Agents For Reversing Epigenetic Silencing Of Genes

  • Published: Jul 10, 2008
  • Earliest Priority: Dec 27 2006
  • Family: 5
  • Cited Works: 2
  • Cited by: 9
  • Cites: 2
  • Sequences: 21
  • Additional Info: Cited Works Full text

AGENTS FOR REVERSING EPIGENETIC SILENCING OF GENES

BACKGROUND OF THE INVENTION

FIELD OF THE INVENTION

[0001] The invention relates generally to the field of DNA methylation and more specifically to the use and detection of agents that reverse epigenetic "silencing" of genes resulting from DNA hypermethylation

BACKGROUND INFORMATION

[0002] DNA methylation, or the covalent addition of a methyl group to cytosine within the context of the CpG dmucleotide, has profound effects on the mammalian genome These effects include transcriptional repression via inhibition of transcription factor binding or the recruitment of methyl-bmding proteins and their associated chromatin remodeling factors, X chromosome mactivation, imprinting and the suppression of parasitic DNA sequences DNA methylation is also essential for pioper embryonic development, however, its presence can add an additional burden to the genome Normal methylation patterns are frequently disrupted in tumor cells with global hypomethylation accompanying region-specific hypermethylation When these hypermethylation events occur within the promoter of a tumor suppressor gene they may silence the gene and provide the cell with a growth advantage in a manner akm to deletions or mutations Furthermore, DNA methylation may be an important player in both DNA repair and genome stability

[0003] DNA methylation at the 5-position of cytosine in CpG dinucleotides is an important aspect of physiological processes, such as embryonic development, X chromosome mactivation, imprinting, and transcriptional regulation While CpG dinucleotides are generally methylated throughout the genome of normal somatic cells, CpG islands (CGIs), clusters of CpG dinucleotides in gene regulatory regions, are usually unmethylated

[0004] Epigenetic gene "silencing" occurs in cancer cells Of all the somatic genome changes that accumulate during the pathogenesis of human cancer, only changes in DNA methylation appear to occui consistently (virtually all cases), to arise early (first appearing in preneoplastic lesions), and to be potentially reversible (the DNA sequence remains intact) One such change in DNA methylation, increased CpG dmucleotide methylation at CpG islands encompassing the transcriptional regulatory regions of many genes, leads to the transcriptional "silencing" of critical cancer genes Aberrant hypermethylation of CGIs and subsequent transcriptional repiession is one of the earliest and most common somatic genome alterations in multiple human cancers

[0005] CpG island hypermethylation has been reported to inhibit gene transcription by interfering with the binding and/or function of transcriptional transactivators, or by recruiting 5 mCpG-binding domain (MBD) family proteins capable of mediating transcriptional repression via effects on chiomatin structure As an example, for the GSTPl CpG island hypermethylated in cancels, such as prostate, breast, and liver cancers, the MBD family protein MBD2 has been found responsible for methylation-associated "silencing" of gene transcription

[0006] Somatic CpG island hypermethylation and associated gene "silencing" may be effectively targeted for rational cancel treatment and prevention One strategy, under current clinical development, features the use of inhibitors of DNA methyltransferases (DNMTs), such as 5-aza-cytdine, 5-aza-deoxycytidine, zebulaπne, procainamide, or hydralazine, to reduce 5 "1CpG density at the CpG island sequences in dividing cancer cells Another approach, also under active clinical development, has been the use of inhibitors of histone deacetylases (HDACs), such as sodium phenylbutyrate, valproic acid, or suberoylanihde hydroxamic acid (SAHA), to limit the formation of repressive chromatin conformation near the genes caring abnormally methylated CpG islands

[0007] Nucleoside analog inhibitors of DNMTs, such as 5-az-cytidine (5-aza-C) and 5- azd-deoxycytidine (5-aza-dC), have been widely used in attempts to reverse abnormal DNA methylation changes in cancer cells and restore "silenced" gene expression Unfortunately, despite some apparent successes using pre-clinical models and some promising results in early clinical trials (Table 1 ), the clinical utility of these compounds for cancer has not yet been fully realized and the drugs have not yet been approved by the U S Food and Drug Administration (F D A ) for any indication Table 1 Nucleoside DNMT Inhibitors and Solid Tumors

[0008| One of the limitations of the nucleoside analog DNMT inhibitors in clinical trials has been treatment-associated side effects, such as myelotoxicity with resultant neutropenia and thombocytopenia, which aie characteristic of other nucleoside analogs in general, including nucleoside analogs that are not DNMT inhibitors

[0009] Another concern about the use of nucleoside analogs as DNMT inhibitors has been that incorporation of the nucleoside analogs into genomic DNA might lead to mutations and/or cancer development Pi ocamamide, a drug approved by the F D A for the treatment of cardiac arrhythmias, and hydralazine, a drug approved for the treatment of hypertension, are non-nucleoside analogs that both also appear to inhibit DNMTs However, long-term use of either of these drugs caries a risk of drug-induced lupus, more commonly in women than in men In animal models, both 5-aza-C and procainamide appear to trigger autoimmunity, though whether or not autoimmunity is an unavoidable side effect of DNMT inhibition is not known Finally, mice carrying one disrupted DNMTl allele and one hypomorphic DNMTl allele, resulting in 10% of normal DNMT activity, have been reported to exhibit genomic instability and to develop T-cell lymphomas, hinting that therapeutic reductions in 5 "1CpG dinucleotides might promote the appearance of certain cancers {eg lymphomas) while attenuating the appearance of others Thus, the clinical use of DNMT inhibitors is likely to be limited by both mechanism-based and mechanism-independent side effects

[0010] Like DNMT mhibitois, HDAC inhibitors have also exhibited promising preclinical activity in cancel models HDAC inhibitors under clinical development include sodium phenyl butyrate (and other butyrates), valoproic acid, suberoylanihde hydroxamic acid (SAHA), pyroxamide, N-acetyl dinahne (CI-994), and depsipeptide However, the early clinical experience with these agents suggests that side effects, such as nausea, vomiting, diarrhea, fatigue, edema, etc , can occur, though severe adverse events appear rare In addition to DNMT inhibitors and HDAC inhibitors given as single agents, combinations of DNMT inhibitors and HDAC inhibitors also appear to have intriguing activity in preclinical models Whether combinations of the currently available collection of DNMT inhibitors and HDAC inhibitors can reactivate silenced cancer genes, without unacceptable toxicity, in human clinical trials, has not yet been determined

[0011] In addition to ti eatment and prevention of cancer, reactivation of silenced genes may be useful for tieatment of other diseases, such as sickle cell anemia Sickle cell anemia is caused by a point mutation in the beta-globin gene (HBb) Dimers of this mutant form of HBb multimeπze with dimers of alpha-globin (Hba) to make sickle hemoglobin (HBs) HBs is prone to polymerization, causing sickling of red blood cells, and subsequent aberrant interactions between the sickled red blood cells, immune cells, and endothelial cells that result in a complex specti um of disease manifestations Reactivation of the gamma-globin gene, presents a useful strategy in tieatment of sickle cell disease

SUMMARY OF THE INVENTION

[0012] The present invention is based in part on the seminal discovery of compounds that reverse epigenetic silencing It is believed that these agents function by inhibiting the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA Accordingly, the present invention provides a method of screening for an agent that inhibits the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA [0013] In one embodiment, the present invention provides a method of screening for an agent that inhibits the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA. The method includes contacting a sample comprising an MBD protein, an MBD protein-mediated gene having hypermethylated CpG islands and an MBD protein- mediated gene having non-hypermethylated CpG islands, with a test agent under conditions sufficient for transcription of the MBD protein-mediated gene, detecting the transcriptional activity of the MBD protein-mediated gene, and comparing the difference in transcriptional activity between the MBD protein-mediated gene having hypermethylated CpG islands and the MBD protein-mediated gene having non-hypermethylated CpG islands in the presence and absence of the test agent. An increase in transcription of the MBD protein-mediated gene having hypermethylated CpG islands as compared to the MBD protein-mediated gene having non-hypermethylated CpG islands, in the presence of the agent, identifies the agent as an inhibitor of the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA.

[0014] In one aspect, the agent is a chemical compound. In another aspect the agent is a chemical compound selected from those shown in Table 2.

[0015] In another aspect, the method further includes determining whether the identified agent is also an inhibitor of a DNA methyltransferase (DNMT) protein by testing the ability of the compound to inhibit DNA methylation. In another embodiment, the MBD protein is methyl-CpG binding domain protein 2 (MBD2) or methyl CpG binding protein 2 (MeCP2).

[0016] In another aspect, the MBD protein mediated gene includes a promoter region. In another embodiment, the promoter region is a GSTPl promoter. In another aspect, the MBD protein mediated gene further includes a reporter gene or reporter molecule. In another aspect, the reporter molecule is selected from radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, or magnetic particles.

[0017] In another embodiment, the invention provides a method of preventing or treating cancer associated with CpG island hypermethylation of a gene in a subject. The method includes administering to the subject an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby increasing transcription of the gene and thereby preventing or treating the cancer In one aspect, the gene is selected from GSTPl, APC, HIC-I, RASSFlA PTGS-2 EDNRB, MDR-I, ESRl, TIMP3, CDKN2A, CDKN2B, MLHl, MGMT, DAPKl CDHl ARF, IGF2, H19, p57/KIP2, KvLQTl, TSSC3, TSSC5, or ASCL2 In one example, the MBD protein is MBD2 or MeCP2 The cancer may be selected from colorectal cancer, esophageal cancer, stomach cancer, leukemia/lymphoma, lung cancer, prostate cancer, uterine cancer, bieast cancer, skin cancer, endocrine cancer, urinary cancer, pancreatic cancer, other gastrointestinal cancer, ovarian cancer, cervical cancer, head cancer, neck cancer, kidney cancel , liver cancer, bladder cancer, breast cancer or adenomas

[0018] In another embodiment, the invention provides a method of preventing or treating sickle cell anemia in a subject The method includes administering to the subject an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby preventing or treating the sickle cell anemia For example, the MBD protein is MBD2 or MeCP2

[0019] In another embodiment, the invention provides a method of reactivating a silenced gene having CpG island hypermethylation The method includes contacting a cell with an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby inci easing transciiption of the silenced gene For example, the agent is an inhibitor of the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA In one aspect, the agent is a chemical compound For example, the agent may be a chemical compound selected from those shown in Table 2

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 shows a pictorial diagram illustrating how 5 mCpG-binding domain (MBD) family proteins iecruit transcription repression complexes to hypermethyated CpG islands to "silence" critical cancer genes

[0021] Figure 2 is a graphical representation showing a CpG island methylation index for normal prostate cells and pi ostate cancer cell lines in vitro, and for localized prostate cancer cases in vivo, sampling GSTPl APC HIC-I, RASSFlA, PTGS-2, EDNRB, MDRl, ESRl, T1MP3 CDKN2A CDKN2B MLHl MGMT, DAPKl, CDHl and ARF, using quantitative MS-PCR methods [0022] Figure 3 is a giaphical representation showing a CpG island methylation index for metastatic prostate cancers, showing greater differences in methylation patterns between cases than between metastatic deposits

[0023] Figure 4 is a graphical iepiesentation showing distinct patterns of CpG island hypermethylation in human cancers

[0024] Figure 5 is a pictorial diagram illustrating the GSTPl CpG island region encompassing the transcriptional promoter unmethylated in all normal tissues and extensively methylated in cancers, such as prostate, breast, and liver cancers

[0025] Figure 6 is a pictorial diagram illustrating histopathogenesis of prostate cancer, from normal prostate, to proliferative inflammatory atrophy (PIA), to prostatic intraepithelial neoplasm (PIN), to prostate cancer

[0026] Figure 7 is a pictoiial diagram illustrating GSTPl Cp-G island hypermethylation appearing early during, piostatic caicinogenesis, arising in PIA and PIN lesions that are precursors to prostate cancer

[0027] Figure 8 is a pictoi ial diagram illustrating CpG island hypermethylation repression of the activity of GSTPJ piomoters upon transfection into MCF-7 breast cancer cells

[0028] Figures 9A-9C are giaphical repiesentations showing chromatin immunoprecipitation (ChIP) analysis of MBD proteins at the GSTPl promoter in MCF-7 cells (A), with "silenced" GSTPl alleles, and in MCF-7/ADR cells (B), with active GSTPl alleles, reveals selective association of MBD2 with "silenced" GSTPl alleles In contrast, at "silenced" MDRl alleles in MCF-7 cells (C), both MBD2 and MeCP2 are present

[0029] Figure 10 is a graphical representation and pictorial diagram showing siRNA targeting mRNA encoding MBD2, but not MeCP2 triggers reactivation of GSTPl expression in MCF-7 cells as efficiently as siRNA targeting DNMTl mRNA

[0030] Figure 1 1 is a giaphical representation and pictorial diagram showing SiRNA- mediated "knock-down" ot MBD2 alleviates repression of methylated GSTPl promoters in transient transfection assays [0031] Figure 12 is a pictorial diagram illustrating the stage 1 screening assay for MBD2 pathway antagonists

[0032| Figure 13 is a graphical repiesentation showing "hits" from stage 1 screening of 10,000 ChemBπdge PHARMCOPHORE™ compounds (/ > 1 5 with Firefly luciferase induction > 1) that selectively activate expression from transfected GSTP 1 promoters with hypermethylated CpG islands

[0033] Figure 14 is a giaphical representation illustrating the stage 2 screening assay for activation of GSTP/ mRNA expiession in MCF-7 cells with hypermethylated GSTPl CpG islands Dose-response analysis of 3 similar "hit" compounds evidence structure-activity relationships

[0034] Figure 15 is a graphical representation showing the dose-response characteristics of 2 "hit" compounds using the stage 2 assay for activation of GSTPl expression in MCF-7 cells

[0035] Figures 16A is a pictoi ial representation showing baculovirus-mediated expression of C-terminal His6-tagged MBD in Sf9 insect cells and purification by Ni-NTA beads The eluate contained purified 9 8 kDa MBD-His6

[0036] Figure 16B is a giaphical representation showing inhibition of MBD2, MeCP2_MBD binding to 5mC -containing DNA

[0037] Figure 17 is a pictorial representation showing cDNA microarray analysis of changes in patters of gene expression in MCG-7 cells accompanying treatment with 5-aza-C or tπchostatin A, and associated with siRNA-mediated "knock-down" of MBD2, MeCP2, or DMNTl (green color indicates increased expression)

[0038] Figure 18 is a pictoi ial iepresentation showing the production and purification of recombinant DNA methyltransfeiases Shown are the results of baculovirus mediated expression of DNMTl and DNMT3a

[0039] Figure 19 is a graphical representation of Lineweaver-Burk analysis of procainamide inhibition of DNMT3a [0040] Figure 20 is a gi aphical representation showing Lineweaver-Burk analysis of procainamide inhibition of DNMT3a

[0041] Figure 21 is a pictorial representation illustrating screening to identify high-pπoπty "lead" compound MBD2 Pathway antagonists for evaluation in preclinical models

[0042] Figure 22 is a graphical i epresentation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MBD2 and MeCP2 to symmetrically methylated DNA oligonucleotides

[0043] Figure 23 is a giaphical representation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MeCP2 to symmetrically methylated DNA oligonucleotides

[0044] Figure 24 is a graphical i epresentation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MBD2 and MeCP2 to symmetrically methylated DNA oligonucleotides

[0045] Figure 25 is a gi aphical representation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MBD2 and MeCP2 to symmetrically methylated DNA oligonucleotides

[0046] Figure 26 is a graphical representation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MBD2 and MeCP2 to symmetrically methylated DNA oligonucleotides

[0047] Figure 27 is a giaphical representation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MBD2 and MeCP2 to symmetrically methylated DNA oligonucleotides

[0048] Figure 28 is a graphical representation of the ability of a chemical compound to inhibit binding ot the methyl-binding domain of MeCP2 to symmetrically methylated DNA oligonucleotides [0049| Figure 29 is a giaphicdl i epresentation of the ability of a chemical compound to inhibit binding of the methyl-binding domain of MeCP2 to symmetrically methylated DNA oligonucleotides

[0050] Figure 30 is a graphical i epresentation of inhibition binding assays of daidzein and daidzin with symmetrically methylated DNA oligonucleotides

[0051] Figure 31 is a gi aphical representation of inhibition binding assays of genistin and genistein with symmetrically methylated DNA oligonucleotides

DETAILED DESCRIPTION OF THE INVENTION

[0052] The present invention provides methods for using and identifying agents that are effective in reversing epigenetic silencing It is believed that such agents inhibit the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA thereby reversing epigenetically silenced genes

[0053] Of all the somatic genome changes that accumulate during the pathogenesis of human cancer, changes in DNA methylation appear to occur consistently, to arise early, and to be potentially reversible One such change in DNA methylation, increased CpG dmucleotide methylation at CpG islands encompassing the transcriptional regulatory regions of many genes, leads to the transcriptional "silencing" of critical cancer genes CpG island hypermethylation has been reported to inhibit gene transcription by interfering with the binding and/or function ot transci iptional transactivators, or by recruiting 5 mCpG-binding domain (MBD) family proteins capable of mediating transcriptional repression via effects on chromatin structure

[0054] One of the MBD family proteins, MeCP2, contains an approximately 70 amino acid minimal region that mediates selective binding to DNA containing 5 mCpG (an MBD motif), and a transcriptional iepiession domain (TRD) that permits interaction with the transcriptional repressor Sιιi3 and associated HDACs MeCP2 can thus act as a CpG island hypermethylation-dependent tianscriptional repressor by binding transcriptional regulatory sequences carrying 5 111CpG and recruiting HDACs For this reason, MeCP2-mediated inhibition of 5 111CpG -containing promoter activity can usually be alleviated by treatment with tπchostatin A, an inhibitor of HDACs [0055] Another MBD family protein, MBD2, which can also bind selectively to DNA containing 5 mCpG, has been found to be a component of a 1 MD transcription repression complex, MeCPl, that also contains the Mi-2/NuRD chromatin remodeling complex subunits MBD3, HDACl and HDAC2, histone-binding proteins RbAp46 and RbAp48, the SWI/SNF hehcase/ATPase domain-containing protein Mi2, MTA2, and two uncharacteπzed polypeptides of 66 and 68 KD

[0056] Though present in the Mi-2/NuRD complex, the MBD family protein MBD3 does not appear to recognize ^ "1CpG -containing DNA As a result, in the absence of MBD2, Mi- 2/NuRD complexes, capable of catalyzing ATP-dependent chromatin remodeling, are incapable of selectively binding hypermethylated transcriptional regulatory sequences In the MeCPl complex, MBD2 acts to iecruit the Mi-2/NuRD chromatin remodeling complex to mCpG -containing DNA Although MeCP2-mediated transcriptional repression can typically be alleviated by treatment with HDAC inhibitors, MeCPl -mediated inhibition of 5 "1CpG- containing promoter activ ity is often not affected by HDAC inhibitor exposure

[0057] Before the present compositions and methods are described, it is to be understood that this invention is not limited to particular compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only in the appended claims

[0058] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural ieferences unless the context clearly dictates otherwise Thus, for example, references to "the method" includes one or more methods, and/or steps of the type described herein which will become apparent to those persons skilled in the art upon reading this disclosure and so ioith

[0059] Unless defined otheiwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods and materials are now described [0060] As used herein, the teims "sample" and "biological sample" refer to any sample suitable for the methods piovided by the present invention The sample can be any sample that may be used such that MBD protein activity can be detected In one aspect, the sample is a biological sample, including, for example, a bodily fluid, an extract from a cell, which can be a crude extract or a fractionated extract, a chromosome, an organelle, or a cell membrane, a cell, genomic DNA, RNA, or cDNA, which can be in solution or bound to a solid support, a tissue, or a sample of an oigan A biological sample, for example, from a human subject, can be obtained using well known and routine clinical methods (e g , a biopsy procedure)

[0061] The present invention describes agents, such as chemical compounds, and the processes and assays used for their identification, that target MBD proteins for the treatment and/or prevention of numerous human diseases, including multiple cancers and sickle cell anemia, in which disruption of MBD-DNA and MBD-Protein interactions is beneficial Existing strategies foi epigenetics-based therapies do not target MBD proteins, but rather they target the upstream DNA methyltransferase (DNMT) enzymes, and/or the downstream histone modifying enzymes

[0062] One embodiment of the present invention provides methods for the identification of agents, such as chemical compounds, that are inhibitors of the transcriptional repression pathway mediated by the 5 m CpG-binding family domain (MBD) proteins MBD2 and MeCP2 Through the use of genetic experiments, both MBD2 and MeCP2 have been found to play critical roles both in the epigenetic "silencing" of genes, like GSTPI, in human cancer cells, and/or in the development of intestinal adenomas in ApcMm/+ mice Accordingly, the present invention involves, in part, the discovery of agents, that may be, for example, selective for MBD2-mediated transcriptional repression or capable of acting against both MBD2 and MeCP2, to levei se the epigenetic "silencing" of genes that are associated with cancer development

[0063] MBD proteins play a role in transcriptional repression accompanying CpG island hypermethylation in cancel cells Two MBD family proteins have been implicated in the silencing of critical genes in cancer cells carrying abnormally hypermethylated CpG island sequences (Figure 1 ) [0064] The terms "polynucleotide" and "oligonucleotide" also are used herein to refer to nucleic acid molecules Although no specific distinction from each other or from "nucleic acid molecule" is intended by the use of these terms, the term "polynucleotide" is used generally in reference to a nucleic acid molecule that encodes a polypeptide, or a peptide portion thereof, whereas the term "oligonucleotide" is used generally in reference to a nucleotide sequence useful as a probe, a PCR primer, an antisense molecule, or the like Of course, it will be recognized that an "oligonucleotide" also can encode a peptide As such, the different terms are used primarily for convenience of discussion

[0065] The terms "small interfeiing RNA" and "siRNA" also are used herein to refer to short interfering RNA or silencing RNA, which are a class of short double-stranded RNA molecules that play a vaπety of biological roles Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene In addition to their role in the RNAi pathway, siRNAs also act in RNAi- related pathways (e g as an antiviral mechanism or in shaping the chromatin structure of a genome)

[0066] A polynucleotide or oligonucleotide comprising naturally occurring nucleotides and phosphodiester bonds can be chemically synthesized or can be produced using recombinant DNA methods, using an appropriate polynucleotide as a template In comparison, a polynucleotide comprising nucleotide analogs or covalent bonds other than phosphodiester bonds geneially will be chemically synthesized, although an enzyme such as T7 polymerase can incorpoiate certain types of nucleotide analogs into a polynucleotide and, therefore, can be used to pi oduce such a polynucleotide recombinantly from an appropriate template

[0067] The present invention is based, in part, on the finding that MBD2-containing complexes are responsible for tianscπptional repression accompanying somatic CpG island hypermethylation at GSTPl , which is the most common somatic genome change yet reported for prostate cancer, and is also a common alteration in other cancers, such as breast and liver cancers

[0068] Accordingly, in one embodiment, the present invention provides a method of scieemng for an agent capable of reversing epigenetic silencing by inhibiting the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA In one embodiment the present invention provides a method for identifying an agent that inhibits the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA The method includes screening tor an agent that inhibits the interaction of an MBD protein with methylated DNA by contacting a sample comprising an MBD protein, an MBD protein- mediated gene having hypei methylated CpG islands and an MBD protein-mediated gene having non-hypermethylated CpG islands, with a test agent under conditions sufficient for transcription of the MBD piotein-mediated gene, detecting the transcriptional activity of the MBD protein-mediated gene, and comparing the difference in transcriptional activity between the MBD protein-mediated gene having hypermethylated CpG islands and the MBD protein-mediated gene having non-hypermethylated CpG islands in the presence and absence of the test agent An inci ease in transcription of the MBD protein- mediated gene having hypermethylated CpG islands as compared to the MBD protein-mediated gene having non- hypermethylated CpG islands, in the presence of the agent, identifies the agent as an inhibitor of the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA

[0069] An agent useful in any of the methods of the invention can be any type of molecule, for example, a polynucleotide, a peptide, a peptidomimetic, peptoids such as vinylogous peptoids, chemical compounds, such as organic molecules or small organic molecules, or the like, and can act in any of various ways to inhibit the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA to treat diseases, such as cancer and sickle cell anemia For example, the agent may be selective for MBD2- mediated transcriptional iepression or capable of acting against MBD2 or MeCP2, to reverse the epigenetic "silencing" of critical genes that accompanies cancer development Accordingly, in one aspect, an agent identified by the method of the present invention is a chemical compound Foi example the agent is a chemical compound selected from those shown in Table 2 Compounds of the invention can be modified and deπvatized at multiple functional groups to enhance pharmacokinetic, pharmacodynamic, and biochemical properties Such methods di e commonly known to those of skill in the art

[0070] Test agents encompass numerous chemical classes, though typically they are chemical compounds, such as an organic molecule, and often are small organic compounds (i e small molecules) having a molecular weight of more than 100 Daltons and less than about 2,500 Daltons Test agents comprise functional groups necessary for structural interaction with proteins, paiticularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxy 1 or carboxyl group, preferably at least two of the functional chemical groups The test agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups Test agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyπmidines, derivatives, structural analogs or combinations thereof

[0071] Test agents may be obtained from a wide variety of sources including libraries of synthetic or natural compounds For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means Known pharmacological agents may be subjected to diiected or random chemical modifications, such as acylation, alkylation, esteπfication, amidification to produce structural analogs

[0072] In another aspect, the method further includes determining whether an agent identified by the present invention is an inhibitor of a DNA methyltransferase (DNMT) protein by testing the ability of the agent to inhibit DNA methylation The agent may inhibit DNA methylation by DNMT proteins DNMTl, DNMT3a, and/or DNMT3b, in natural or recombinant forms, including fiagments thereof

[0073] It is known in the art that a variety of genes are involved in cancer, tumor, and metastasis Many of these genes have been found to contain regions of DNA hypermethylation in diseased tissues, including cancer, and may be MBD protein-mediated genes The list of imprinted genes continues to grow and includes at least 80 human and mouse genes Such hypermethylated genes, include but are not limited to GSTPl, APC, HIC-J, RASSFlA PTGS-2, EDNRB, MDR-I, ESRl, TIMP3, CDKN2A, CDKN2B, MLHl, MGMT DAPKl, CDHl ARF IGF2 H 19 p57/KIP2, KvLQTl, TSSC3, TSSC5, and ASCL2, among others Furtheπnoie, for a majority of these genes, if not for all of these genes, the expression is regulated by methylation, and hence also by hypermethylation Moreover, most of these genes, if not all or these genes, have multiple methylation sites, resulting in a fine- tuning of regulation, but also in aberration of regulation by hypermethylation In short, a gene may have one or moie methylation sites which may be subjected to hypermethylation These methylation sites may be located in the promoter region, including the regulatory regions, and methylation sites may also be located in the coding regions, and outside coding regions

[0074] Accoidingly, any of the above listed genes may be used in the screening method of the present invention An MBD piotein-mediated gene as described herein, is any gene whose transcription is mediated by an MBD protein The method of the present invention may employ the entire gene or any portion thereof, such as the promoter A "promoter" is a nucleic acid sequence that diiects the binding of RNA polymerase and thereby promotes RNA synthesis Promoter sequences include constitutive and inducible promoter sequences Exemplary promoter sequences include promoters from MBD protein-mediated genes, such as GSTPl The promoteis can be either naturally occurring promoters, hybrid promoters, or synthetic promoters Hybrid piomoters, which combine elements of more than one promoter, are also known in the art, and aie useful in the piesent invention

[0075] An MBD protein-mediated gene may further include a reporter gene or reporter molecule to facilitate detecting the transcriptional activity of the MBD protein-mediated gene For example, the piesent invention contemplates construction of promoter/reporter constructs There aie many genes and molecules that may be used in such a fashion, as well as methods of labeling known to those of ordinary skill in the art Examples of the types of reporters known in the art includes radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substiates, cofactors, inhibitors, or magnetic particles The reporter molecule oi gene can be visibly observable or detectable using conventional detection techniques In one embodiment the protein-mediated gene is a promoter/reporter construct including the promotei ot a protein-mediated gene operably linked to a reporter gene, such as a lucifei ase gene One illustrative example is a construct including a GSTPl promoter operably linked to either a Firefly luciferase gene or a Remlla luciferase gene

[0076] A nucleic acid is "opeiably linked" when it is placed into a functional relationship with another nucleic acid sequence For example, DNA for a presequence or secretory leader is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. The transcriptional and translational regulatory nucleic acid will generally be appropriate to the host cell used to express the MBD polypeptide, as will be appreciated by those in the art; for example, transcriptional and translational regulatory nucleic acid sequences from Baculovirus are preferably used to express the MBD protein in cells. Numerous types of appropriate expression vectors, and suitable regulatory sequences are known in the art for a variety of host cells.

[0077] However, detection of the transcriptional activity of the MBD protein-mediated gene need not be through a promoter/reporter construct. For example, the transcriptional activity may be detected using other methods well known in the art, such as monitoring the activity utilizing GeneChip platforms to monitor expression profiles and transcriptional activity. Accordingly, the MBD protein-mediated gene is not required to include a reporter.

[0078] The screening method of the present invention may be performed on a number of platforms and utilize a variety of cell types. The method of the present invention may be performed, for example, on a solid support platform, or may be performed using a cell based assay. A variety of cells may be used, those known in the art and those commercially available, as well as those isolated from a subject. Thus, cells may be any type of cancer cell, including prostate cancer cells. Additionally, the method may be performed using cells transfected with an MBD protein-mediated gene or gene construct, such as described in the Examples. As such, the method is particularly suited to be performed in a high-throughput fashion, (e.g., 96-well plate analysis; mechanical or robotic processing).

[0079] The screening strategy of the present invention may employ chimeric polypeptides containing an affinity or epitope tag, such as a poly-His, GST, HA, Flag, myc, or other tag well known in the art. Such tags allow proteins to be conveniently isolated and purified through the interaction ot the affinity or epitope tag with a cognate binding species, which can be a metal ion, glutathione, anti-HA antibody, anti-Flag antibody or anti-myc antibody, respectively, for the tags listed above Furthermore, the affinity tag can be used to anchor the polypeptide to a solid suppoit, such as a nickel-resin in the case of a His-tagged protein Also contemplated by the invention are tags or other modifications that may be added to a protein post-synthetically For example, a peptide can be biotinylated for affinity purification and immobilization using a\ idin or stieptavidin reagents

|0080] Thus, in one aspect, the MBD protein-mediated gene of the present invention is a recombinant, chimei ic oi fusion gene, expressed in vitro or in vivo The nucleic acid encoding the MBD piotein-mediated gene may be incorporated into an expression vector, which may be, for example, a self-replicating extrachromosomal vector, a vector which integrates into a host genome, or a linear nucleic acid that may or may not self-replicate Detailed descriptions of methods for (i) the construction of promoter/reporter constructs, (a) the assay of promoter function after transient tranfection, and (n) the quantitative detection of promoter mRNA by RT-PCR is well described in the art

[0081] MBD2 selectively binds the GSTPl CpG island when it is methylated, and siRNA- mediated reduction in MBD2 levels activates GSTPl expression despite CpG island hypermethylation (see the Examples) Similarly, cells from Mbd2 ' mice are unable to repress transcription fiom exogenously hypermethylated promoters in transient transfection assays Also, ApcMl" + Mbd2 mice develop far fewer intestinal adenomas, and survive longer, than do ApcMl" Mbd2+ or ApCM'"/+ Mbd2+/+ mice As for toxicity, other than a maternal behavior defect the Mbd2 mice appear fairly unremarkable, and have maintained nominal gene imprinting i epiession of endogenenous retroviral sequences, and no obvious ectopic gene expiession In contiast, Dnmtl Dnmt3a / , and Dnmύb 7 mice are not viable These observations show that MBD2-targeted drugs are able to reactivate "silenced" genes m cancer cells, or in pie-canceious lesions, with a significant margin of safety

[0082] Prevention and tieatment of cancer using methods of the present invention applies to all cancers associated with epigenetic gene "silencing" due to gene hypermethylation The terms "cell proliferative disoidei" or "cellular proliferative disorder" refer to any disorder in which the proliferative capabilities of the affected cells is different from the normal proliferative capabilities ot unaffected cells An example of a cell proliferative disorder is neoplasia Malignant cells (/ e cancer) develop as a result of a multistep process Cancer arises from the uncontrolled and/or abnormal division of cells that then invade and destroy the surrounding tissues As used herein, "proliferating" and "proliferation" refer to cells undergoing mitosis As used herein, "metastasis" refers to the spread of a malignant tumor from its sight of origin Cancel cells may metastasize through the bloodstream, through the lymphatic system, across body cavities, or any combination thereof The term "cancerous cell" as provided heiein, includes a cell afflicted by any one of the cancerous conditions provided herein Accordingly, types of cancer can include, but are not limited to, colorectal cancer, esophageal cancel , stomach cancer, leukemia/lymphoma, lung cancer, prostate cancer, uterine cancel , bi east cancel , skin cancer, endocrine cancer, urinary cancer, pancreatic cancer, othei gastrointestinal cancer, ovarian cancer, cervical cancer, head cancer, neck cancer, kidney cancel , livei cancer, bladder cancer, breast cancer or adenomas

|0083] A cell proliferative disorder as described herein may be a neoplasm Such neoplasms are either benign or malignant The term "neoplasm" refers to a new, abnormal growth of cells 01 a growth of abnormal cells that reproduce faster than normal A neoplasm creates an unstructuied mass (a tumor) which can be either benign or malignant The term "benign" refers to a tumoi that is noncancerous, e g its cells do not proliferate or invade surrounding tissues The tei m "malignant" refers to a tumor that is metastastic or no longer under normal cellular giowth control

[0084] As used herein, the term "ameliorating" or "treating" means that the clinical signs and/or the symptoms associated with the cancer or disease, such as sickle cell anemia, are lessened as a result of the actions performed The signs or symptoms to be monitored will be characteristic of a particulai cancel or melanoma and will be well known to the skilled clinician, as will the methods for monitoring the signs and conditions For example, the skilled clinician will know that the size or i ate of growth of a tumor can monitored using a diagnostic imaging method typically used foi the paiticular tumor (e g , using ultrasound or magnetic resonance image (MRl) to monitoi a tumoi )

[0085] The teim "subject" as used herein refers to any individual or patient to which the subject methods aie perloimed Generally the subject is human, although as will be appreciated by those in the art, the subject may be an animal Thus other animals, including mammals such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cow s, horses, goats, sheep, pigs, etc., and primates (including monkeys, chimpanzees, oi angutans and gorillas) are included within the definition of subject.

[0086] In one embodiment, the invention provides a method of reactivating a silenced gene having CpG island hypei methylation The method includes contacting a cell with an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby inci easing ti anscπption of the silenced gene. In one aspect, the agent is an inhibitor of the interaction of a methyl-binding domain (MBD) protein with methylated genomic DNA

[0087] The agent can be any agent identified by the present invention. In one example, the agent is a chemical compound In another example, the agent is a chemical compound selected from those shown in Table 2

[0088] In one aspect, the method may be applied to any hypermethylated gene. For example, the gene is selected Horn GSTPl, APC, HIC-I, RASSFlA, PTGS-2, EDNRB, MDR- 1, ESRl, TIMP3, CDKN2A, CDKN2B, MLHl, MGMT, DAPKl, CDHl, ARF, IGF2, H19, P57/KIP2, KvLQTl, TSSC3, TSSC5, or ASCL2 In one example the gene is GSTPl.

[0089] Reactivation of the silenced gene can be performed with cells in a subject. In one aspect, the method furthei includes administering the agent to a subject having a disease associated with an epigenetically silenced gene In one example the disease is cancer or sickle cell anemia

[0090] In another embodiment, the present invention provides a method of preventing or treating cancer associated with CpG island hypermethylation of a gene in a subject. The method includes administeπng to a subject an agent that modulates methyl-binding domain (MBD) protein-mediated transci iptional repression, thereby increasing transcription of the gene and thereby preventing or ti eating the cancer. As previously discussed, it is well known in the art that hypermethylation of a number of genes is linked to cancer. As such, one aspect of the present invention, includes increasing transcription of any of such genes that are transcriptionally repressed due entirely, or in part, of one or more MBD proteins. In one aspect, the gene is selected fi om GSTPl, APC, HIC-I, RASSFlA, PTGS-2, EDNRB, MDR-I, ESRl, TIMP3, CDKN2A CDKN2B, MLHl, MGMT, DAPKl, CDHl, ARF, IGF2, H19, p57/KIP2, KvLQTl, TSSC3, TSSC5, or ASCL2 In one example the gene is GSTPl. In another example, the MBD pi otein is MBD2 or MeCP2 However, the MBD protein can be any MBD protein that acts to mediate transcription of a "silenced" gene

[0091 ] In any of the methods of the piesent invention, the agent may be an inhibitor of the interaction of an MBD pi otein with methylated genomic DNA As such, the agent may interact directly with an MBD protein to inhibit or block binding or interaction of the protein with methylated DNA Foi example, the agent may interact directly with MBD2, with 5 "1CpG -containing DNA, or both, to prevent MBD2 from binding to 5 mCpG-contaimng GSTPl promoter sequences Alternatively, the agent may act indirectly through other proteins, such as binding to DNMTs or other proteins, resulting in inhibition of the interaction of an MBD piotein with methylated genomic DNA For example, the agent may target some other component of the MBD2 repression pathway

[0092] While the term agent is broadly defined above, in one aspect, the agent utilized by any of the methods ot the invention is a chemical compound Exemplary chemical compounds useful for piaUicing any method of the present invention are shown in Table 2

[0093] The terms "administiation" or "administering" are defined to include an act of providing a compound oi phaimaceutical composition of the invention to a subject in need of treatment The phrases 'pai enteral administration" and "administered parenterally" as used herein means modes oi administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular mtraoibital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, inti aarticulare, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion The phrases "systemic administration," "administered systemically," "peripheral administration" and "administered peripherally" as used herein mean the administi ation of a compound, drug or other material other than directly into the central nervous system, such that it enteis the subject's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration

[0094] The agent can be administered in any way typical of an agent used to treat the particular type of cancel , oi undei conditions that facilitate contact of the agent with the target tumor cells and, it appropπate, entry into the cells Entry of a polynucleotide agent into a cell, for example, can be facilitated by incorporating the polynucleotide into a viral vector that can infect the cells If a vital vector specific for the cell type is not available, the vector can be modified to exptess a receptor (or hgand) specific for a ligand (or receptor) expressed on the taiget cell, or can be encapsulated within a liposome, which also can be modified to include such a ligand (or receptor) A peptide agent can be introduced into a cell by various methods, including, ior example, by engineering the peptide to contain a protein transduction domain such as the human immunodeficiency virus TAT protein transduction domain, which can facilitate translocation of the peptide into the cell Generally, an agent is formulated in a composition (e g , a pharmaceutical composition) suitable for administration to the subject

[0095] In one aspect, the agent may be combined with known chemotherapeutic agents, including but not limited to, Aclacmomycins, Actinomycins, Adπamycins, Ancitabines, Anthramycins, Azacitidines, Azaseπnes, 6-Azauπdines, Bisantrenes, Bleomycins, Cactinomycins, Carmofui s, Cai mustines, Carubicins, Carzinophilms, Chromomycins, Cisplatins, Cladπbines, Cytdi abines, Dactmomycins, Daunorubicins, Denopteπns, 6-Diazo-5- Oxo-L-Norleucines, Doxiflui idines, Doxorubicins, Edatrexates, Emitefurs, Enocitabines, Fepirubicins, Fludarabines, Fluoiouracils, Gemcitabines, Idarubicins, Loxuπdines, Menogaπls, 6-Mercaptopui ines, Methotrexates, Mithramycins, Mitomycins, Mycophenohc Acids, Nogalamycins, Ohvomycines, Peplomycine, Pirarubicins, Piπtrexims, Phcamycins, Porfiromycins, Pteiopteπns, Puiomycins, Retinoic Acids, Streptonigπns, Streptozocins, Tagafurs, Tamoxifens, Thiamipnnes, Thioguanines, Triamcinolones, Tπmetrexates, Tubercidins, Vinblastines, Vinci istines, Zinostatins, and Zorubicins

[0096] In addition to ti eatment and pievention of cancer, methods of the present invention contemplate treatment ot sickle cell anemia Sickle cell anemia is caused by a point mutation in the beta-globin gene (HBb) Dimers of this mutant form of HBb multimeπze with dimers of alpha-globin (Hba) to make sickle hemoglobin (HBs) HBs is prone to polymerization, causing sickling of red blood cells, and subsequent aberrant interactions between the sickled red blood cells, immune cells, and endothelial cells that result in a complex spectrum of disease manifestations

[0097] One approach toi the tieatment of sickle cell anemia has been to prevent the polymerization ot HBs by inducing expression of gamma-globin, a component of the fetal form of hemoglobin that is noi mally silenced in adult tissues by DNA methylation and binding of MBD2 By this appioach. gamma-globin will compete with the mutant form of beta-globin to form fetal hemoglobin (HBf) instead of HBs The resulting decrease in the concentration of HBs will pievent foimation of the HBs polymers, as well as the downstream complications Hydioxyurea is the most commonly used therapy for re-expression of beta- globin and/or interruption of the HBs polymerization process However, the exact mechanism of hydioxyurea is not known, and may have many off target effects limiting potency and therapeutic w indow Other investigational drugs include DNA meihyltransferase nucleoside-analog inhibitors and histone-deacetylase inhibitors Such drugs have the disadvantages discussed in previous sections of this report MBD2 represents a target for treatment of sickle cell disease since it is apparently required for maintaining the silencing of gamma-globin MBD2 inhibitors reported in the present invention, for example, some of which are shown in Table 2, can be efficacious in the reactivation of gamma-globin, and useful as agents in the tieatment of sickle cell disease

[0098] Accordingly, in one embodiment the invention provides a method of preventing or treating sickle cell anemia in a subject The method includes administering to the subject an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby preventing or treating the sickle cell anemia For example, the agent increases transcription of the gamma-globulin gene In one aspect, the MBD protein is MBD2 or MeCP2 In anothei aspect, the agent is an inhibitor of the interaction of a methyl- binding domain (MBD) pi otem with methylated genomic DNA In another aspect, the agent is a chemical compound In another aspect, the agent is a chemical compound selected from those shown in Table 2

[0099] The following examples are provided to further illustrate the embodiments of the present invention, but are not intended to limit the scope of the invention While they are typical of those that might be used, other piocedures, methodologies, or techniques known to those skilled in the ait may alternatively be used

EXAMPLE 1

CPG ISLAND HYPERMETHYLATION IN THE PATHOGENESIS OF HUMAN

PROSTATE CANCER

[0100] Using quantitativ e DNA methylation-specific PCR (MS-PCR), the presence or absence of CpG island hypeimethylation at GSTPl, APC, HIC-I, RASSFlA, PTGS-2, EDNRB MDRl ESRl TIMF '3 CDKN2A CDKN2B, MLHl, MGMT, DAPKl, CDHl, and ARF, was assessed using genomic DNA from various human prostate cancer cell lines cultivated in vitro, as well as from primary and metastatic prostate cancer cases (Figures 2-4). Next, when laser capture micro-dissection was used to selectively isolate epithelial cells from normal prostate, from proliferative inflammatory atrophy (PIA) lesions, from prostatic intraepithelial neoplasia (PlN) lesions, and from prostatic cacinomas, analysis of genomic DNA by MS-PCR revealed the appearance of GSTPl CpG island hypermethylation in prostate cancer precursors (PlA and PIN) as well as prostate cancers (Figures 5-7).

[0101] MBD2 mediates repression of GSTPl genes with hypermethylated CpG islands in MCF-7 breast cancer cells GSTPl , encoding the π-class GST, has not only been reported to be the target of somatic CpG island hypermethylation in >90% of prostate cancers, but also in >80 % of liver cancers, and in >30 % of breast cancers. For each of these cancer cell types, GSTPl CpG island hypermethylation has been shown to be responsible for absence of GSTPl expression (Figure 8). The evidence that the MBD family protein MBD2 binds to hypermethylated GSTPl CpG island sequences to prevent GSTPl transcription is as follows: (i) MBD2 (along with DNMTl), but not the MBD family protein MeCP2, was detected bound to GSTP 1 promoter sequences, using chromatin immunoprecipitation (ChIP) analyses, in MCF-7 breast cancer cells only when the GSTPl CpG island was hypermethylated (Figure 9), and (ii) treatment of MCF -7 cells with siRNA targeting MBD2 mRNA, but not with siRNA targeting MeC P2 or /ennui A mRA, activated transcription from hypermethylated GSTPl promoters (Figure 10)

[0102] MBD2-mediated repression of transcription from hypermethylated GSTPl promoters can be recapitulated in transient transfection assays. When GSTPl promoter sequences were exogenously methylated by treatment with the CpG methyltransferase Sssl, and transfected into Hep3B liver cancer cells, MBD2, but not MeCP2, was attached to the promoter, as detected using ChIP analysis, and reporter expression was repressed in a manner that could be alleviated via siRNA "knockdown" of MBD2, but not MeCP2, levels (Figure i n. EXAMPLE 2 DISCOVERY QF SMALL MOLECULE MBD ANTAGONISTS

|0103] To identify and chai acteπze small molecules that antagonize MBD2-mediated repression of transcription horn genes with hypermethylated CpG islands, three objectives were pursued

[0104] A 2-stage "high-thi oughput" screening strategy identified "lead" compounds from a chemical diversity hbiai y (a ChemBπdge collection of n = 10,000 compounds) A 2-stage screening strategy exploited the dependence of transcriptional repression associated with GSTPl CpG island hypeπnethylation on MBD2, to identify MBD2 pathway inhibitors (see Example 1) siRNA-tπggei ed "knock-down" of MBD2 protein levels in human cancer cells is known to alleviate repiession of hypermethylated GSTPl promoter sequences both for transfected promoter/repot tei constructs (Figure 1 1), the basis for the first screening stage, and for native GSTPl alleles in situ (Figure 10), the basis of the second screening stage The integrated screening strategy inv olved stage 1, a readily scalable cell-based screening approach focused on tiansfected GSTPl promoter/reporter constructs, and stage 2, a confirmatory cell-based assay monitoied reactivation of "silenced" GSTPl alleles in situ via quantitative reverse ti anscuptase-PCR (RT-PCR) measurements of GSTPl mRNA levels 10,000 compounds fiom the ChemBπdge PHARMCOPHORE™ collection were screened

[0105] A 2-stage screening strategy for MBD2 transcription repression pathway antagonists stage 1 The fu st stage of the screening strategy for MBD2 hypermethylated CpG island transcriptional iepression pathway inhibitors features the use of two GSTPl promoter/lucifei ase iepoitei constructs one treated with Sssl CpG methyltransferase controlling Firefly lucifei ase, the other left free of 5 "1CpG controlling Renilla luciferase After simultaneous tiansfection into cancer cells and exposure to chemical library compounds in multi-well plates, sevei al patterns of tianscπption induction were distinguished (i) compounds that induce both hypermethylated and unmethylated promoter sequences, (n) compounds that aie incapable ot augmenting expression from either promoter, (n) compounds that selectively activate unmethylated promoter sequences, and (iv) compounds, defined as "hits," that selectively inciease expression from hypermethylated promoter sequences (Figure 12) [0106] In prehminaiy experiments, siRNA targeting MBD2 mRNA ("knockmg-down" MBD2 polypeptide levels) gave a "hit" pattern of promoter induction (Figure 11) To adjust for short-term toxicity to the cancel cells, simultaneous screening of the chemical library compounds for rapid cancel cell killing via an XTT assay was performed Using this strategy, 10,000 CheinBi idge PHARMCOPHOREI M compounds, at a concentration of l OμM, were screened foi MBD pathway antagonism using MCF-7 cells in a 96-well cell culture format (Figui e 13) The performance characteristics of the screening assay incorporated stage 1 screening iesults (restricted to non-toxic compounds by XTT assay) were displayed as the ratio (/ ) of Firefly luciferasβ induction to Renύla luciferase induction (r = Ft/Fu - Rt/Ru where F1 = Firefly luciferase activity in a compound-treated well, Fu = Firefly luciferase activity in a conti ol well, Rt = Renilla luciferase activity in a compound-treated well, and Ru = Renilla liicifei ase activity in a control well), a "cut-off value of r > 1 5 with F,/Fu > 1 0 provided a 1 42% "hit" iate

[0107] The second stage of the scieenmg strategy involved subjecting "hits" identified in stage 1 to a "medium-thioughput" assay testing whether "hit" compounds could increase GSTPl mRNA expicssion li om cells with hypermethylated GSTPl CpG islands For this assay approach, quantitative RT -PCR for detection of GSTPl mRA was adapted to 96-well plate format As with the stage 1 screening assay, the stage 2 assay correctly identified siRNA targeting MBD2 mRNA as a "lead" (Figure 10) The performance characteristics of this screening activity also appear reasonable of 142 "hits" from stage 1 screening of 10,000 ChemBπdge PHARMCOPHORE I M compounds, 24 (1 69% of "hits" and 0 24% of total compounds screened) induced GSTPl mRNA expression in MCF-7 cancer cells For each "lead" compound, the stage 2 scieenmg assay was used to assess dose-response properties, providing potency ( ECMJ) and efficacy (maximal GSTPl mRNA induction) data (Figures 14- 15)

[0108] Detailed desci iptions of methods have been described for (i) the construction of hypermethylated GSTPl promotei/ieporter constructs, (n) the assay of GSTPl promoter function after transient tianiection, and (π) the quantitative detection of GSTPl mRNA by RT-PCR

[0109] Construction of GSTPl promotev-Remlla luciferase and pGSTPl -Firefly luciferase and treatment of plasmids with .S SΛ I CpG methylase GSTPl promoter sequences (GenBan positions -408 to +36), recovered from pGSTPl -CA T via excision using Hindlll and Sail and cloning in pBluescriptI M (Stratagene), were introduced into pGL3-Basic™ (Promega), a promoter-less vector containing Firefly lucifrase cDNA, and into pRL-null (Promega), a promoter-less vector containing Renilla lucifrase cDNA. Methylation of GSTPl CpG island sequences in promoter/reporter plasmid constructs was accomplished using the CpG methylase Sss\ (New England BioLabs). The reaction mixtures featured 200μg plasmid DNA, 160μM S-adenosylmethionine, and 200,000 units Sssl in 5OmM NaCl, 1OmM tris-HCl, 1OmM MgCb, and I mM DTT; the mixture was incubated at 37°C for 60 minutes.

[0110] Assessment of GSTPl promoter activity. Growing MCF-7 cells were simultaneously transfected with S.ss I -treated pGSTPl promoter-Firefly luciferase and non- •Sssl-treated pGSTPl promoler-Renilla luciferase constructs as described previously, seeded into 96-well plates, and exposed to various small molecule inhibitor candidates (at lOμM) in complete growth medium. To assess reporter gene expression, the transfected cells were lysed 48 hours after small molecule inhibitor exposure and then assayed for luciferase activity using the DUAL-LUC1FERASE© REPORTER ASSAY SYSTEM from Promega.

[0111] The ChemBridge PHARMCOPHORE™ library of chemical compounds. The PHARMCOPHORE™ diverse chemical library from ChemBridge contains 100,000 compounds, 10,000 of which were used in the "high-throughput" screening assay of the present invention. Quality control testing at ChemBridge reveals > 90% purity by NMR for 94% of library compounds. Also, sufficient quantities of "hit" compounds are available at ChemBridge for re-supply to permit characterization studies. At the Johns Hopkins University School of Medicine, access to the ChemBridge PHARMCOPHORE™ compounds is facilitated by the High Throughput Biology (HiT) Center. The HiT Center serves as a Core Resource at the School of Medicine to provide access to chemical diversity libraries, robotic technologies for expanding the scope of screening studies, and consultation for the design of screening assays. The initial 10,000 ChemBridge PHARMCOPHORE™ compounds used were obtained from the HiT Center.

[0112] XTT assay for cell viability. MCF-7 cells, 24 hours after seeding into 96-well cell culture dishes at 5 X 103 cells/well, were exposed to ChemBridge PHARMCOPHORE™ library compounds at a concentration of l OμM. 48 hours later, 50μL XTT labeling mixture (Roche Molecular Biochemicals) was added to each cell culture well. After 4 hours incubation at 37°C, cell v iability was assessed by monitoring absorbance (A492nm - A690nm), which was measuied ioi each well and compared to the mean and standard deviation for each plate Compounds ai e designated as "toxic" if the absorbance is less than two standard deviations below the plate mean

[0113] Characteπzation of "lead" compounds identified by the "high-throughput" screen "Lead" compounds identified by the 2-stage screening approach activated expression from hypermethylated GSTPl CpG island alleles These "lead" compounds accomplish this feat by interacting directly with MBD2, with 5 mCpG-containing DNA, or both, to prevent MBD2 from binding to 5 mCpG-containmg GSTPI promoter sequences Alternatively, the "lead" compounds act indii ecth by taigeting some other component of the MBD2 repression pathway Both direct and indii ect MBD2 pathway inhibitors are appropriate for further attention In addition, some "lead" compounds might reactivate expression from hypermethylated GSTPl CpG island alleles via a mechanism independent of MBD2, such as by inhibition of DNMTs As described above, the 2-stage screening assay employed would be unlikely to identify compounds that solely inhibit DNMTs as "leads " However, like MBD2, DNMTs recognize and bind DNA sequences containing 5 "1CpG As a consequence, some "lead" compounds might act both to interfere with MBD2 binding to 5 "1CpG containing DNA and to inhibit DNMTs

[0114] To detei mine if the "lead" compounds directly interfere with MBD2 binding to "1CpG containing DNA, each "lead" compound is tested for its ability to inhibit such binding using a DNA-protein binding assay Foi this assay, a biotinylated and methylated oligonucleotide substi ate is bound to a neutravidin-coated high binding capacity 96-well plate His-tagged M BD2 M BD or MeCP2_MBD binds to the methylated oligonucleotide An Anti-His-HRP conjugated antibody is used to detect bound protein Introducing the "lead" compounds into the i eaction mix at various concentrations provides a MBD2 MBD- DNA binding curve from w hich an IC50 is derived

[0115] To ascertain whethei any of the "lead" compounds inhibit DNMTs, the compounds are tested for ability to inhibit DNA methylation catalyzed by recombinant DNMTl, DNMT3a, and/or DNMT3b The outputs of these experiments were K/s for each of the DNMT enzymes When consideied along with potency and efficacy data from the screening assays, the results of analyses ol "lead" compounds for interference with MBD2 binding to 5 mCpG-contaming DNA loi dii ect binding to 5 mCpG-containmg DNA, and for inhibition of DNMTs allow pπoπti/ation of "lead" compounds Ideally, "lead" compounds that activate expression from GSTPl alleles with CpG island hypermethylation at sub-μM concentrations, target MBD2 directly and tail to inhibit DNMTs, are high-priority "lead" compounds

[0116] Finally to iuithei assess the "on-target" and "off-target" properties of high-priority "lead" compounds the effects of such compounds on global gene expression profiles m cancer cells, in compai ison to the effects of siRNA "knock-down" of MBD2 expression, is contemplated to be analyzed Anticipating these analyses, the consequences of targeted MBD2 "knock-down," vei sus "knock-down" of MeCP2 and DNMTl, on gene expression in MCF-7 cells have been exploi ed via transcπptome profiling (Figure 17)

[0117] DNA binding assays using recombinant MBDs To produce recombinant His6- tagged MBD polypeptides horn human MBD2 (MBD2-MBD), MBD2-MBD cDNA was amplified from clone MGC-45084 (American Type Culture Collection), using PCR primers containing BamHl and CcoR\ recognition sites (5'-

GGATCCATGGAGAGCGGGAAGAGGATGGA-S' (SEQ ID NO 1) and 5'- GAATTCCATCTTTCC AGTTCTGAAGT-3' (SEQ ID NO 2)), and then introduced into pFBC6H, a modified pFastBac- 1 R) baculovirus expression vector (Invitrogen), that had been linearized via cutting with /Yo/? I and Xba\ This pFB6H-MBD2 expression construct was used to transform DH 1 OBac ' M L coli competent cells (Invitrogen) to form an MBD2 expression bacmid via site-specific transposition The MBD2 expression bacmid was then transfected into Sf9 insect cells foi pioduction of recombinant MBD2 baculovirus particles, which were used to infect SfP cells ( 1 MOI, 48 hours) to generate recombinant MBD2 protein To recovei iecombinant MBD2 protein, the infected Sf9 cells were homogenized, using a Dounce homogenize! in a buffer containing 2OmM HEPES, 25% glycerol, 0 42M NaCI, 1 5mM MgCb, 0 2mM EDT A, 0 5mM PMSF, 0 5μg/mL Leupeptm, and 0 5mM DTT After centπfugation in a miciotuge, the soluble protein fraction, containing MBD2, was recovered A similar approach was used for producing cloned recombinant MeCP2 For binding assays, biotinylated 45-bp oligonucleotide (Top Strand 5'- GA5 "1CGT5 "1CGTT5 "1CGTA5 "1CGCT' "1CGTT' "1CGACT' "1CGTG5 "1CGA5 "1CGGAT5 "1CGGATTG 3' (SEQ ID NO 20), Bottom Stiand 5' C AATCC5 "1GATC5 "1CGT5 "1CGCA5 "1CGAGT5 "1CGAA5 "1CGAG5 "1CGTA5 111CGAA' "1CGA' "1CGTC 3' (SEQ ID NO 3)) is combined with MBD2_MBD or MeCP2_MBD (O.25μM) in binding buffer (1OmM NaCl, ImM EDTA, 25mM Tris-HCl (pH 7.4) "Lead" compounds (diluted in DMSO) are added to each well at various concentrations and incubate in reaction mix for 1 hour at RT in a neutravidin-coated high binding capacity 96-well plate (Pierce, 15507). After washing wells twice with binding buffer, protein is incubated with Anti-His-HRP conjugated Ab (1 : 1000) (Qiagen, 34460) for 1 hour at RT. After washing four times with binding buffer and drying wells, TMB is added to each well followed by 1 N HCl, and A450 is measured on a microplate reader. The IC50 for each "lead" compound is derived from the DNA-protein binding curve.

[0118] DNMT assays using recombinant DNMTl , DNMT3a, and DNMT3b. To produce recombinant DNMTl , full-length DNMTl cDNA was amplified in two segments by RT-PCR from human brain poly A+ RNA (BD Clontech). Amplification of the upstream segment was performed using the PCR primers (5' -CCTCTCTCCGTTTGGTACATCC-3' (SEQ ID NO:4) and 5' -CACAGGTG ACCGTGCTTACAGT-3' (SEQ ID NO:5)), and amplification of the downstream segment was performed using the PCR primers (5'- AGCACAAACTGACCTGCTTCAG-3' (SEQ ID NO:6) and 5'-

ATCAGTGCATGTTGGGGATTC-3' (SEQ ID NO:7)). The upstream and downstream segments were subcloned into the pCMKscript® vector (Stratagene), and assembled using an internal BstEW site that is common to both segments to create pCMFscript-DNMTl . PCR primers containing EcoIU and Kpiή sites (5'-GAATTCCCGGCGCGTACCG-S' (SEQ ID NO:8) and 5'-GGTACCCTAGTCCTTAGCAGCTTCCTCCT-S' (SEQ ID NO:9)) were used to amplify the DNMTl coding sequence from pCMKscript-.DNM77. The product was subcloned into pFB6H, a modified pFastBac-1® baculovirus expression vector (Invitrogen) that contains a 6xHis tag (SEQ 1D ΝO:21 ). This pFB6H-DNMTl construct was used to transform DH 10Bac i M E cυh competent cells (Invitrogen) to generate a recombinant expression bacmid via site-specific transposition. The DNMTl expression bacmid was transfected into Sf9 insect cells to produce recombinant DNMTl baculovirus particles, which were subsequently used to infect additional Sf9 cells (1 MOI, 48 hours) for protein production. Recombinant His((,)-(SEQ ID NO:21 )-DNMTl was recovered by Ni2+ affinity chromatography. After lysis in 5OmM Na2HPO4 pH 7.6, 1OmM imidazole, 50OmM NaCl, 1 % Igepal CA-630, 10% glycerol, and I x Complete™ Protease Inhibitor (Roche) by two freeze-thaw cycles, Hιs(())-(SEQ ID NO:21 )-DNMT1 was bound to Ni-NTA agarose (Qiagen) for 1.5 hours at 4°C. The supei natant was removed, and the beads were washed twice with 5OmM Na2HPO4 pH 7.6, 2OmM imidazole, 50OmM NaCl, 10% glycerol, and Ix Complete™ Protease Inhibitor to remove contaminating proteins. The beads were then washed twice with 5OmM Na2HPO4 pH 7.6, 1 OmM NaCl, 10% glycerol, and Ix Complete™ Protease Inhibitor to remove excess salt. His(6)-(SEQ ID NO:21 )-DNMTl was eluted from the Ni-NTA agarose by adding 50 mM Na2HPO4 pH 7.6, 250 mM imidazole, 1OmM NaCl, 10% glycerol, and Ix Complete1 M Protease Inhibitor. Spin dialysis was used to concentrate the protein and exchange the buffer 5OmM Na2HPO4 pH 7.6, 1 OmM NaCl, ImM EDTA, ImM DTT, 20% glycerol, and Ix Complete I M Protease Inhibitor. Protein concentration was determined using the BCA assay (Pierce). Recombinant DNMTl was stored at -800C until further use.

[0119] His(6)-(SEQ ID NO:21 )-DNMT3a and His(6)-(SEQ ID NO:21)-DNM3b2 were expressed and purified in Sf9 cells as described above with the following modifications. Full length DNMT3a cDNA was amplified from human testis Poly A+ RNA by RT-PCR with the primers (5'-GCTCAACACCGGGATCTATGTT-3' (SEQ ID NO: 10) and 5'- CTACCTCAGTTTGCCCCC ATGT-3' (SEQ ID NO: 1 1)) and subcloned into pCR-Bluntl- TOPO® vector (Invitrogen). PCR primers containing EcoRl and Xba\ sites (5'- GAATTCCCCGCCATGCCCTC-3' (SEQ ID NO: 12) and 5'-

TCTAGATTAC AC AC ACGC A AATACTCCTTC-3' (SEQ ID NO: 13)) were used to amplify the DNMT3a coding sequence from pCR-Bluntll-TOPO-DNMHα. The product was subcloned into pFB6H to create pFB6H-DNMT3a. Full length DNMT3b2 cDΝA was amplified from human testis Poly A+ RΝA by RT-PCR with the primers (5'- ATGAAGGGAGACACCAGGCA-3' (SEQ ID NO: 14) and 5'-

GGATGCCTTCAGG AATCACAC-3' (SEQ ID NO: 15)) and subcloned into pCR-Bluntll- TOPO® vector (Invitrogen). PCR primers containing EcoBΛ and Xba\ sites (5'- GA ATTCAAGGGAG ACACCAGGCATCT-S1 (SEQ ID NO: 16) and 5'- TCTAGACTATTCAC ATGC A A AGTAGTCCTTCAG-3' (SEQ ID NO: 17)) were used to amplify the DNMT3b2 coding sequence from pCR-BluntI-TOPO-DNMT3b2. The product was subcloned into pFB6H to create pFB6H-DNMT3b2.

[0120] DNA methyltransferase activity assays were performed by combining 10OnM His(6)-(SEQ ID NO:2 1 )-DNMT with 5' - biotinylated synthetic hemi -methylated or unmethylated oligonucleotide substrate containing lμM CG (Top Strand 5' - GA CGTCGTTCGTACGCTCGTTCG ACTCGTGCGACGGATCGGATTGTTATG-3' (SEQ ID NO: 18), Bottom Strand 5'-

CATAACAATCCGATCCGTCGCACGAGTCGAACGAGCGTACGAACGACGTC-S' (SEQ ID NO: 19)) and lμM S-adenosyl-L-[methyl-3H]methionine™ (Amersham TRK581 60- 85Ci/mmol). After incubation at 37°C for 30 minutes, reactions were stopped by adding one volume of 1OmM cold S-adenosyl-L-methionine™ (Sigma). To purify the oligonucleotides, reactions will be added to a SAM2© 96 Biotin Capture Plate (Promega). The plate was washed 7 times with PBS + 2M NaCl and 3 times with dH20 to remove His(6)-(SEQ ID NO:21 )-DNMTl and S-adenosyl-L-methionine. After drying the plate, 30μl Microscint-PS TM scintillation fluid (Packard) was added to each well, and tritium was quantitated using the TopCount™ NXT liquid scintillation counter (Packard). Using this approach, procainamide was found to inhibit DN MT l , via a mixed mechanism, with a K, = 7.2μM, and to inhibit DNMT3a with a K, = 1.4mM ( Figures 18-20). Twelve of the 24 compounds have tested negative for DNMTl inhibition.

[0121] Compounds that interfere with MBD binding to 5"meCpG-Containing DNA and/or reactivate epigenetically silenced gene expression are summarized in Table 2.

Table 2.

to +++)

(VIII) Untested Untested Untested +++

(IV) Untested Untested Untested

(X) No Untested >200 +++ Inhibition

(XI) Untested Untested Untested +++

(XII) Untested Untested Untested +++

[0122] Although the invention has been described with reference to the above example, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.

CLAIMS

What is claimed is

1 λ method of screening for an agent that inhibits the interaction of a methyl-binding domain (MBD) piotein with methylated genomic DNA comprising

a) contacting a sample comprising an MBD protein, an MBD protein-mediated gene having hypermethylated CpG islands and an MBD protein-mediated gene having non- hypermethylated CpG islands, with a test agent under conditions sufficient for transcription of the MBD protein-mediated gene,

b) detecting the transcriptional activity of the MBD protein-mediated gene, and

c) comparing the difference in transcriptional activity between the MBD protein- mediated gene having hypermethylated CpG islands and the MBD protein-mediated gene having non-hypermethylated CpG islands in the presence and absence of the test agent,

wherein an increase in transcription of the MBD protein-mediated gene having hypermethylated CpG islands as compared to the MBD protein-mediated gene having non- hypermethylated CpG islands, in the piesence of the agent, identifies the agent as an inhibitor of the interaction ot a methyl-bmding domain (MBD) protein with methylated genomic DNA

2 The method of claim 1 , wherein the agent is a chemical compound

3 The method ot claim 1 , wherein the MBD protein is methyl-CpG binding domain protein 2 (MBD2) or methyl CpG binding protein 2 (MeCP2)

4 The method of claim 1 further compi ising determining whether the agent of claim 1 is an inhibitor of a DNA methyltransferase (DNMT) protein by testing the ability of the compound to inhibit DNA methylation

5 The method of claim 1 , wherein the MBD protein-mediated gene includes a promoter region 6 The method of claim 5, wherein the promoter is a GSTPl promoter.

7 The method of claim 6, wherein the MBD protein-mediated gene further comprises a reporter gene or reporter molecule

8. The method of claim 7, wherein the reporter molecule is selected from radionuclides, enzymes, fluorescent, chemiluminescent, oi chromogenic agents as well as substrates, cofactors, inhibitors, or magnetic particles

9 The method of claim 7, wherein the reporter is a luciferase gene.

10 The method of claim 1 , wherein the transcriptional activity is detected using a reporter.

1 1 The method of claim 1, wherein the sample comprises a cell sample.

12 The method of claim 1 1 , wherein the cell sample contains cancer cells.

13 The method of claim 12, wherein the cancer is prostate cancer.

14. The method of claim 1, which is pei formed in a high throughput format.

15 A method of preventing or treating cancer associated with CpG island hypermethylation of a gene in a subject comprising administering to the subject an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby increasing transcπption of the gene and theieby preventing or treating the cancer.

16 The method of claim 15, wherein the gene is selected from GSTPl, APC, HIC-I, RASSFlA, PTGS-2, EDNRB, MDR-I , ESRl , TIMP3, CDKN2A, CDKN2B, MLHl, MGMT, DAPKl , CDH l , ARF, 1GF2, H 19, p57/KIP2, KvLQTl , TSSC3, TSSC5, or ASCL2.

17 The method of claim 16, wherein the gene is GSTPl

18 The method of claim 15, wherein the MBD protein is MBD2 or MeCP2.

19 The method of claim 15, wherein the cancer is selected from colorectal cancer, esophageal cancel, stomach cancer, leukemia/lymphoma, lung cancer, prostate cancer, uterine cancer, bi east cancer, skin cancer, endocrine cancer, urinary cancer, pancreatic cancer, other gastrointestinal cancer, ovai ian cancer, cervical cancer, head cancer, neck cancer, kidney cancer, liver cancer, bladdei cancer, breast cancer or adenomas

20 The method of claim 19, wherein the cancer is prostate, kidney, liver, bladder, lung, breast or colon cancer

21 The method of claim 20, wherein the cancer is prostate cancer

22 The method of claim 15, wherein the agent is an inhibitor of the interaction of a methyl- binding domain (MBD) protein with methylated genomic DNA

23 The method of claim 15, wherein the agent is a chemical compound

24 The method of claim 15, wherein the subject is a human

25 A method of preventing or treating sickle cell anemia in a subject comprising administering to the subject an agent that modulates methyl-binding domain (MBD) protein- mediated transcriptional repression, theieby preventing or treating the sickle cell anemia

26 The method of claim 25, wherein the MBD protein is MBD2 or MeCP2

27 The method of claim 25, wherein the agent increases transcription of the gamma-globulin gene

28 The method of claim 25, wherein the subject is a human

29 The method of claim 25, wherein the agent is an inhibitor of the interaction of a methyl- binding domain (MBD) protein with methylated genomic DNA

30 The method of claim 25, wherein the agent is a chemical compound

31 A method of reactivating a silenced gene having CpG island hypermethylation comprising contacting a cell with an agent that modulates methyl-binding domain (MBD) protein-mediated transcriptional repression, thereby increasing transcription of the silenced gene

32 The method of claim 3 1 , wherein the agent is an inhibitor of the interaction of a methyl- binding domain (MBD) protein with methylated genomic DNA

33. The method of claim 31 , wherein the agent is a chemical compound.

34. The method of claim 31 , wherein the MBD protein is MBD2 or MeCP2.

35. The method of claim 31 , wherein the gene is selected from GSTPl , APC, HIC-I, RASSF lA, PTGS-2, EDNRB, MDR-I, ESRl , T1MP3, CDKN2A, CDKN2B, MLHl, MGMT, DAPK 1 , CDH 1 , ARF, IGF2, H 19, p57/KIP2, KvLQT 1 , TSSC3, TSSC5, or ASCL2.

36. The method of claim 31 , which comprises administering the agent to a subject having cancer.

37. The method of claim 31 , which comprises administering the agent to a subject having sickle cell anemia.

38. The method of claims 36 or 37, wherein the subject is a human.

39. The method of claim 36, wherein the cancer is selected from colorectal cancer, esophageal cancer, stomach cancer, leukemia/lymphoma, lung cancer, prostate cancer, uterine cancer, breast cancer, skin cancer, endocrine cancer, urinary cancer, pancreatic cancer, other gastrointestinal cancer, ovarian cancer, cervical cancer, head cancer, neck cancer, kidney cancer, liver cancer, bladder cancer, breast cancer or adenomas.

40. The method of claim 39, wherein the cancer is prostate, kidney, liver, bladder, lung, breast or colon cancer.

41. The method of claim 40, wherein the cancer is prostate cancer.

42. The method of any one of claims 2, 23, 30 or 33, wherein the chemical compound is selected from the group consisting of compounds 1-XXV, or a combination thereof:

II

IV

V

VI

VII

VIII

IX

X

XIl

XIII

XV

XVI

XVII

XVlII

XIX

XX

XXI

XXII

XXIII

XXlV

XXV

43. The method of claim 30, wherein the chemical compound is selected from the group consisting of compounds I-II1, or a combination thereof:

II

III


Feedback