Generation Of Psa-only Producing Mutant Strain

  *US20130121966A1*
  US20130121966A1                                 
(19)United States 
(12)Patent Application Publication(10)Pub. No.: US 2013/0121966 A1
 Mazmanian et al.(43)Pub. Date:May  16, 2013

(54)Generation of PSA-only producing mutant strain 
    
(75)Inventors: Sarkis K. Mazmanian,  Porter Ranch, CA (US); 
  Sung-Eun Lee,  Los Angeles, CA (US); 
  Dennis L. Kasper,  Charlestown, MA (US) 
(73)Assignees:The Brigham and Women's Hospital, Inc.,  Boston, MA (US), Type: US Company;
California Institute of Technology,  Pasadena, CA (US), Type: US Company
 
(21)Appl. No.: 13/573,695 
(22)Filed: Oct.  3, 2012 
 Related U.S. Application Data 
(60)Provisional application No. 61/542,549, filed on Oct.  3, 2011.
 
 Publication Classification 
(51)Int. Cl. C12N 015/74 (20060101)
(52)U.S. Cl. 424/93.2; 435/252.3; 536/123.1; 424/780
CPC C12N 015/74 (20130101)

        

(57)

Abstract

Provided is an isolated B. fragilis bacterial cell producing a native capsular polysaccharide A (PSA), wherein the cell is incapable of producing capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH because the cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome. The isolated isolated or wild type B. fragilis cell, or an extract obtained from said B. fragilis cell, can be used to treat individuals with inflammation.
 Claim(s),  Drawing Sheet(s), and Figure(s)
 
 


CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of Provisional Patent Application 61/542,549 filed on Oct. 3, 2011, which is incorporated by reference herein in its entirety.

STATEMENT OF GOVERNMENT GRANT

[0002] This invention was made with government support under R21DK083633 and RO1DK078938A awarded by the National Institutes of Health. The U.S. Government has certain rights in this invention.

FIELD OF THE INVENTION

[0003] The invention relates to treatments B. fragilis. More particularly this invention relates to the generation of PSA only producing mutant strains of B. fragilis.

BACKGROUND

[0004] Bacteroides fragilis produces at least 8 different capsular polysaccharides. In order to facilitate purification of PSA from the other 7 capsular polysaccharides. Others have engineered a PSA producing strain employed mutation of a regulatory gene that controls the transcription of polysaccharide production genes, but left the actual genes that are required for all capsular polysaccharide synthesis intact. However, subsequent to the creation of this strain, it was shown that secondary mutations could cause reversion to polysaccharide production (1).

SUMMARY

[0005] We created a novel bacterial strain for the production of Polysaccharide A (PSA). In order to facilitate purification of PSA from the other 7 capsular polysaccharides, we devised a strategy to mutate the genes required for production of all known polysaccharides except PSA. This was accomplished by DNA recombination (as described below) to delete the genes that encode for proteins that synthesize all non-PSA polysaccharides, ensuring that additional mutations would not restore production of other polysaccharides. The previous strategy to engineer a PSA producing strain employed mutation of a regulatory gene that controls the transcription of polysaccharide production genes, but left the actual genes that are required for all capsular polysaccharide synthesis intact.
[0006] However, subsequent to the creation of this previous strain, it was shown that secondary mutations could cause reversion to polysaccharide production (1). The current approach of deleting the genes that are required for polysaccharide production would overcome this potential shortcoming, and ensure a strain that is stable in this genotype and phenotype.
[0007] In an embodiment an isolated B. fragilis bacterial cell producing a native capsular polysaccharide A (PSA) is provided, wherein the cell is incapable of producing capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH.
[0008] In an aspect of any embodiments described herein, the cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
[0009] In yet another aspect of any embodiments described herein, a promoter that controls expression of PSA has not been modified.
[0010] In an aspect of any embodiments described herein, the PSA promoter has one or more repeat flanking regions surrounding the promoter, and wherein said flanking regions have not been modified.
[0011] In yet another aspect of any embodiments described herein, the cell is administered, as part of a pharmaceutical, to individuals suffering from an inflammatory disease or condition.
[0012] In an aspect of any embodiments described herein a composition is provided comprising a bacterial extract or cellular fraction obtained from a B. fragilis bacterial cell that produces a native capsular polysaccharide A (PSA) wherein the cell is incapable of producing capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH, wherein the cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
[0013] In yet another aspect of any embodiments described herein, a method to treat an individual with inflammation is provided comprising administering to said individual an effective amount of a pharmaceutical comprising an isolated B. fragilis bacterial cell, or an extract or cellular fraction of said cell, wherein the cell produces a native capsular polysaccharide A (PSA); and wherein the cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
[0014] In yet another aspect of any embodiments described herein, the cellular fraction is an outer membrane vesicular fraction.

BRIEF DESCRIPTION OF DRAWINGS

[0015] FIG. 1: Shows a gel showing the genotype of the PSA-only expressing mutant (B. fragilisΔPSB-PSH) compared to the wild-type B. fragilis 9343 by CPS specific PCR analysis. Wild-type (WT) is distinguished from the deletion mutant (A) at a given locus using primers in Table 2.
[0016] FIG. 2: Shows an immunoblot analysis confirms PSA expression by B. fragilisΔPSB-PSH mutant. Rabbit anti-PSA antiserum was used at 1:1000 dilution to probe for PSA and goat anti-rabbit secondary antibody was used at 1:5000 dilution. ΔPSA refers to a strain that is deleted only in the genes required for PSA biosynthesis. The lack of reactivity for this sample shows that the antibody used is specific for PSA and not any other molecule produced by the bacteria.
[0017] FIG. 3: Shows an immunoblot analysis confirms PSA expression by B. fragilis CPS mutants ΔPSA, ΔPSB, ΔPSB-PSC, ΔPSB-PSF, and ΔPSB-PSH. Rabbit anti-PSA antiserum was used at 1:3000 dilution to probe for PSA and goat anti-rabbit secondary antibody was used at 1:5000 dilution.
[0018] FIG. 4 shows an immunoblot analysis with PSA antiserum of whole cell (WC) and outer membrane vesicles (OMV) extracts from wild-type, PSA deletion mutant, Mpi deletion mutant expressing PSA only, and PSB through PSH deletion mutant B. fragilis show that all three PSA producing B. fragilis strains express PSA both on bacterial surface and with OMV. PSA-deletion mutant confirms specificity of the PSA antiserum.
[0019] FIG. 5 shows a NMR spectra for PSA (PSA12) from a PSA-only expressing mutant (B. fragilisΔPSB-PSH) bacteria.
[0020] FIG. 6 shows induction of IL-10 from in vitro cultures of dendritic cells and T cells treated with purified PSA (PSA12 and PSA 13) from a PSA-only expressing mutant (B. fragilisΔPSB-PSH) bacteria.

DETAILED DESCRIPTION

[0021] A “promoter controlling expression of a capsular polysaccharide” as used herein refers to a nontranscribed genetic element associated with and controlling the transcription of a capsular polysaccharide biosynthesis gene. The capsular polysaccharide biosynthesis gene can occur as part of a polycistronic capsular polysaccharide biosynthesis locus. A given promoter can regulate transcription of one or more capsular polysaccharide biosynthesis genes within the associated capsular polysaccharide biosynthesis gene locus. The promoter can include inverted repeat regions separated by intervening sequence. In one embodiment the promoter is contained between inverted repeat regions in the intervening sequence and is subject to inversion such that in one orientation the promoter is transcriptionally active (“on”) with respect to the capsular polysaccharide biosynthesis gene, while in the opposite or flipped orientation the promoter is transcriptionally inactive (“off”) with respect to the capsular polysaccharide biosynthesis gene.
[0022] The term “native” when used in connection with biological materials such as nucleic acid molecules, polypeptides, host cells, bacterial cells/strains and the like, refers to materials as they are found in nature and not manipulated by man.
[0023] The term “isolated” when used in connection biological materials such as nucleic acid molecules, polypeptides, bacterial cells, host cells, bacterial cells/strains and the like, refers to the isolated or purified aforementioned materials, where these materials do not occur naturally and/or where they have markedly different or distinctive characteristics compared to those found in the native material.
[0024] The wording “polysaccharide A” (or PSA, or PSA ligand) as used herein indicates a molecule produced by the PSA locus of Bacteroides fragilis and derivatives thereof which include but are not limited to polymers of the repeating unit {→3) α-d-AAT Galp(1→4)-[β-d-Galf (1→3)] α-d-GalpNAc(1→3)- [4,6-pyruvate]-β-d-Galp(1→}, where AATGa is acetamido-amino-2,4,6-trideoxygalactose, and the galactopyranosyl residue is modified by a pyruvate substituent spanning O-4 and O-6. The term “derivative” as used herein with reference to a first polysaccharide (e.g., PSA), indicates a second polysaccharide that is structurally related to the first polysaccharide and is derivable from the first polysaccharide by a modification that introduces a feature that is not present in the first polysaccharide while retaining functional properties of the first polysaccharide. Accordingly, a derivative polysaccharide of PSA, usually differs from the original polysaccharide by modification of the repeating units or of the saccharidic component of one or more of the repeating units that might or might not be associated with an additional function not present in the original polysaccharide. A derivative polysaccharide of PSA retains however one or more functional activities that are herein described in connection with PSA in association with the anti-inflammatory activity of PSA.
[0025] In one embodiment, low molecular weight PSA (L-PSA), as used herein, refers to PSA molecule with a molecular weight from 70 kDa to 200 kDa; and high molecular weight PSA (H-PSA), as used herein, refers to PSA molecule whose molecular weight is above 200 kDa.
[0026] In particular, in embodiments where the isolated bacterial strain/cell disclosed in this application, or OMV or PSA obtained from said strain, is used as an anti-inflammatory compound, the condition can be any condition associated to an inflammation or inflammatory response; or a condition described as an inflammatory disease itself. The wording “associated to” as used herein with reference to two items indicates a relation between the two items such that the occurrence of a first item is accompanied by the occurrence of the second item, which includes but is not limited to a cause-effect relation and sign/symptoms-disease relation.
[0027] Conditions associated with an inflammation (or inflammatory diseases) in humans include but are not limited to inflammatory bowel disease, including but not limited to Crohn's disease and ulcerative colitis, asthma, dermatitis, arthritis, myasthenia gravis, Grave's disease, multiple sclerosis (MS), type I diabetes, type 2 diabetes, food allergy, and psoriasis. A person of skill in the art would be able to identify such subjects suffering from the aforementioned diseases using the appropriate clinical criteria.
[0028] In one embodiment, compositions, extracts, or pharmaceutical composition comprising the isolated bacterial strain/cell disclosed in this application or OMVs, extracts, or PSA obtained from said strain, can be used to treat or prevent inflammatory diseases, such as, but not limited to, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), asthma, dermatitis, arthritis, myasthenia gravis, Grave's disease, multiple sclerosis, and psoriasis.
[0029] The term “treatment” or “treated” as used herein indicates any activity whether part of a medical care, or not, for or deals with a condition medically or surgically in animals or humans. Such treatments can be administered by either medical or non-medical personnel.
[0030] In some embodiments, where the composition is to be administered to an individual with another compound/drug, and/or a pharmaceutically acceptable or appropriate carrier/vehicle or excipient.
[0031] The term “excipient” as used herein indicates an inactive substance used as a pharmaceutically acceptable or appropriate carrier for the active ingredients of a medication. Suitable excipients for the pharmaceutical compositions herein disclosed include any substance that enhances the ability of the body of an individual to absorb vesicles herein described. Suitable excipients also include any substance that can be used to bulk up formulations with vesicles herein described to allow for convenient and accurate dosage. In addition to their use in the single-dosage quantity, excipients can be used in the manufacturing process to aid in the handling of vesicles herein described. Depending on the route of administration, and form of medication, different excipients may be used. Exemplary excipients include but are not limited to antiadherents, binders, coatings disintegrants, fillers, flavors (such as sweeteners) and colors, glidants, lubricants, preservatives, sorbents.
[0032] Pharmaceutically acceptable or appropriate carriers can be, but not limited to, organic or inorganic, solid or liquid excipient which is suitable for the selected mode of application such as oral application or injection, and administered in the form of a conventional pharmaceutical preparation. Such preparation includes solid such as tablets, granules, powders, capsules, and liquid such as solution, emulsion, suspension and the like. Said carrier includes starch, lactose, glucose, sucrose, dextrine, cellulose, paraffin, fatty acid glyceride, water, alcohol, gum arabic and the like. If necessary, auxiliary, stabilizer, emulsifier, lubricant, binder, pH adjustor controller, isotonic agent and other conventional additives may be added.
[0033] The pharmaceutically acceptable or appropriate carrier may well include other compounds known to be beneficial to an impaired situation of the gut, (e.g., antioxidants, such as Vitamin C, Vitamin E, Selenium or Zinc); or a food composition. The food composition can be, but is not limited to, milk, yoghurt, curd, cheese, fermented milks, milk based fermented products, ice-creams, fermented cereal based products, milk based powders, infant formulae, tablets, liquid bacterial suspensions, dried oral supplement, or wet oral supplement.
[0034] An “extract” as used herein indicates either the insoluble material or soluble material obtained from the B. fragilis bacterial cell using various chemical, immunological, biochemical or physical procedures known to those of skill in the art, including but not limited to, precipitation, centrifugation, filtering, column chromatography, and detergent lysis. Extract can also cover PSA, the outer membrane vesicular and/or the supernatant fraction obtained from culturing the said B. fragilis.
[0035] The term “diluent” as used herein indicates a diluting agent which is issued to dilute or carry an active ingredient of a composition. Suitable diluent include any substance that can decrease the viscosity of a medicinal preparation.
[0036] In certain embodiments, compositions, compounds, and, in particular, pharmaceutical/extract/cell compositions can be formulated for enteral administration including, but not limited to, i) by mouth (orally) as tablets, capsules, or drops; ii) by gastric feeding tube, duodenal feeding tube, or gastrostomy; and enteral nutrition; and iii) rectally as a suppository.
[0037] In certain embodiments, the wild type B. fragilis cell, or extracts or PSA derived from the wild type, can be used as pharmaceuticals or food for the above enteral administration to treat or prevent inflammatory diseases, such as, but not limited to, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), asthma, dermatitis, arthritis, myasthenia gravis, Grave's disease, multiple sclerosis, and psoriasis.
[0038] In some embodiments, the disclosed bacterial strain/cell, or OMVs derived from either the isolated (as disclosed) or wild type B. fragilis, can be used in a method of treating or preventing a condition in an individual.
[0039] The method comprises administering to the individual an effective amount of the composition or pharmaceutical/extract/cell/PSA composition comprising or derived from either the isolated B. fragilis strain (as disclosed here) or wild type B. fragilis; or a combination thereof. The term “individual” as used herein includes a single biological organism wherein inflammation can occur including but not limited to animals and in particular higher animals and in particular vertebrates such as mammals and in particular human beings.
[0040] The wild type B. fragilis or the isolated B. fragilis cell, or extracts, OMVs, or PSA derived from wild type or the isolated B. fragilis can be administered as part of or in the form of a nutritional composition, such as but not limited to a beverage, a drink, a bar, a snack, an ice cream, a dairy product, for example a chilled or a shelf-stable dairy product, a confectionery product, a cereal product such as a breakfast cereal, a frozen product intended for consumption after heating in a micro-wave or an oven, a ready-to-eat product, a fast food or a nutritional formula (which encompasses any nutritionally complete or supplementary formulation).
[0041] In alternative embodiments, the wild type B. fragilis or the isolated B. fragilis cell, or extracts, OMVs, or PSA derived from wild type B. fragilis or the isolated B. fragilis, can be administered as or part of a neutraceutical; a probiotic alone (or in combination with other probiotics); a pharmaceutical; a medicinal formulation, a cream, or a lotion.
[0042] The term neutraceutical, as used in this application, refers to a food, food product, fortified food or a dietary supplement that provides health and medical benefits, including the prevention and treatment of disease.
[0043] The “effective amount”, “amount effective to,” or “amount of X effective to” refers to an amount of the compound, composition or pharmaceutical/extract/cell composition that is effective to treat, relieve, reduce, or improve to some extent one or more of the symptoms of the disease in need of treatment, or to retard initiation of clinical markers or symptoms of a disease in need of prevention, when the compound is administered. Thus, for example an effective amount refers to an amount of the compound/composition/pharmaceutical ingredient which exhibits the ‘improved’ effects, as noted below.
[0044] The “effective amount” may be empirically determined by experimenting with the compounds concerned in known in vivo and in vitro model systems for a disease in need of treatment. An effective amount will vary according to the weight, sex, age and medical history of the individual, as well as the severity of the patient's condition(s), the type of disease(s), mode of administration, and the like. An effective amount may be readily determined using routine experimentation, e.g., by titration (administration of increasing dosages until an effective dosage is found) and/or by reference to amounts that were effective for prior patients. Generally, the effective amount of the present invention will be administered in dosages ranging between about 0.1 mg/kg and about 20 mg/kg of the patient's body-weight.
[0045] As used herein, the phrase “prophylactically effective amount” includes the amount of the compound/composition/pharmaceutical/extract/cell composition which is sufficient to result in the prevention or reduction of the development, recurrence or onset of one or more symptoms associated with a disorder (or to enhance or improve the prophylactic effect(s) of another therapy (e.g., another prophylactic agent).
[0046] It is further contemplated that the compound/composition/pharmaceutical/extract/cell composition of the present invention can be used with one or more known medicaments known to be useful in the treatment or prevention of inflammatory diseases, either separately or in combination.
[0047] For example the compound/composition/pharmaceutical/extract/cell composition of the present invention can be combined with one or a combination of medicaments/treatments known to be useful in the treatment of IBD such as, but not limited to, sulfasalazine (Azulfadine), mesalamine (Asacol, Pentasa), immunosuppressants (Imuran, 6-MP, cyclosporine); methotrexate, TNF-alpha inhibitors (Remicade and Humira); and corticosteroids (Entocort and prednisone). Other treatments (experimental) for ulcerative colitis, include aloe vera, butyrate, boswellia, probiotics, antibiotics, immunosuppressive therapy, and nicotine.
[0048] For example the compound/composition/pharmaceutical/extract/cell/PSA of the present invention can be combined with one or a combination of medicaments/treatments known to be useful in the treatment of MS such as, but not limited to, Avonex®, Betaseron®, and Copaxone®. Rebif®; Extavia® Novantrone® (mitoxantrone); Tysabri® (natalizumab), and Gilenya® (fingolimod). Other drugs include intravenous immunoglobulin (IVIg) therapy, methotrexate, azathioprine (Imuran®), and cyclophosphamide (Cytoxan®); corticosteroids; cytoxan® (cyclophosphamide); Imuran® (azathioprine); methotrexate; plasma exchange; pulse solu-medrol® (IV methylprednisolone); prednisone; Decadron® (dexamethasone); Medrol® (oral methylprednisolone); Plasmapheresis (plasma exchange); intravenous immunoglobulin (IVIg) therapy.
[0049] Generation of PSA-only Producing Mutant Strain (“Isolated B. Fragilis”)
[0050] To create the B. fragilis mutant that produces PSA only from the repertoire of capsular polysaccharides (CPS), the B. fragilis NCTC9343ΔPSB mutant (2) was used as a parent strain from which every CPS biosynthesis locus (PSC-PSH) except for that of PSA was deleted one at a time. DNA segments upstream and downstream of the region to be deleted were PCR amplified by using primers listed in Table 1. A second round of PCR using primers 1 (forward primer of the left flank) and 4 (reverse primer of the right flank) with the 1:1 mix of the two PCR products as templates was performed to fuse the left and right flanking DNA fragments using the 18 bp overlapping region engineered into primers 2 (reverse primer of the left flank) and 3 (forward primer of the right flank). The fused PCR product was digested with BamHI and cloned into the BamHI site of the Bacteroides conjugal suicide vector pNJR6. The plasmid was introduce into Escherichia coli (E. coli.) and subsequently conjugally transferred into B. fragilis NCTC9343 and the cointegrates were selected by resistance to erythromycin encoded by pNJR6. The cointegrate strain was passaged in nonselective medium for 5-8 days and then plated on nonselective medium (BHIS). The resulting colonies were replica plated to BHIS containing erythromycin and the erythromycin-sensitive colonies were screened by PCR to distinguish wild-type revertants from strains with desired mutation (Table 2).
[00001] [TABLE-US-00001]
  TABLE 1 
 
  Primers used to PCR amplify upstream and downstream flanking regions.
  Primer name   Sequence   5′ addition   Purpose
 
  SEQ ID. NO. 1   AAATGCGTTGCTTTTGCTTT   GT GGATCC (BamHI)   Delete PSC - left flank
  PSC primer-1      
 
  SEQ ID. NO. 2   TTCGAAATCGTTTTGCTTCA   AAACCATGG   Delete PSC - left flank
  PSC primer-2      
 
  SEQ ID. NO. 3   CCATGGTTTATGCTGGCTTT   GATTTCGAA   Delete PSC - right flank
  PSC primer-3      
 
  SEQ ID. NO. 4   AACACTACGCCTACCCGATG   TT GGATCC (BamHI)   Delete PSC - right flank
  PSC primer-4      
 
  SEQ ID. NO. 5   TACTGACCGAACCCACATCA   GT GGATCC (BamHI)   Delete PSD - left flank
  PSD primer-1      
 
  SEQ ID. NO. 6   CGATCCGATCTGTCATAGCA   TAGCCGGTT   Delete PSD - left flank
  PSD primer-2      
 
  SEQ ID. NO. 7   AACCGGCTAAAAATGGAAGG   ATCGGATCG   Delete PSD - right flank
  PSD primer-3      
 
  SEQ ID. NO. 8   ATCGGCACTCCAACAGACTT   TT GGATCC (BamHI)   Delete PSD - right flank
  PSD primer-4      
 
  SEQ ID. NO. 9   ACTTACGTTCAACGCCATCC   GT GGATCC (BamHI)   Delete PSE - left flank
  PSE primer-1      
 
  SEQ ID. NO. 10   GAGATTGCCTGGGTGAAAAA   CTTATGGAC   Delete PSE - left flank
  PSE primer-2      
 
  SEQ ID. NO. 11   GTCCATAAGCTTGACGCACA   GGCAATCTC   Delete PSE - right flank
  PSE primer-3      
 
  SEQ ID. NO. 12   CGTGCAGGTAATGTGATTGG   TT GGATCC (BamHI)   Delete PSE - right flank
  PSE primer-4      
 
  SEQ ID. NO. 13   TTTGTGAGCGTTTGCTCAAT   GT GGATCC (BamHI)   Delete PSF - left flank
  PSF primer-1      
 
  SEQ ID. NO. 14   CATCCTCCCATGCCTAAAGA   GCACCGCAC   Delete PSF - left flank
  PSF primer-2      
 
  SEQ ID. NO. 15   GTGCGGTGCTGGTTTTTAAT   GGGAGGATG   Delete PSF - right flank
  PSF primer-3      
 
  SEQ ID. NO. 16   CTATGCCAAGCGGAAAGAAG   TT GGATCC (BamHI)   Delete PSF - right flank
  PSF primer-4      
 
  SEQ ID. NO. 17   CCCTATTGGCCGGTTTTATT   GT GGATCC (BamHI)   Delete PSG - left flank
  PSG primer-1      
 
  SEQ ID. NO. 18   TTGGCTTTATCGTCCGTACC   TTGAAGTGG   Delete PSG - left flank
  PSG primer-2      
 
  SEQ ID. NO. 19   CCACTTCAACACCATTGACG   TAAAGCCAA   Delete PSG - right flank
  PSG primer-3      
 
  SEQ ID. NO. 20   CCCCTCTCCAATATCAGCAA   TT GGATCC (BamHI)   Delete PSG - right flank
  PSG primer-4      
 
  SEQ ID. NO. 21   ATTCCCGCAAGTGCAGATAG   GT GGATCC (BamHI)   Delete PSH - left flank
  PSH primer-1      
 
  SEQ ID. NO. 22   TTTAAGCGACGTGGAGGTTT   TGGGACTGA   Delete PSH - left flank
  PSH primer-2      
 
  SEQ ID. NO. 23   TCAGTCCCACCCACACAGTA   TCGCTTAAA   Delete PSH - right flank
  PSH primer-3      
 
  SEQ ID. NO. 24   CACTTACAGCCGTGAGCTTG   TT GGATCC (BamHI)   Delete PSH - right flank
  PSH primer-4
 
[00002] [TABLE-US-00002]
  TABLE 2 
 
  Primers used to distinguish between wild-type revertants and
  deletion mutant strains.
  Primer name   Sequence   Target   Product size
 
  SEQ ID. NO. 25   GCGCAAGCTTCTGGTTTAAG   PSA wild-type   1191 bp
  PSA F      
  SEQ ID. NO. 26   CTCCAAAGCCTTCACTTTCG    
  PSA R      
 
  SEQ ID. NO. 27   GCTAAGACCGTTGCCAAAAT   PSA deletion mutant   1333 bp
  delPSA F      
  SEQ ID. NO. 28   ACCCGCAAAACAGAAATGAC    
  delPSA R      
 
  SEQ ID. NO. 29   AAATGCGTTGCTTTTGCTTT   PSB wild-type   1245 bp
  PSB F      
  SEQ ID. NO. 30   TTCGAAATCGTTTTGCTTCA    
  PSB R      
 
  SEQ ID. NO. 31   CATGGAGAAAACATCGTTGG   PSB deletion mutant    802 bp
  delPSB F      
  SEQ ID. NO. 32   CCCAATATCGTTCAGCCAAA    
  delPSB R      
 
  SEQ ID. NO. 33   GGAGGATGTTTGAATTGGTGG   PSC wild-type    979 bp
  C127      
  SEQ ID. NO. 34   CCCGCTTAATGCCCTAAAAT    
  delPSC C      
 
  SEQ ID. NO. 35   GGAGGATGTTTGAATTGGTGG   PSC deletion mutant   2825 bp
  C127      
  SEQ ID. NO. 36   TATCCTGATGTTCTGCTTTTCCG    
  C121      
 
  SEQ ID. NO. 37   GTATCCCGACGTTACGAGGA   PSD wild-type    881 bp
  delPSD F      
  SEQ ID. NO. 38   CGAGGAATCTTGGCATTGAT    
  delPSD C      
 
  SEQ ID. NO. 39   GTATCCCGACGTTACGAGGA   PSD deletion mutant   1037 bp
  delPSD F      
  SEQ ID. NO. 40   CCATTTGGATAGGCGAGAAA    
  delPSD R      
 
  SEQ ID. NO. 41   CTGAAAGCGCATTTTCAACA   PSE wild-type    940 bp
  delPSE C      
  SEQ ID. NO. 42   TGCATTTCATGGAGGAACAA    
  delPSE R      
 
  SEQ ID. NO. 43   TTGATGGGGAATGAATGGTT   PSE deletion mutant   1687 bp
  delPSE F      
  SEQ ID. NO. 44   TGCATTTCATGGAGGAACAA    
  delPSE R      
 
  SEQ ID. NO. 45   GCCCATGTCAGATTTGCTTT   PSF wild-type    958 bp
  delPSF F      
  SEQ ID. NO. 46   TAGGCAAAATATCCGGCATC    
  delPSF C      
 
  SEQ ID. NO. 47   GCCCATGTCAGATTTGCTTT   PSF deletion mutant   1281 bp
  delPSF F      
  SEQ ID. NO. 48   ATGAATGAAGCCGAAAATCG    
  delPSF R      
 
  SEQ ID. NO. 49   AATGCCGGTTGTTTTGGTTA   PSG wild-type    802 bp
  delPSG F      
  SEQ ID. NO. 50   ACAGAACCTGCTCCCACTGT    
  delPSG C      
 
  SEQ ID. NO. 51   AATGCCGGTTGTTTTGGTTA   PSG deletion mutant    930 bp
  delPSG F      
  SEQ ID. NO. 52   CGGATCATAAAATCGGCAAC    
  delPSG R      
 
  SEQ ID. NO. 53   CGGGTAAAACTCTGCCCATA   PSH wild-type    923 bp
  delPSH F      
  SEQ ID. NO. 54   GCTCGTATGGATGCTGATGA    
  delPSH C      
 
  SEQ ID. NO. 55   CGGGTAAAACTCTGCCCATA   PSH deletion mutant    829 bp
  delPSH F      
  SEQ ID. NO. 56   AGGTGCTTTCGTGATTGCTT    
  delPSH R
 
[0051] We determined whether PSA could be detected in the outer membrane vesicles (OMV) extracts of our strain. For this purpose outer membrane vesicles (OMV) extracts were prepared based on a modification of a previously described protocol for the preparation of OMVs from E. coli (Amanda L. Horstman and Meta J. Kuehn. (2000) Enterotoxigenic Escherichia coli secretes active heat-labile enterotoxin via outer membrane vesicles. J Biol Chem. 275: 12489-12496. ) Briefly, electron dense layer (EDL)-enriched B. fragilis was grown in customized MM. OMVs were recovered from the bacteria-free supernatant of the culture by centrifugation at 40,000 g for 2hrs at 4 C and further washed twice with PBS and filtered through 0.45 μm spin columns (Millipore #20-218). Total protein concentration of the purified OMVs was determined by Bradford assay (Biorad #500-0205). FITC-labeled OMVs were prepared as previously described (Nicole C. Kesty and Meta J. Keuhn. (2004) Incorporation of heterologous outer membrane and periplasmic proteins into Escherichia coli outer membrane vesicles. J Biol Chem. 279: 2069-2076). Briefly, OMVs were incubated in the staining buffer (1 mg/ml FITC (Thermo Scientific #46424), 100 mM NaCl, 50 mM Na2CO3, pH 9.2) for 1 hr at RT. Labeled OMVs were collected by centrifugation at 40,000 g for 30 min at 4 C and washed twice with PBS+200 mM NaCl.
[0052] FIG. 4 shows an immunoblot analysis for PSA production by whole cell lysates and OMVs. There are 4 bacterial strains analyzed: wild-type bacteria (positive control), PSA mutant (ΔPSA; negative control for antibody specificity), mpi44 (the previously used PSA production strain) and ΔB-H (the newly created strain in this application). As can be seen, PSA is produced as expected in the ΔB-H strain in both the whole cell and outer membrane vesicles (OMV) extracts; the latter confirming that PSA is actively sorted into the OMVs of our strain.
[0053] The disclosed bacterial strain/cell can be used to treat or prevent a variety of diseases, such as but not limited to, inflammatory bowel disease, Crohn's disease and ulcerative colitis, asthma, dermatitis, arthritis, myasthenia gravis, Grave's disease, multiple sclerosis (MS), type I diabetes, type 2 diabetes, food allergy, and psoriasis. Thus, either the live, viable or lyophilized embodiments of the bacteria cell disclosed expresses only PSA can be administered alone or part of a pharmaceutical; or in conjunction with any other therapeutic agent useful in the treatment the aforementioned diseases. In another embodiments, the OMVs from the disclosed bacterial strain/cell can be can be administered alone or part of a pharmaceutical; or in conjunction with any other therapeutic agent useful in the treatment the aforementioned diseases.
[0054] It should be mentioned that prior investigators have described an isolated Bacteroides fragilis bacterial cell producing a native capsular polysaccharide A (PSA), having a native promoter that controls expression of native biosynthetic genes of PSA and native promoters that control expression of native biosynthetic genes of native capsular polysaccharides PSB, PSD, PSE, PSF, PSG and PSH, wherein the promoter that controls expression of the native biosynthetic genes of PSA is locked on, wherein at least one of the promoters that controls expression of the native biosynthetic genes of the native capsular polysaccharides selected from the group consisting of: PSB, PSD, PSE, PSF, PSG, and PSH is locked off, wherein the promoter controlling expression of the native biosynthetic genes of PSA is locked on by deletion of the gene that encodes for a DNA recombinase that inverts promoters. Upon deletion of this gene, named multiple promoter invertase (mpi), bacterial isolates were screened for a strain that has the PSA promoter in the locked on orientation, but all other promoters in the locked off orientation. In that study, the promoter controlling expression of a capsular polysaccharide is “locked on” when the invertible promoter is in its transcriptionally active orientation and it cannot invert to the transcriptionally inactive orientation. The promoter can be locked on because a sequence-specific enzyme that normally inverts the promoter is not present or is otherwise disabled. Alternatively, the promoter can be locked on because at least one inverted repeat flanking the invertible region of the promoter is altered, e.g., deleted, so that the inversion is not possible. Alternatively, the promoter controlling expression of a capsular polysaccharide is “locked off” when the invertible promoter is in its transcriptionally inactive orientation and it cannot invert to the transcriptionally active orientation. The promoter can be locked off because a sequence-specific enzyme that normally inverts the promoter is not present or is otherwise disabled. Alternatively, the promoter can be locked off because at least one inverted repeat flanking the invertible region of the promoter is altered, e.g., deleted, so that the inversion is not possible.
[0055] FIG. 5 shows that the PSA-only expressing mutant (B. fragilisΔPSB-PSH) bacteria serves its purpose to facilitate purification of PSA as evidenced by NMR.
[0056] FIG. 6 shows the induction of IL-10 from in vitro cultures of dendritic cells and T cells treated with PSA purified from the A-only expressing mutant (B. fragilisΔPSB-PSH) bacteria (PSA12 and PSA13). Both PSAs look similar.
References (which are all incorporated by reference in their entirety).
[0057] 1. Liu C H, Lee S M, Vanlare J M, Kasper D L, Mazmanian S K. 2008. Regulation of surface architecture by symbiotic bacteria mediates host colonization. Proc Natl Acad Sci USA 105: 3951-6
[0058] 2. Coyne M J, Kalka-Moll W, Tzianabos A O, Kasper D L, Comstock L E. 2000. Bacteroides fragilis NCTC9343 produces at least three distinct capsular polysaccharides: cloning, characterization, and reassignment of polysaccharide B and C biosynthesis loci. Infect Immun 68: 6176-81
(57)

Claim

1. An isolated B. fragilis bacterial cell producing a native capsular polysaccharide A (PSA), wherein the cell is incapable of producing capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH.
2. The cell of claim 1, wherein the cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
3. The cell of claim 1, wherein the PSA is expressed on the cell's outer membrane vesicles.
4. The cell of claim 1, wherein a promoter that controls expression of PSA has not been modified.
5. The cell of claim 4, wherein the PSA promoter has one or more repeat flanking regions surrounding the promoter, and wherein said flanking regions have not been modified.
6. The cell of claim 1, wherein the cell is administered, as part of a pharmaceutical, to individuals suffering from an inflammatory disease or condition.
7. The cell of claim 3, wherein the cell's outer membrane vesicles are administered, as part of a pharmaceutical, to individuals suffering from an inflammatory disease or condition.
8. A composition comprising a bacterial extract or cellular fraction obtained from either a wild type or isolated B. fragilis cell that produces a native capsular polysaccharide A (PSA), wherein said isolated B. fragilis cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
9. The composition of claim 1, wherein a promoter that controls expression of PSA has not been modified.
10. The composition of claim 9, wherein the PSA promoter has one or more repeat flanking regions surrounding the promoter, and wherein said flanking regions have not been modified
11. The composition of claim 8, wherein the cellular fraction is an outer membrane vesicular fraction.
12. A method to treat an individual with inflammation comprising administering to said individual an effective amount of a pharmaceutical comprising an isolated or wild type B. fragilis cell, or an extract obtained from said B. fragilis cell, wherein the isolated cell produces a native capsular polysaccharide A (PSA), and wherein said isolated cell's biosynthetic genes for native capsular polysaccharides PSB, PSC, PSD, PSE, PSF, PSG, and PSH have been deleted from the cell's genome.
13. The method of claim 12, wherein the cellular fraction is an outer membrane vesicular fraction.
*****

Download Citation


Sign in to the Lens

Feedback