodímeros interaccionan con las secuencias de unión de GAL4 (UAS) localizadas en los plásmidos pGene/V5-HisA y pSwitch, activando así la transcripción del gen de interés y del gen que codifica el propio factor de transcripción (Fig. 2C).

En base a la idea planteada en la presente invención de poner la región El de Ad5 y el gen de la endonucleasa I-Scel bajo el control del sistema inducible GeneSwitchΥM, inicialmente se diseñaron distintas combinaciones del sistema de regulación, la secuencia del genoma adenoviral entre las posiciones 505 y 351 1 (Ad5(505-3511)) (GenBank: AC000008) y el gen codificante de I-Scel. En estas combinaciones el mecanismo de regulación se basa en la utilización de uno o dos plásmidos y en los que los genes El y el gen l-Scel quedan bajo el control de un único promotor o bien bajo el control de promotores diferentes dispuestos, a su vez, en la misma o distinta orientación (Fig. 3A). Cada una de estas combinaciones se ensayó para determinar la capacidad de regulación de la expresión de la región El y el gen l-Scel y su capacidad de integración estable dentro del genoma celular. De todas ellas, la construcción pGal4-2RU-El-SceI fue considerada la más adecuada para su aplicación en el diseño de un sistema de producción de adenovirus de alta capacidad independiente de helper.

Las cepas bacterianas utilizadas para la propagación de las construcciones descritas a continuación fueron Escherichia coli DH5α y E. coli STBL2. El crecimiento se llevó a cabo en medio Luria Bertani (LB) (Sigma-Aldrich, 28760 Madrid, España) suplementado con Ampicilina (100 μg/ml) (Sigma-Aldrich) como medio de selección y a 37 0C, en el caso de la cepa DH5α, y 30 0C para STBL2. Las bacterias fueron transformadas siguiendo el protocolo del CaCl2 descrito inicialmente por Hanahan (1983, J. Mol. Biol, 166: 557-580). Para ello se mezclaron 10-20 ng de ADN plasmídico con 100 μl de células competentes y se mantuvo en hielo durante 30 min. A continuación, para aumentar la eficiencia del proceso, la mezcla se incubó a 42 0C durante 1 minuto e inmediatamente se transfirió a hielo en donde se incubó otros 2 min. Por último se añadió 1 mi de medio LB y se incubó durante 1 h a 37 0C y en agitación.

Para la purificación de plásmidos, así como para la purificación de fragmentos de ADN producto de la digestión con enzimas de restricción tras su separación en geles de agarosa, se utilizaron los sistemas FX microplasmid prep kit (GE Healthcare Europe, 8290 Barcelona, España) y QlAquick GeI extraction hit (Qiagen, Valencia CA91355, USA) respectivamente, siguiendo las recomendaciones del fabricante.

En el clonaje de fragmentos de ADN, las reacciones de ligación se diseñaron para un volumen final de 20 μl con 1 U de T4-ADN ligasa (New England Biolabs, Beverly MA01915-5599, USA) y 2 μl de tampón de reacción 1OX (New England Biolabs). En el caso de fragmentos con extremos romos, las reacciones se diseñaron para un volumen final de 20 μl con 1 U de T4-ADN ligasa (New England Biolabs), 2 μl tampón de reacción 10X (New England Biolabs) y 2 μl de PEG 4000 al 50%. En cualquier caso, todas las reacciones se incubaron a temperatura ambiente durante 2 horas y se inactivaron a 65 0C/ 10 minutos previamente a su introducción en la cepa de E. coli correspondiente. Los clones recombinantes se seleccionaron en base al marcador de resistencia codificado por el vector y se confirmaron por digestión con endonucleasas de restricción y electroforesis en gel de agarosa al 1%.

Todas las reacciones de PCR diseñadas en el proceso de síntesis del plásmido pGal4- 2RU-El-SceI se llevaron a cabo en presencia de 1 U del enzima Taq polimerasa (BioTaq, Bioline, Londres NW2 6EW, UK), tampón de PCR (Bioline), MgCl2 4 mM, 0.4 mM de cada dNTP, 10 pmol de cada cebador, ADN y agua desionizada estéril hasta un volumen final de 50 μl. Las condiciones de amplificación fueron las siguientes: 1 ciclo de desnaturalización de 4 minutos a 95 0C; 29 ciclos de 50 segundos a 94 0C de desnaturalización, 40 segundos a 50 0C de hibridación con el cebador y 40 segundos a 72 0C de elongación; 1 ciclo de 5 minutos a 72 0C de elongación final. Para el análisis de los productos de amplificación las muestras se mezclaron con 1.5 μl de la solución de carga (azul de bromofenol 0.25% en agua destilada; Glicerol 40%; EDTA 100 mM) y se analizaron por electroforesis en geles de agarosa (1%) con tampón TAE IX (Tris Base 40 mM; ácido acético glacial 20 mM; EDTA 1 mM, pH 8.0) visualizando el ADN mediante tinción con bromuro de etidio (0.5 μg/ml).

El plásmido de regulación pGal4-2RU-El-SceI se diseñó en cinco pasos descritos a continuación: 1) Construcción del vector pGene-LinkerRU2: El plásmido pSwitch fue linealizado con los enzimas de restricción Sbfl (posición 38) y BamHl (posición 2484) para incluir el LinkerRU2. Éste se sintetizó previamente a partir de los cebadores

LinkerRU-1 : 5'-

GGACCACCAAGGATCCTCTAGAACCGTTTAAACACCACTAGTCCAACGCGTGATAT CACCGCGGCCGC A-3' (SEQ ID NO: 2) LinkerRU-2: 5 'GATCTGCGGCCGCGGTGATATCACGCGTTGGACTAGTGGTGTTTAAACGGTTCTA GAGGATCCTTGGTGGTCCTGCA3' (SEQ ID NO: 3)

En la reacción de anillamiento se mezclaron 10 μl de cada cebador a una concentración 50 mM en solución tampón (Tris-HCl 50 mM pH8.0; NaCl 100 mM; EDTA 1 mM). Las condiciones de reacción fueron las siguientes: 95 0C durante 2 minutos y 52 0C durante 10 minutos. Seguidamente el fragmento LinkerRU2 se fosforiló con el enzima T4 polinucleótido kinasa siguiendo las recomendaciones del fabricante (New England Biolabs). La reacción se incubó 30 minutos a 37 0C y se inactivo a 65 0C durante 15 minuntos. A continuación se procedió a la ligación del LinkerRU2 con el vector pSwitch y su transformación en E. coli DH5α. La construcción resultante se denominó pSwitch-LinkerRU2.

Seguidamente, la digestión del vector pSwitch-LinkerRU2 con los enzimas Fspl (posición 6623 de pSwitch) y Apal (posición 2721 de pSwitch) liberó el LinkerRU2 arrastrando parte de las secuencias adyacentes del vector pSwitch. Este fragmento se subclonó en el vector pGeneV5-HisA digerido previamente con estos mismos enzimas. El vector resultante se denominó pGene-LinkerRU2 y será la base de la construcción del vector pGal4-2RU-El-SceI.

2) Clonaje de la región El del adenovirus:

A partir del vector pGL3-Basic (Groskreutz y Schenborn, 1997, Methods Mol. Biol, 63: 11-30) y mediante digestión con BamHl y Xbal se liberó un fragmento de 262 pb que incluía la señal de poliadenilación del SV40 (SV40pA). Esta secuencia se clonó en el plásmido pBluescript II KS(+) (Stratagene, La Jolla CA92037, USA), digerido previamente con estos mismos enzimas, para dar lugar al plásmido pBS-SV40pA.

Por su parte, la digestión secuencial del plásmido pGeneV5-HisA con los enzima Salí (posición 151) y Pvull (posición 895) permitió el aislamiento de la señal de poliadenilación de la hormona de crecimiento bovina (BGHpA). Este fragmento de 744 pb se clonó en el plásmido pBS-SV40pA linealizado previamente con Salí y BamHl y cuyo extremo BamHl previamente se hizo romo con Klenow siguiendo las recomendaciones del fabricante (DNA Pofymerase I, Large (Klenow) fragment; New England Biolabs). De este modo se obtiene un inserto que comprende las señales de poliadenilación BGH y SV40 unidas por una secuencia diana para el enzima de restricción BamHl.

Seguidamente, se procedió a la síntesis del plásmido pGeneLinkerRU2-2pA. Para ello, la digestión del vector pBS-BGHpA-SV40pA con Xbal liberó un fragmento de 623 pb que incluye las dos secuencias de poliadenilación y que se clonó dentro de la diana única Xbal presente en el LinkerRU2 del plásmido pGene-LinkerRU2. La orientación correcta del inserto (5 -SV40pA-BGHpA-3 ') se confirmó por restricción con Pmel.

La región El del Ad5 se amplificó por PCR con los cebadores: adl9 5 -GAGTGCCAGCGAGTAGAGTT-3 ' (SEQ ID NO: 4), y ad22 5 -GAATTCTCAATCTGTATCTTCATC-3 ' (SEQ ID NO: 5).

El producto resultante de 3 kb se clonó en el vector específico para productos de PCR pGemT-Easy (Promega Biotech Ibérica, 28108 Madrid, España). Mediante digestión con EcoRl se purificó dicha región El y se subclonó dentro de la diana EcoRl del vector pGeneLinkerRU2-2pA y que se localiza "corriente abajo" de la señal de poliadenilación BGHpA. El plásmido resultante se denominó pGeneLinkerRU2-2pA-

El.

3) Clonaie del gen GAL4-DBD/hPR-LBD/p65-AD (regulador transcripcional) y su región promotora autorregulada. La digestión del vector pSwitch con los enzimas de restricción Sbfl (posición 38) y BamHl (posición 2485) aisló las secuencias de unión al regulador transcripcional (región UAS), el promotor mínimo de la proteína quinasa (Ptk) y el gen codificante del activador transcripcional GAL4-DBD/hPR-LBD/p65-AD. Este fragmento Sbfi-BamM, de 2.4 kb, se clonó en el plásmido pGeneLinkerRU2-2pA digerido previamente con estos mismos enzimas y provocando la pérdida de la secuencia de poliadenilación SV40pA. La construcción resultante recibió el nombre de pGeneLinkerRU2-Gal4- BGHpA-El.

Para recuperar esta segunda señal de poliadenilación, la secuencia SV40pA se purificó a partir de la construcción inicial pGeneLinkerRU2-2pA por digestión con BamHl. El fragmento de 0.2 kb se clonó dentro de la diana única BamHl del plásmido pGeneLinkerRU2-Gal4-BGHp A-E 1.

4) Clonaje del gen I-Scel

El gen que codifica la endonucleasa I-Scel se obtuvo mediante amplificación por PCR con los cebadores:

Scel-bl 5 -AAACCATGGGATCAAGATCGC-3 ' (SEQ ID NO:6), y

Scel-b2 5 -CCCTCT AGATTATTTCAGGAAAGTTTCGGAGGA-3 ' (SEQ ID NO:7),

a partir del plásmido pl-Scel (Choulika, et al., 1994, C. R. Acad. Sci. III, 317: 1013- 1019). Tras su clonaje en pGemT-Easy se liberó mediante digestión con el enzima de restricción Non. Los extremos del fragmento purificado se hicieron romos con el fragmento Klenow siguiendo las recomendaciones del fabricante (New England Biolabs) y a continuación se sometió a una segunda digestión con el enzima de restricción Spel. Por último el fragmento purificado, de 0.8 kb, se clonó entre las dianas Spel (posición 478) y Non (posición 522, tratada con Klenow) del vector pGeneV5-HisA. El tratamiento con Klenow conlleva la pérdida de la diana Non. El plásmido resultante se denominó pGene-IScel. La digestión del plásmido pGene-IScel con Xbal liberó un fragmento de 1.2 kb que incluye el gen de la endonucleasa I-Scel bajo el control transcripcional del promotor mínimo del gen EIb de adenovirus (PEIB). El fragmento se subclonó dentro de la diana compatible Spel localizada, dentro del plásmido pGeneLinkerRU2-Gal4-2pA-El, entre la secuencia de poliadenilación BGH y la región El. La construcción resultante se denominó pGeneLinkerRU2-Gal4-2pA-ISceI-El .

5) Clonaje del promotor inducible dual para el control de la transcripción de I-Scel y la región El del adenovirus.

La región del vector pGeneV5-HisA que engloba las secuencias reguladoras de unión al activador transcripcional (UAS) y el promotor mínimo PEIB se obtuvo por amplificación por PCR con los cebadores:

PRU-I 5 -AATACTAGTCCGAGCTCTTACGCGGGTC-3' (SEQ ID NO: 8), y

PRU-2 5 '-AATACGCGTGGTGGCCTGTGAAGAGAAAAAA-3 ' (SEQ ID NO:9),

y se subclonó en el vector pGemT-Easy. Posteriormente, el inserto se liberó por digestión con Not\ y se subclonó en la construcción pGeneLinkerRU2-Gal4-2pA-ISceI- El, dentro de la diana Not\ localizada entre el promotor mínimo PEIB de I-Scel y la región El del adenovirus. La construcción resultante se denominó pGal4-2RU-SceI-El (Fig. 3B).

Ejemplo 2: Construcción del plásmido pRCAd2 para la integración en células de mamífero del genoma de un adenovirus delecionado en la señal de empaquetamiento y genes EIa y EIb, y que codifica la endonucleasa I-Scel.

Dentro de la secuencia que engloba el genoma adenoviral se ha delecionado la secuencia de empaquetamiento (ψ) y la región correspondiente a los genes tempranos El a y Elb para un mayor control de la expresión del resto de los genes virales. Asimismo, la secuencia adenoviral se encuentra delimitada en ambos extremos por secuencias de reconocimiento para la endonucleasa de restricción I-Scel de Saccharomyces cerevisiae (Anglana y Bacchetti, 1999, Nucleic Acids Res., 27: 4276- 4281) la cual, debido al tamaño de su secuencia diana (T AGGGAT AACAGGGT AA - SEQ ID NO: 8) y su alta especificidad, no reconoce secuencias dentro del genoma de la célula a transfectar. La inserción de estas secuencias facilita la liberación del genoma viral sólo en presencia de la proteína I-Scel. Esta digestión deja libres los extremos ITR del adenovirus, necesarios para la correcta transcripción y replicación del ADN viral.

Por último, en el extremo 5 ' de la construcción se ha incluido una secuencia attB que promueve la integración del plásmido dentro del genoma celular, proceso mediado por la recombinasa PhiC31 del fago de Streptomyces. Este enzima posee un gran potencial como sistema de integración de ADN exógeno en células de mamífero ya que da lugar a una reacción específica y unidireccional y posee unas frecuencias netas de integración superiores a las observadas con otras recombinasas (Thyagarajan et al., 2001, Mol. CeIl. Biol, 21 : 3926-3934). Las secuencias de reconocimiento para la integrasa PhiC31 se denominan attB y attP y son diferentes en su secuencia. Tras la reacción de integración, las secuencias att resultantes difieren de las secuencias attB y attP originales, bloqueando posibles reacciones de recombinación secundarias. En células humanas, PhiC31 es capaz de mediar eventos de recombinación en puntos del genoma en los que existen secuencias con identidad parcial a attP y que se denominan pseudo-α^P (Fig. 4). Según Thyagarajan et al. (2001, supra) el número total de secuencias pseudo-α^P podría estar entre 102 y 103 lo que hace que la frecuencia de integración sea de 2 a 3 veces mayor que en el caso de las integraciones mediadas por recombinación homologa, e incluso de 10 a 100 veces mayor que la integración mediada por otras recombinasas específicas como la recombinasa Cre.

Las cepas bacterianas de E. coli utilizadas para la propagación de las construcciones descritas a continuación fueron DH5α, STBL2 y BJ5 183. Las bacterias fueron transformadas siguiendo el protocolo del CaCl2 descrito en el Ejemplo 1. El crecimiento se llevó a cabo en medio Luria Bertani (LB) (Sigma-Aldrich) suplementado con Ampicilina (100 μg/ml) (Sigma-Aldrich) como medio de selección y a 37 0C, en el caso de las cepas DH5α y BJ5183, y 30 0C para E. coli STBL2. Todas las reacciones de PCR diseñadas en el proceso de síntesis del plásmido pRcAd2 se llevaron a cabo en las mismas condiciones que las descritas en el Ejemplo 1. Los procedimientos generales aplicados en la purificación y manipulación de ácidos nucleicos también se describen en el Ejemplo 1.

El vector pRcAd2 se diseñó en 4 pasos, descritos a continuación:

1) Clonación de la secuencia αtfi?-ISceI-Ad(l-190)

El primer paso en la construcción del vector pRcAd2 fue la amplificación por PCR de la región attB con los cebadores:

attB-Pl 5'-AGATCTGTCGACGATGTAGGTCACGGTCTCCGAAGC-S ' (SEQ ID NO: l l) y attB-P2 5 '-TTAATTAATTACCCTGTTATCCCTAGTCGACATGCCCGCCGTGA-S ' (SEQ ID

NO: 12),

utilizando como molde el plásmido pTA-attB (Groth, et al., 2000, Proc. Nati. Acad. Sd.

USA, 97: 5995-6000). El fragmento amplificado se subclonó en el vector específico para productos de PCR pGemT-Easy (Promega), siguiendo las recomendaciones del fabricante. El cebador attB-P2 incluye un Linker con la secuencia de reconocimiento para el enzima de restricción I-Scel de Saccharomyces cerevisiae.

El fragmento αtóMScel (316 pb) se liberó del vector pGemT-Easy mediante digestión con los enzimas de restricción Ncol y Pací y se subclonó en el plásmido pGemT/A6, digerido previamente con estos mismos enzimas. pGemT/A6 deriva de la amplificación por PCR de la región del genoma del adenovirus serotipo 5 comprendida entre las posiciones 1 y 190, con los cebadores:

ad63: 5 '-AGATCTAGGGATAACAGGGTAATCATCATCAATAATATACCTT-S ', (SEQ ID NO:13) y ad64: 5 -AGATCTCGGCGCACACCAAAAACGTC-3 ' (SEQ ID NO: 14),

y su clonaje en el vector pGemT-Easy. En la construcción resultante, pGemT/attB-A6, la diana de restricción para I-Scel queda insertada entre la región attB y la posición 1 del genoma del adenovirus.

2) Clonación de la región Ad(3528-4459) El inserto αtó?-ISceI-Ad(l-190), de 512 pb, se escindió mediante digestión con BgHl y se subclonó en el vector pRC/A4-A5. Este vector es producto de la amplificación de la secuencia del adenovirus comprendida entre las posiciones 3528 y 4459 con los cebadores: ad57 5 -AGATCTCGTGGCTTAAGGGTGGGAAA-3 ' (SEQ ID NO: 15), y ad58: 5 -TCTAGATTATATGGCTGGGAACATAGCC-3 ' (SEQ ID NO: 16). y su clonaje en el vector de expresión eucariota pRC/RSV (Invitrogen), el cual incluye, además del gen de resistencia a ampicilina, el gen de resistencia a neomicina para su selección en células de mamífero. Para la inserción de la secuencia Ad(3528-4459) en pRC/RSV, se incluyeron secuencias diana para BgHl y Xbal el extremo 5 ' de los cebadores ad57 y ad58, respectivamente. El inserto queda integrado entre las posiciones 13 y 701 del vector.

La construcción resultante de la ligación del fragmento αtó?-iSceI-Ad(l-190) al vector pRC/A4-A5 se denominó pRC/A6-A5. De este modo queda delecionada la región El del adenovirus y que se localizaría entre las posiciones 190 y 3528.

3) Clonación de la región Ad(34901-35938)

El extremo 3' del genoma adenoviral (posiciones 34901-35938) se amplificó con los cebadores:

ad59: 5 '-TCTAGATTAGCTATGCTAACCAGCGTAG-3 '(SEQ ID NO: 17), y ad65 : 5 '-GGTACCTAGGGATAACAGGGTAATCATCATCAATAATATACCTT-S '(SEQ

ID NO: 18).

En el extremo 5 ' del cebador ad65 se incluyó la secuencia diana para el enzima de restricción I-Scel (subrayado). Ambos cebadores incluyen en su extremo 5' las dianas de restricción para Xbal (ad59) y Kpnl (ad65). El fragmento de 1060 pb, producto de esta amplificación, se cortó con estos enzimas para facilitar su subclonaje "corriente abajo" de la región Ad(3528-4459) insertada en el vector pRC/A6-A5. La construcción resultante se denominó pRC/A6-A7.

4) Obtención del plásmido pRcAd2

El plásmido pRC/A6-A7 fue linealizado con Xbal y desfosforilado con Fosfatasa Alcalina siguiendo las recomendaciones del fabricante (Alkaline Phosphatase, CaIf Intestinal (CIP); New England Biolabs).

Simultáneamente, la digestión del plásmido pTG3602 (Chartier, et al, 1996, J. Virol, 70: 4805-4810) con Pací liberó una copia completa del genoma del adenovirus serotipo 5. Su recircularización se evitó mediante la desfosforilación de sus extremos con fosfatasa alcalina.

Tanto el vector linealizado pRC/A6-A7 como el inserto liberado del plásmido pTG3602 se utilizaron simultáneamente para transformar la cepa bacteriana electrocompetente de E. coli BJ5183 (BJ5I83 Electroporation competent cells; Stratagene). Estas células están diseñadas especialmente para promover procesos de recombinación entre secuencias homologas de un vector transferente, que contiene el gen de interés, y un vector que incluya el genoma adenoviral. En este caso las regiones homologas incluidas en ambos fragmentos de ADN (regiones Ad(3528-4459) y Ad(34901-35938)) favorece dicho proceso de recombinación cuya resolución conlleva la inserción del genoma adenoviral dentro del vector pRC/A6-A7 y a partir de la posición 4459 del virus (Fig. 5).

El proceso de electroporación se llevó a cabo, siguiendo las recomendaciones del fabricante, en un electroporador Gene Pulser (Biorad) y estableciendo los siguientes parámetros: voltaje: 2.5 kV; resistencia: 200 Ω; capacitancia: 25 μF; duración del pulso: 5 ms. Por último se añadió 1 mi de medio LB y la suspensión se incubó en agitación durante 1 hora a 37 0C. Seguidamente se prepararon diluciones seriadas de las células transformadas. Éstas se sembraron en placas de medio de cultivo suplementado con ampicilina (100 μg/ml) como antibiótico de selección para el plásmido pRC/A6-A7. La incubación se continuó a 37 0C hasta la aparición de clones resistentes.

El análisis de restricción con Hindlll confirmó la correcta inserción del genoma adeno viral en sólo uno de los clones obtenidos y que se denominó pRcAd2.

El plásmido pRcAd2 incluye el genoma completo del adenovirus, a excepción de la región localizada entre las posiciones 190 y 3528 y que corresponde a la región El. La secuencia se encuentra delimitada por dianas de restricción para I-Scel, y posee una secuencia attB en su extremo 5' (Fig. 5).

Ejemplo 3: Construcción y caracterización de líneas celulares estables para la producción y empaquetamiento de vectores adenovirales de alta capacidad

En la presente invención se ha propuesto la obtención de líneas celulares estables diseñadas para la producción y empaquetamiento de vectores adenovirales de alta capacidad. Estas células serán capaces de producir todos los componentes necesarios para la replicación, ensamblaje y funcionamiento del virus.

Debido a la citotoxicidad de niveles elevados de proteínas virales, un sistema de regulación transcripcional inducible por mifepristona controla la expresión de los genes EIa y EIb, los cuales a su vez dirigen la expresión y replicación del resto del genoma adenoviral. Este mismo sistema controla, a su vez, la producción de la endonucleasa de restricción I-Scel necesaria para la liberación del genoma adenoviral integrado en el genoma de la célula eucariota, lo que proporciona un segundo nivel de control de la transcripción. La inducción (y por tanto la producción de partículas virales) se inicia en el momento de la adición al medio de cultivo de mifepristona o su análogo RU486.

Al no ser necesaria la utilización de un virus helper durante el proceso de producción, el sistema desarrollado por los inventores permite la obtención de extractos virales sin la contaminación residual indeseable de partículas virales que contienen copias genómicas de dichos virus helper. En la presente realización se ha utilizado la línea celular humana de carcinoma de pulmón A549 para el diseño de un sistema de producción de vectores de alta capacidad independiente de helper. Esta línea celular iniciada por Giard et al. (1973, J. Nati. Cáncer Inst. , 51 : 1417-1423) y posteriormente caracterizada en profundidad por Lieber et al. (1976, Int. J. Cáncer., 17: 62-70), presenta una gran sensibilidad a la infección por adenovirus lo que le confiere un elevado potencial como línea de producción de virus

(Smith et al, 1986, J. Clin. Microbiol, 24: 265-268). Las células son fácilmente cultivables sin variaciones en su morfología y se mantienen viables entre 10 y 14 días sin mostrar señales importantes de degeneración.

Ejemplo 3.1 : Generación de líneas celulares mediante transfección del plásmido pRcAd2 para la integración estable del genoma adeno viral (polinucleótido B).

Para la obtención de una línea celular de empaquetamiento capaz de complementar la síntesis de proteínas virales implicadas en la replicación, formación de la cápside y empaquetamiento de adenovirus de alta capacidad, las células A549 se incubaron en placa de 10 cm2 a 37 0C, 5% CO2, hasta alcanzar una confluencia del 80%. Las células fueron co-transfectadas mediante lipofectamina con 3 μg de la construcción pRcAd2 (confiere resistencia a la Neomicina (neo1)) y 1 μg del plásmido pCMV-Int (Groth et al., 2000, Proc. Nati. Acad. Sd. USA, 97: 5995-6000), que codifica la integrasa del fago PhiC31 de Streptomyces y que promueve la integración estable del plásmido en el genoma de la célula (Fig. 6A).

El ADN de ambos plásmidos se diluyó previamente en 500 μl de medio sin suero OPTI- MEM (Gibco®: Invitrogen, Carlsbad CA92008, USA). Para favorecer la formación de los complejos entre el ADN y lípidos catiónicos se añadió el reactivo Plus Reagent (Invitrogen) en una relación 1 :0.75 (DNA: Plus Reagent). Tras 5 minutos de incubación a temperatura ambiente se añadieron 6 μl de Lipofectamina LTX (Invitrogen) y la mezcla se incubó de nuevo a temperatura ambiente durante 25 minutos. Seguidamente la dilución se añadió gota a gota sobre el medio de cultivo de las células: DMEM suplementado con suero fetal bovino 10% (Gibco®); L-Glutamina 1% (200 mM en NaCl 0.85%; Lonza Ibérica, 08006 Barcelona, España); y Penicilina/Estreptomicina 1% (10 mg/ml en NaCl 0.85%; Gibco®). Tras 4 horas de incubación a 37 0C, 5% CO2, el medio se sustituyó por medio DMEM fresco y se continuó la incubación otras 24 horas. Finalmente se retiró el medio y, tras un lavado con tampón fosfato salino IX (PBS) (Gibco®), las células transfectadas se levantaron con tripsina (Trypsin-EDTA; Gibco®) y se centrifugaron a 1250 rpm durante 5 minutos a temperatura ambiente. El precipitado de células se resuspendió en 6 mi de medio de cultivo y se repartió en tres placas de 60 cm2. Se añadió medio nuevo, en este caso suplementado con el antibiótico de selección G418, análogo de la Neomicina, a una concentración de 600 μg/ml. Cada dos días se procedió al cambio del medio de cultivo hasta la aparición de clones aislados resistentes al antibiótico (2-3 semanas). Los clones se levantaron con tripsina y se transfirieron a pocilios de 0.3 cm2 con medio de selección. La incubación se continuó hasta alcanzar el 80% de confluencia y seguidamente se transfirieron a pocilios de mayor superficie. Tras sucesivos pases se aisló un clon resistente a G418 que recibió el nombre de pRc-1. Para probar la estabilidad del clon las células se mantuvieron 4 meses en cultivo sin que se observaran cambios en su morfología o viabilidad.

Para confirmar la integración del plásmido pRcAd2 en el clon aislado, se extrajo el ADN genómico del clon pRc-1 con el sistema QIAmp DNA minikit (Qiagen) siguiendo las recomendaciones del fabricante. Este ADN se utilizó en ensayos de Nested-PCR para detectar la presencia de los genes adenovirales Illa, IV, el gen codificante de la proteasa y el gen que codifica la polimerasa viral. Los cebadores utilizados en esta detección fueron:

Gen Cebador Tm PCR SEQ ID NO:

Illa IHaI 5 -AGAGCCAGCCGTCCGGCCTTA-3 55 0C 19

IIIa2 5 -CGCGGTCGCCTGTGGGAGCCC-3 20

IIIa3 5 -GGTTGC ACT AAACGCCTTCC-3 ' 54 0C 21

IIIa4 5 -AGCCCCTGCAAGTTTTTGAA-3 ' 22

IV IVl 5 -CCTCT AGTT ACCTCCAATGGC-3 ' 45 0C 23

IV2 5 -AGT AACTTT AGTTTGCAAGGA-3 ' 24

IV3 5 -GGGCAACACACTCACCATGC-3 ' 55 0C 25

IV4 5 -ACATGCAAAGGAGCCCCGTA-3 ' 26 Proteasa PrI 5 -ACAGCTGCCGCCATGGGCTCC-3 ' 55 0C 27

Pr2 5 -GGGCGAGTGGCGCTCCAGGAA-3 ' 28

Pr3 5 -GCTTTTCTGACCAGCGACT-3 ' 51 0C 29

Pr4 5 -CACTGTGGCTGCGGAAGTAG-3 ' 30

Polimerasa POLI 5 -CTGGCCTGGACGCGAGCCTTT-3' 55 0C 31

POL2 5 -CAGGGTCCTCGTCAGCGTAGT-3 ' 32

POL3 5 -T ACGGGGAC ACGGAC AGCCTT-3 ' 60 0C 33

POL4 5 -CTTGGCGCGCAGCTTGCCCTT-3 ' 34

Las reacciones de PCR con los cebadores externos de Nested-PCR (cebadores 1 y 2) se llevaron a cabo en presencia de 1 U del enzima Taq polimerasa (BioTaq, Bioline), tampón de PCR (Bioline), MgCl2 1.5 mM, 0.4 mM de cada dNTP, 10 pmol de cada cebador, ADN y agua desionizada estéril hasta un volumen final de 50 μl. Las condiciones de amplificación fueron las siguientes: 1 ciclo de 2 minutos a 94 0C, 50 segundos a 94 0C de desnaturalización, 50 segundos de hibridación con el cebador (Tm según el gen a amplificar, ver tabla) y 50 segundos a 72 0C de elongación; 35 ciclos de 50 segundos a 94 0C de desnaturalización, 50 segundos de hibridación con el cebador (Tm según el gen a amplificar, ver tabla) y 50 segundos a 72 0C de elongación; 1 ciclo de 7 minutos a 72 0C de elongación final. Las reacciones de amplificación con los cebadores internos de Nested-PCR (cebadores 3 y 4) se llevaron a cabo a partir de 2 μl de las reacciones de PCR anteriores y en presencia de 1 U del enzima Taq polimerasa (BioTaq, Bioline), tampón de PCR (Bioline), MgCl2 2.5 mM, 0.4 mM de cada dNTP, 10 pmol de cada cebador, ADN y agua desionizada estéril hasta un volumen final de 50 μl. En este caso las condiciones de amplificación fueron: 35 ciclos de 50 segundos a 94 0C de desnaturalización, 50 segundos de hibridación con el cebador (Tm según el gen a amplificar, ver tabla) y 50 segundos a 72 0C de elongación; 1 ciclo de 7 minutos a 72 0C de elongación final.

La pérdida de la región attB también se comprobó mediante reacción de PCR utilizando los cebadores attB-Pl; attB-P2 (Ejemplo 2). Las reacciones de PCR se llevaron a cabo en presencia de 1 U del enzima Taq polimerasa (BioTaq, Bioline), tampón de PCR (Bioline), MgCl2 4 mM, 0.4 mM de cada dNTP, 10 pmol de cada cebador, ADN y agua desionizada estéril hasta un volumen final de 50 μl. Las condiciones de amplificación fueron las siguientes: 1 ciclo de desnaturalización de 4 minutos a 95 0C; 29 ciclos de 50 segundos a 94 0C de desnaturalización, 40 segundos a 50 0C de hibridación con el cebador y 40 segundos a 72 0C de elongación; 1 ciclo de 5 minutos a 72 0C de elongación final.

Para el análisis de los productos de amplificación las muestras se mezclaron con 1 ,5 μl de la solución de carga (azul de bromofenol 0.25% en agua destilada; Glicerol 40%; EDTA 100 mM) y se analizaron por electroforesis en geles de agarosa (1%) con tampón TAE IX (Tris Base 40 mM; ácido acético glacial 20 mM; EDTA 1 mM, pH 8.0) visualizando el ADN mediante tinción con bromuro de etidio (0.5 μg/ml).

Los resultados obtenidos (Fig. 6B) confirman la correcta integración del polinucleótido B en el genoma de la célula eucariota A549. La pérdida de la región attB confirma, además, que dicha integración ha sido mediada específica y unidireccionalmente por la integrasa PhiC31.

A continuación, y para determinar la expresión de los genes del adenovirus, el clon pRc-1 se incubó en placa de 20 cm2 a 37 0C, 5% CO2, hasta alcanzar una confluencia del 80%. En este momento las células fueron transfectadas con una dilución de 5 μg de la construcción pGal4-2RU-SceI-El, Plus Reagent (1 :0.75) y 12 μl Lipofectamina LTX, siguiendo el procedimiento descrito anteriormente. Las transfecciones se llevaron a cabo por duplicado incubando una de las placas en presencia del inductor RU486 a una concentración de 10"8M. Tras 48 horas de incubación las células se usaron con 1 mi de TRIZOL (Invitrogen) para proceder a la extracción del RNA total siguiendo las recomendaciones del fabricante. Este RNA fue utilizado para ensayos de retrotranscripción (RT)-PCR con cebadores específicos para los genes adenovirales

Gen Cebador Secuencia SEQ ID NO:

IVa2 PRCl 5 -TGATCCAGTCGTAGCAGGAG-3 ' 35

PRC4 5 -ACGATCTCATCCTGGAACAC-3 ' 36

III III 1 5 -GCCAGTGGCGGCGGCGCTGGG-3 ' 37

III2 5 -CCGATGTCGCTTTCCAGAACC-3 ' 38 E4 E4-1 5 -CGTGCGAGGTCTTCCCTGCAG-3 ' 39

E4-2 5 -CT AC ATGGGGGT AGAGTCAT A-3 ' 40

Para estos ensayos previamente se trató 1 μg de RNA con 1 unidad de DNasa (DNasal amplification grade; Invitrogen) en tampón de reacción (Tris-HCl 20 mM, pH 8.4; MgCl2 2 mM; KCl 50 mM) y a un volumen final de 10 μl. La reacción se incubó a temperatura ambiente durante 15 minutos y la DNasa se inactivo añadiendo 1 μl de solución EDTA 25 mM, e incubando a 65 0C durante 10 min. En la reacción de síntesis del cDNA se emplearon 625 ng de este RNA libre de ADN. La reacción de reverso- transcripción se inició mezclando la muestra con 10 pmol del cebador específico, 1 μl de dNTPs (10 mM) y agua hasta un volumen final de 13 μl. Tras incubar a 65 0C durante 5 minutos, la mezcla se enfrió en hielo y se añadieron 2 μl de DTT 0.1 M y 4 μl de tampón de reacción (Tris-HCl 250 mM, pH 8.3; KCl 375 mM; MgCl2 15 mM). Finalmente tras una nueva incubación a 37 0C durante 2 minutos se añadieron 200 U de M-MLV Reverse-Transcriptase (Invitrogen) y se continuó la incubación a 37 0C durante 50 min. Seguidamente el cDNA resultante se utilizó como molde en reacciones de PCR con objeto de amplificar el producto de la transcripción de los genes bajo estudio. Como control negativo y para comprobar la ausencia de contaminación por ADN genómico, en todos los casos, se incluyó una reacción de amplificación utilizando como molde el RNA tratado con la DNasa. Las condiciones de amplificación utilizadas para las reacciones de PCR con el ADNc obtenido de la reacción de reverso-transcripción fueron las mismas que las empleadas en las reacciones de amplificación del ADN genómico.

Los resultados de estos ensayos, mostrados en la Figura 7, confirman la capacidad de transcripción de los genes adenovirales integrados de manera estable en el cromosoma de la célula eucariota.

Finalmente, para confirmar la capacidad de las células de producir proteínas virales a partir del mRNA viral, se ensayó la detección de proteínas de la cápside viral mediante ensayos de inmunocitoquímica. Para inducir la síntesis de proteínas, el clon pRc-1 se transfectó previamente con la construcción pGal4-2RU-SceI-El. Las transfecciones se hicieron por duplicado para obtener células transfectadas e incubadas en presencia y ausencia del inductor RU486. Tras 24 horas de incubación, las células se levantaron con tripsina y 8x104 células se transfirieron a un portaobjeto de cultivo de cuatro celdas (BD Falcon Cultureslide; BD Biosciences, Erembodegem 9320, Bélgica), añadiendo nuevo medio de cultivo con y sin inductor RU486. Al día siguiente se retiró el medio y las células se lavaron con PBS. Seguidamente se procedió a su fijación con una solución Acetona:Metanol (1 :1) previamente enfriada a -20 0C. La solución de fijado se dejó evaporar a temperatura ambiente (30 minutos) y los portaobjetos se sumergieron en PBS IX. Tras 3 lavados de 3 minutos en PBS se procedió a la hibridación con el anticuerpo primario (Mouse anti-adenovirus monoclonal antibody blend; Millipore Ibérica, 28050 Madrid, España) diluido previamente en PBS (1 :75). Dicha hibridación se llevó a cabo durante toda la noche a 4 0C, en oscuridad y cámara húmeda. Al día siguiente el exceso de anticuerpo se lavó en PBS (3 lavados de 3 minutos) y se procedió a la hibridación con el anticuerpo secundario (Immunopure goat anti-mouse IgG- Peroxidase; Pierce Biotechnology, Rockford IL61105, USA) diluido también en PBS (1 :400). La hibridación se incubó 45 minutos a temperatura ambiente y en oscuridad. De nuevo, las muestras se lavaron 3 veces en PBS IX y se procedió al revelado con el cromógeno DAB (DakoCytomation Liquid DAB Substrate Chromogen System; Dako Diagnósticos, Sant Just Desvern E-08960, Barcelona, España) siguiendo las recomendaciones del fabricante. Las muestras se contratiñeron con Hematoxilina de Mayer (5 segundos) para la tinción específica de núcleos y, tras un lavado de 15 minutos en agua, las muestras se deshidrataron sumergiéndolas 1 minuto en alcohol al 70%, 96% y 100%, y 10 minutos en Xileno.

La coloración marrón detectada en las muestra confirma la síntesis de proteínas de la cápside viral. Aunque se detecta una ligera producción basal de estas proteínas en la muestra sin inductor, los resultados de la inmunocitoquímica revelan una clara diferencia con respecto a los niveles de expresión de las proteínas virales en presencia del inductor RU486, confirmando que el sistema de regulación por mifepristona funciona en el control de la expresión de los genes virales integrados en el genoma del clon pRc-1. Ejemplo 3.2: Transfección de células A549 con el plásmido pGa!4-2RUSceI-El (polinucleótido A) para la generación de líneas celulares estables que integran la región El y el gen I-SceL ambos bajo control del sistema de regulación transcripcional inducible por mifepristona.

En una segunda realización, se diseñó una línea celular estable en la que se ha integrado el polinucleótido A2, según se define en la invención (Fig. IA). Así, la línea celular originada cuenta con los genes necesarios para el inicio y control de la expresión de los genes adenovirales incluidos en el polinucleótido B. A su vez, estos genes, como son el gen que codifica la endonucleasa de restricción I-Scel y la región adeno viral El que codifica, a su vez, las proteínas ElA y ElB, se encuentran bajo el control de promotores regulados por mifepristona. El propio factor de regulación GAL4-hPR-p65 está incluido en el polinucleótido A2 y, por tanto, se integrará de manera simultánea en el genoma celular. Dicho trans activador será expresado de manera constitutiva por las células modificadas.

Para la obtención de esta línea celular se incubaron células A549 en placa de 10 cm2 a 37 0C, 5% CO2, hasta alcanzar una confluencia del 80%. Las células se transfectaron por el método de la lipofectamina con la construcción pGal4-2RUSceI-El (gen de resistencia a la Zeomicina (zeo1)) y siguiendo el procedimiento descrito en el apartado 3.1 para la obtención del clon pRc-1. Las células se incubaron en medio DMEM suplementado con suero fetal bovino 10%, L-GIu 1 % y P/S 1 % y el antibiótico Zeomicina a una concentración de 400 μg/ml. Tras sucesivos pases de amplificación se aisló un clon resistente al antibiótico que recibió el nombre de Gal-13. Del mismo modo que para el clon pRc-1, la estabilidad del clon Gal-13 se testó mediante su mantenimiento en cultivo durante un período superior a los 4 meses y más de 35 pases sucesivos.

Ensayos de PCR a partir del ADN genómico de la célula confirmaron la presencia de los genes adenovirales EIa y EIb, del gen codificante de la endonucleasa I-Scel y del gen que codifica la proteína de fusión GAL4- hPR-p65 reguladora de la transcripción e inducible por mifepristona. Los cebadores utilizados fueron: Gen Cebador Secuencia SEQ ID NO:

EIa RT-EAl 5 -T ATCTGCC ACGGAGGTGTTAT-3 ' 41

RT-EA2 5 -TAGACAAACATGCCACAGGTC-3 ' 42

EIb RT-EB3 5 -GCTTGGGAGTGTTTGGAAGAT-3 ' 43

RT-EB4 5 '-CTGCTCCTCCGTCGGT ATT AT-3 ' 44

Scel SceI-3 5 -CCATACGATGTTCCTGACTA-3 ' 45

SceI-4 5 -CCCTT AACCAGGT ATTCT ACT-3' 46

GAL4- hPR-p65 GaI-I 5 -CTGACTAGGGC AC ATCTGAC A-3 ' 47

Gal-2 5 -TTGATGAGCTCTCTAATGTAG-3 ' 48

El ADN genómico de las células se extrajo con el sistema QIAmp DNA minikit (Qiagen) siguiendo las recomendaciones del fabricante y las reacciones de PCR se llevaron a cabo en presencia de 1 U del enzima Taq polimerasa (BioTaq, Bioline), tampón de PCR (Bioline), MgCl2 4 mM, 0.4 mM de cada dNTP, 10 pmol de cada cebador, ADN y agua desionizada estéril hasta un volumen final de 50 μl. Las condiciones de amplificación fueron las siguientes: 1 ciclo de desnaturalización de 4 minutos a 95 0C; 29 ciclos de 50 segundos a 94 0C de desnaturalización, 40 segundos a 50 0C de hibridación con el cebador y 40 segundos a 72 0C de elongación; 1 ciclo de 5 minutos a 72 0C de elongación final. Para el análisis de los productos de amplificación las muestras se mezclaron con 1.5 μl de la solución de carga (azul de bromofenol 0.25% en agua destilada; Glicerol 40%; EDTA 100 mM) y se analizaron por electro foresis en geles de agarosa (1%) con tampón TAE IX (Tris Base 40 mM; ácido acético glacial 20 mM; EDTA 1 mM, pH 8.0) visualizando el ADN mediante tinción con bromuro de etidio (0.5 μg/ml). Los resultados de amplificación confirmaron la correcta integración de los genes incluidos en el polinucleótido A2 dentro del genoma de la línea A549 (Fig. 8).

Seguidamente, para comprobar la capacidad de regulación de la expresión génica del sistema inducible por mifepristona se analizó, por Western blot, la síntesis de las proteínas E lA y I-Scel partiendo de muestras de proteínas obtenidas de cultivos incubados en presencia y ausencia del inductor RU486 a una concentración de 10"8M. Los extractos proteicos se purificaron en 500 μl de Passive Ly sis Buffer IX (Promega) y los niveles de proteína total fueron determinados usando la técnica de Bradford para cuantificación de proteínas (Bradford, 1976, Anal. Biochem., 72 : 248-254). Las muestras se analizaron por electro foresis en gel discontinuo de poliacrilamida-SDS y tampón de electroforesis Laemli (Tris-HCl 25 mM; Glicina 192 mM; SDS 0.1% p/v). El gel separador estaba compuesto por poliacrilamida al 12% en tampón Tris-HCl 0.39 M (pH 8.8) con SDS al 0.1%. Como catalizadores se utilizaron PSA al 0.1% y TEMED al 0.04%. Por su parte el gel de concentración estaba compuesto por poliacrilamida al 5% en Tris-HCl 0.125 M (pH6.8) con SDS al 0.1%, PSA 0.1% y TEMED al 0.01%. Las muestras se transfirieron a membrana Hybond-P (GE Healthcare Europe) en tampón de transferencia (Tris-Base 0.3%; Glicina 186 mM; Metanol 20%) durante 2 horas a 4 0C. Seguidamente se procedió al bloqueo de la membrana en solución de leche 5% en PBS+Tween (0.05%) a 4 0C durante toda la noche. La hibridación con el anticuerpo primario se llevó a cabo en solución de leche 1% + PBS-T ween durante 1.5 horas a temperatura ambiente. El exceso de anticuerpo se eliminó con 3 lavados de 10 minutos en PBS-Tween. La hibridación con el anticuerpo secundario se realizó en leche 1% + PBS-Tween durante 30 minutos a temperatura ambiente. En la detección de la proteína ElA se empleó el anticuerpo Anti-adenovirus2 ElA (Mouse) (1 :500) (Calbiochem®: EMD, La Jolla CA92039-2087, USA) y como anticuerpo secundario el Immunopure goat anti-mouse IgG-Peroxidase (1 :5000) (Pierce Biotechnology). En el caso de la proteína I-Scel se empleó como único anticuerpo el Anti-H A-Per oxidase High affinity (1 :500) (Roche Diagnostics, 08174 Barcelona, España). Tras 3 lavados de la membrana en PBS-Tween durante 10 minutos, se procedió al revelado. Para ello se empleó el sistema Western lightning chemiluminescence reagent (Perkin-Elmer, 28760 Madrid, España) siguiendo las recomendaciones del fabricante. Los resultados obtenidos se muestran en la figura 9 y demuestran la correcta producción de las proteínas analizadas, así como un incremento en los niveles de expresión de estas proteínas en presencia del inductor. Sin embargo hay que tener en cuenta que, en ausencia de inductor, existe una expresión basal de las proteínas sometidas a regulación. Ejemplo 3.3: Generación de líneas celulares estables mediante doble transfección de células A549 con los plásmidos pGa!4-2RUSceI-El (polinucleótido A) y pRcAd2 (polinucleótido B).

Para obtener una única línea celular con todos los genes necesarios en la producción de partículas virales, el clon resistente a Zeomicina Gal- 13 (ejemplo 3.2) se co-transfectó con la construcción pRcAd2 (neo1), que incluye el resto de genes del adenovirus, y el plásmido pCMV-Int que codifica la integrasa PhiC31. Las condiciones de transfección fueron las mismas que las empleadas en la obtención del clon Gal- 13 y la selección se hizo en presencia de los antibióticos G418 (600 μg/ml) y Zeomicina (400 μg/ml). De esta selección resultó el aislamiento de dos clones doblemente resistentes (zeor+neor) y que se denominaron GAd-I y GAd-6 respectivamente. Las características morfológicas de ambos clones difieren enormemente de la línea parental A549 y su derivado Gal-13. Los nuevos clones transfectantes tienden a una forma esférica y son de menor tamaño. Este cambio morfológico posiblemente sea debido a la transcripción basal de los genes El detectada anteriormente en el clon Gal-13, lo que conlleva la transcripción del resto de genes adenovirales clonados en el plásmido pRcAd2 e insertados en el genoma de la célula. Sin embargo los niveles de proteínas virales no afectan de manera significativa a la estabilidad y viabilidad de las células, tal y como se ha comprobado tras su mantenimiento en cultivo durante un periodo superior a los 4 meses.

Para confirmar la integración del plásmido pRcAd2 en los clones GAd-I y GAd-6, se extrajo el ADN genómico con el sistema QIAmp DNA minikit (Qiagen) siguiendo las recomendaciones del fabricante. Este ADN se utilizó en ensayos de Nested-PCR para detectar la presencia de los genes adenovirales Illa, IV, el gen codificante de la proteasa y el gen que codifica la polimerasa viral. Los cebadores utilizados en esta detección fueron los mismos que los empleados en el apartado 3.1. Del mismo modo, las reacciones de amplificación se llevaron a cabo en las mismas condiciones que las descritas en el apartado 3.1.

Los productos de amplificación se analizaron por electro foresis en geles de agarosa (1%) con tampón TAE IX (Tris Base 40 mM; ácido acético glacial 20 mM; EDTA 1 mM, pH 8.0) y visualizando el ADN mediante tinción con bromuro de etidio (0.5 μg/ml) (Fig. 10).

Para confirmar la síntesis de proteínas virales se diseñaron ensayos de inmunocitoquímica contra proteínas de la cápside viral. En este caso los clones GAdI y

GAd6 se incubaron durante 48 horas tanto en presencia como en ausencia del inductor

RU486 a una concentración 10"8M. Seguidamente se transfirieron 6x104 células a un portaobjeto de cultivo de cuatro celdas (BD Falcon Cultureslide; BD) y se procedió de igual modo que en el caso del clon pRc-1 (ejemplo 3.1). Como anticuerpo primario se utilizó el anticuerpo Mouse anti-adenovirus monoclonal antibody blend (Millipore) diluido en PBS (1 :75) y como anticuerpo secundario el anticuerpo Immunopure goat anti-mouse IgG-P er oxidase (Pierce Biotechnology) también diluido en PBS (1 :400).

La detección de coloración marrón en las células confirma la síntesis de proteínas de la cápside viral. Sin embargo, no se detectan diferencias claras entre las muestras incubadas en presencia del inductor RU486 y en ausencia del mismo. Por tanto, la expresión basal de las proteínas E l , la cual escapa al control del regulador transcripcional GAL4-hPR-p65, es suficiente para iniciar la expresión del resto de genes adenovirales integrados en el genoma de la célula.

Ejemplo 4: Producción y empaquetamiento de partículas infectivas del virus gutless KCZ.

Ejemplo 4.1 : Producción y empaquetamiento del virus KCZ en la línea empaquetadora pRc-1 mediante sistema de co-transfección con dos plásmidos. En el presente ejemplo, el clon seleccionado de la línea celular generada en el ejemplo 3.1 se utilizó para la producción y empaquetamiento de adeno virus de alta capacidad o adenovirus gutless. Este sistema de producción permite la obtención de extractos virales de adenovirus de alta capacidad sin necesidad de la utilización de un virus helper como complemento de los genes delecionados en el plásmido pRcAd2 e integrado de manera estable en el cromosoma de la célula eucariota. Para compensar la deficiencia de la región El, el sistema requiere la transfección de la línea celular, en cada uno de los pasos de producción, con el plásmido pGal4-2RU-SceI- El . Este plásmido de complementación expresa los genes EIa y EIb a partir del promotor inducible regulado por mifepristona (Fig. IA), lo que iniciará la expresión del resto de los genes adenovirales. Además, la replicación del genoma viral integrado sólo será posible en el momento de la expresión de la endonucleasa de restricción I-Scel, incluida en el plásmido p Gal4-2RU-SceI-El y también controlada a nivel transcripcional por el regulador GAL4-hPR-p65. La liberación del genoma viral y el inicio de su replicación permitirán la obtención de múltiples copias del mismo y, por tanto, suficientes niveles de proteínas virales para la encapsidación del adeno virus de alta capacidad y su purificación en un alto título.

Para determinar la capacidad del sistema de producir partículas infectivas, se incubaron 8xlO5 células del clon pRc-1, en placa de 20 cm2 a 37 0C, 5% CO2, hasta alcanzar una confluencia del 80%. Seguidamente las células se co-transfectaron con 5 μg del plásmido pGal4-2RU-SceI-El y 12 μg del vector gutless KCZ, digerido con el enzima de restricción Pmel para eliminar el origen de replicación, el gen de resistencia a la ampicilina y dejar los extremos ITR del vector libres. Como gen reportero, el vector KCZ lleva el gen de la β-galactosidasa bacteriana (lacZ).

En la co-transfección se empleó la lipofectamina como sistema de internalización del ADN en la célula eucariota. Así, el ADN de ambos plásmidos se diluyó previamente en 1 mi de medio sin suero OPTI-MEM (Gibco®). Para favorecer la formación de los complejos entre el ADN y lípidos catiónicos se añadió el reactivo Plus Reagent (Invitrogen) en una relación 1 :0.75. Tras 5 minutos de incubación a temperatura ambiente se añadieron 12 μl de Lipofectamina LTX (Invitrogen) y la mezcla se incubó de nuevo a temperatura ambiente durante 25 minutos. Seguidamente la dilución se añadió gota a gota sobre el medio de cultivo de las células (DMEM suplementado con suero fetal bovino 10%). Tras 4 horas de incubación a 37 0C, 5% CO2, el medio se sustituyó por medio DMEM fresco suplementado con suero fetal bovino 2% e inductor RU486 a una concentración 10"8M. Al no tener un efecto citopático claro, las células se incubaron entre 48 y 120 horas y, posteriormente, se recogieron a distintos tiempos en su propio medio. Tras una centrifugación a 1250 rpm durante 5 minutos, el precipitado se resuspendió en 200 μl de Tris-HCl 0.1M (pH 8.0) y las células fueron Usadas mediante tres ciclos de congelación/descongelación. Los restos celulares se centrifugaron y el título del sobrenadante se determinó por tinción X-gal de células 293 S infectadas con las preparaciones del vector KCZ. Para ello, las células 293S se crecieron en pocilios de 2 cm2 hasta alcanzar una confluencia del 80% en medio DMEM suplementado con suero fetal bovino 2% y Na-Piruvato 1%. Seguidamente, el medio de cultivo se retiró y las células se infectaron con diluciones seriadas del extracto viral en DMEM + FBS 2% + Na-Piruvato 1%. Tras una incubación de 4 horas a 37 0C, 5% CO2, se añadió medio fresco y se continuó la incubación otras 48 horas. Finalmente las células se fijaron con una solución de glutaraldehido 0.5% en PBS durante 10 minutos y a temperatura ambiente, se lavaron 3 veces en PBS y se tiñeron 4 horas a 37 0C con 1 mg/ml de X-gal (5-bromo-4-cloro-3-indolil-β-galactopiranósido) en PBS suplementado con MgCl2 2OmM, K3Fe(CN6) 5mM y K4Fe(CN6) 5mM.

Según los resultados obtenidos, utilizando como línea de producción y empaquetamiento el clon pRc-1, la producción a Pase 0 alcanza sus niveles máximos a las 48-72 horas y están en torno a 7x105 unidades infectivas (ui)/ml (Fig. 11). En los sucesivos pases de amplificación, estos extractos se utilizarán para la infección de nuevas células pRc-1, previamente transfectadas con el plásmido pGal4-2RU-SceI-El. El sistema descrito permite, por tanto, la recuperación de extractos de adenovirus de alta capacidad libres de partículas infectivas derivadas de un virus helper, así como su obtención a altos niveles de producción.

Ejemplo 4.2: Producción y empaquetamiento del virus KCZ en células de los clones GAd-I y GAd-6. Sistema de transfección única con el vector de alta capacidad. El sistema de producción descrito a continuación utiliza como célula empaquetadora una línea modificada en la que se ha integrado de manera estable los polinucleótidos A2 y B, descritos en la invención (Fig. IA, IB). Salvo el polinucleótido correspondiente al vector adenoviral de alta capacidad, esta línea celular no requiere ningún elemento adicional (plásmido o virus helper) para la producción de partículas virales con capacidad infectiva.

El sistema integra los genes adenovirales necesarios para la encapsidación y replicación del adenovirus de alta capacidad (polinucleótido B), así como los genes de la región El y la endonucleasa de restricción I-Scel (polinucleótido A2), necesarios para la expresión controlada y a altos niveles de las proteínas virales anteriores, en una única célula.

Finalmente, el inicio del proceso de producción está regulado mediante la expresión de los genes de la región E l y la endonucleasa de restricción a partir de sus correspondientes promotores inducibles y el activador transcripcional GAL4-hPR-p65.

En el presente ej emplo de producción de partículas infectivas, las líneas empaquetadoras GAd-6 y GAd-I se transfectaron con 12 μg del vector gutless KCZ que codifica el gen reportero de la β-galactosidasa y que se ha linearizado previamente con el enzima de restricción Pmel, tal y como se indica en el ejemplo 4.1. La transfección con el vector de alta capacidad se llevó a cabo siguiendo el procedimiento descrito en el sistema de producción con la línea empaquetadora pRc-1 (ejemplo 4.1).

Las células se incubaron entre 48 y 120 horas en medio DMEM suplementado con suero fetal bovino 2% y en presencia del inductor RU486 a una concentración 10"8M.

Las células se recogieron a distintos tiempos, se centrifugaron a 1250 rpm durante 5 minutos y, finalmente, se resuspendieron en 200 μl de Tris-HCl 0.1M. Tras su lisis con tres ciclos de congelación/descongelación, los restos celulares se centrifugaron y el sobrenadante se tituló en la línea celular 293 S siguiendo el protocolo descrito en el ejemplo anterior.

Utilizando como línea de producción y empaquetamiento el clon GAd-I, los niveles de producción a Pase 0 fueron de hasta 1,7x106 unidades infectivas (ui/ml), mientras que para el clon GAd-6 se obtuvo una titulación de 3xlO6 ui/ml (Fig. 12).

Igual que en el ejemplo anterior, estos extractos se utilizarán para la infección de nuevas células empaquetadoras durante los sucesivos pases de amplificación. El sistema descrito en la presente realización se diferencia del sistema anterior de co-transfección con dos plásmidos (ejemplo 4.1) u otros sistemas de producción dependientes de helper, en la eliminación del proceso de transfección/infección de las células empaquetadoras en cada uno de los pasos de amplificación del virus. Esta característica reduce significativamente el tiempo de producción e incrementa el rendimiento de la misma. La otra gran ventaja es la ausencia de contaminaciones con virus helper, lo que simplifica el proceso de purificación del virus y permite la obtención de cantidades suficientes para su utilización en procedimientos de terapia génica en humanos.

REIVINDICACIONES

1. Un polinucleótido o un vector de expresión que comprende:

(a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional;

(b) un segundo cásete de expresión que comprende a secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional codificado por el polinucleótido definido en (a).

2. Polinucleótido o vector de expresión según cualquiera de las reivindicación 1 donde el regulador transcripcional codificado por el cásete (a) es un regulador transcripcional activable.

3. Polinucleótido o vector de expresión según la reivindicación 2 donde el regulador transcripcional activable (a) está formado por el dominio de unión a ADN de GAL4, el dominio de unión a ligando del receptor humano de progesterona y por el dominio de activación de NF-kappaB p65.

4. Polinucleótido o vector de expresión según cualquiera de las reivindicaciones 1 a 3 donde la endonucleasa de restricción codificada por el cásete (b) es I-Scel.

5. Un polinucleótido o vector de expresión que comprende: (a) un primer cásete de expresión que comprende una secuencia nucleotídica que codifica un regulador transcripcional;

(b) un segundo cásete de expresión que comprende a secuencia nucleotídica que codifica una endonucleasa de restricción, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a) y

(c) un tercer cásete de expresión que comprende una secuencia nucleotídica que codifica la proteína adenoviral seleccionada ElA o las proteínas adenovirales ElA y ElB, y que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a).

6. Polinucleótido o vector de expresión según la reivindicación 5 dónde el segundo y tercer cásete se transcriben en sentido contrario.

7. Polinucleótido o vector de expresión según la reivindicación 6 dónde la secuencia reguladora de la transcripción que controla el segundo y tercer cásete comparten el mismo sitio de unión para el regulador transcripcional (a).

8. Polinucleótido o vector de expresión según cualquiera de las reivindicaciones 5 a 7 donde el regulador transcripcional codificado por el cásete (a) es un regulador transcripcional activable.

9. Polinucleótido o vector de expresión según la reivindicación 8 donde el regulador transcripcional activable (a) está formado por el dominio de unión a ADN de GAL4, el dominio de unión a ligando del receptor humano de progesterona y por el dominio de activación de NF-kappaB p65.

10. Polinucleótido o vector de expresión según cualquiera de las reivindicaciones 5 a 9 donde la endonucleasa de restricción codificada por el segundo cásete (b) es I- Scel.

11. Un polinucleótido o vector de expresión que comprende una secuencia nucleotídica que comprende el genoma de un adenovirus recombinante que carece de, al menos, la secuencia ψ de empaquetamiento y la secuencia que codifica la proteína ElA o E1A/E1B, en donde dicha secuencia que comprende el genoma de un adenovirus recombinante se encuentra flanqueada por secuencias de reconocimiento específico para una endonucleasa de restricción.

12. Polinucleótido o vector de expresión según la reivindicación 11 que comprende además una secuencia nucleotídica de reconocimiento específico para una integrasa, donde la secuencia de reconocimiento para la integrasa se encuentra en posición 5 ' respecto de la primera secuencia de reconocimiento para la endonucleasa de restricción.

13. Polinucleótido o vector de expresión según la reivindicaciones 12 en donde la secuencia nucleotídica de reconocimiento para la integrasa es attB, específica para la integrasa PhiC31.

14. Polinucleótido o vector de expresión según cualquiera de las reivindicaciones l i a 13 en donde las secuencias nucleotídicas de reconocimiento para la endonucleasa son específicas para la endonucleasa I-Scel.

15. Una célula hospedadora que comprende un polinucleótido o vector de expresión según cualquiera de las reivindicaciones 1 a 4.

16. Una célula hospedadora según la reivindicación 15 que comprende, adicionalmente, una secuencia que codifica la proteína adeno viral ElA y, opcionalmente, una secuencia que codifica la proteína adeno viral ElB.

17. Una célula hospedadora que comprende un polinucleótido o vector de expresión según cualquiera de las reivindicaciones 5 a 10.

18. Una célula hospedadora según la reivindicación 15 a 17 que comprende, adicionalmente, un polinucleótido o vector de expresión según cualquiera de las reivindicaciones 11 a 14 o que es obtenible mediante integración en una célula hospedadora según cualquiera de las reivindicaciones 15 a 17, de un polinucleótido según la reivindicaciones 11 a 14.

19. Una célula según la reivindicación 18 en donde las dianas de restricción que flanquean el genoma viral derivadas del polinucleótido o vector de expresión según cualquiera de las reivindicaciones 11 a 14 son reconocidas de forma específica por la endonucleasa de restricción que se encuentra bajo control operativo de una secuencia reguladora de la transcripción activable por el regulador transcripcional (a) derivado del polinucleótido según cualquiera de las reivindicaciones 1 a 10.

20. Un método para la producción de células adecuadas para la producción y empaquetamiento de partículas infectivas de un adenovirus de alta capacidad que comprende (i) transfectar una célula con un primer polinucleótido según cualquiera de las reivindicaciones 1 a 4 o con un vector que comprende dicho polinucleótido, o con un polinucleótido según cualquiera de las reivindicaciones 5 a 10 o con un vector que comprende dicho polinucleótido y (ii) transfectar dicha célula con un polinucleótido según cualquiera de las reivindicaciones 1 1 a 14 o con un vector que comprende dicho polinucleótido en donde las etapas (i) y (ii) pueden llevarse a cabo en cualquier orden o de forma simultánea y en donde si las células se transfectan en la etapa (i) con un polinucleótido según cualquiera de las reivindicaciones 1 a 4, entonces se utilizan células que comprenden la secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB.

21. Método según la reivindicación 20 en donde las etapas (i) y/o (ii) incluyen una etapa adicional de selección en la que se seleccionan células que han integrado de forma estable el primer y/o el segundo polinucleótido en base a marcadores de selección presentes en los polinucleótidos utilizados en las etapas (i) y (ii).

22. Método según la reivindicación 20 ó 21 en donde el polinucleótido según cualquiera de las reivindicaciones 11 a 14 comprende adicionalmente una secuencia nucleotídica de reconocimiento específico para una integrasa y en donde la transfección realizada en la etapa (ii) incluye, adicionalmente, un polinucleótido que codifica una integrasa específica para dichas secuencias de reconocimiento.

23. Método según la reivindicación 22 en donde la integrasa específica es la integrasa del fago PhiC31 de Streptomyces y en donde el sitio de reconocimiento específico es un sitio attB.

24. Célula obtenible mediante un método según cualquiera de las reivindicaciones 20 a 23.

25. Un sistema para la producción de adenovirus de alta capacidad que comprende

(a) una célula según cualquiera de las reivindicaciones 15 a l9 y 24 y

(b) un adenovirus de alta capacidad.

26. Método para la producción de vectores adenovirales de alta capacidad, que comprende las etapas de:

(a) transfectar o infectar una célula hospedadora con un polinucleótido que comprende el genoma del adenovirus de alta capacidad que se desea producir o con un vector de expresión que comprende dicho polinucleótido,

(b) cultivar las células transfectadas/infectadas en condiciones que permitan la replicación y empaquetamiento del adenovirus de alta capacidad,

(c) recuperar las partículas virales del adenovirus de alta capacidad y, opcionalmente, (d) repetir las etapas (a) a (c) en donde las partículas virales de alta capacidad obtenidas en la etapa (c) se utilizan para infección en la etapa (a) del siguiente ciclo, en donde la célula hospedadora usada en la etapa (a) se selecciona del grupo de

(i) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 1 a 4 y la secuencia que codifica la proteína adenoviral

ElA y, opcionalmente, la proteína adenoviral ElB, en cuyo caso la etapa

(a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un polinucleótido según las reivindicaciones 11 a 14 y/o un vector de expresión que comprende dicho polinucleótido, (ii) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 5 a 10, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un polinucleótido según las reivindicaciones 11 a 14 y/o un vector de expresión que comprende dicho polinucleótido, (iii) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 11 a 14, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un polinucleótido según las reivindicaciones 1 a 4 y en donde la célula comprende una secuencia que codifica la proteína adeno viral ElA y, opcionalmente, la proteína adenoviral ElB,

(iv) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 11 a 14, en cuyo caso la etapa (a) va precedida de o se lleva a cabo simultáneamente con una etapa de transfección con un polinucleótido según las reivindicaciones 5 a 10 y/o un vector de expresión que comprende dicho polinucleótido,

(v) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 1 a 4, un polinucleótido según las reivindicaciones l i a

14 y una secuencia que codifica la proteína adenoviral ElA y, opcionalmente, la proteína adenoviral ElB, y (vi) una célula que comprende un polinucleótido según cualquiera de las reivindicaciones 5 a 10 y un polinucleótido según cualquiera de las reivindicaciones 11 a 14.

27. Método según la reivindicación 26, donde el cultivo de la etapa (b) se realiza en presencia de un agente inductor específico del regulador transcripcional codificado por la secuencia nucleotídica comprendida en el polinucleótido según las reivindicaciones I a 4 y 5 a lθ.

28. Método según las reivindicación 27 en donde el regulador transcripcional está formado por el dominio de unión a ADN de GAL4, el dominio de unión a ligando del receptor humano de progesterona y por el dominio de activación de NF- kappaB p65 y donde el agente inductor es una antiprogestina sintética, preferiblemente mifepristona.

Download Citation


Feedback