Fungal Strains And Methods Of Use



[001] The present application claims priority to currently pending U.S. Provisional Patent Application Serial No. 62/113,905, filed February 09, 2015 and U.S. Provisional Patent Application Serial No. 62/173,511, filed June 10, 2015.


[002] The present disclosure relates to an engineered, transformed or derivative fungal strain capable of producing an altered level of a protein of interest, and the methods of genetically modifying a fungal strain such that it has an ability to produce an altered level of protein of interest. Moreover, the present disclosure pertains to a protein of interest produced by fermenting this engineered, transformed or derivative fungal strain and a composition comprising this protein of interest. Furthermore, the present disclosure pertains to a method of producing a protein of interest employing an engineered, transformed or derivative fungal strain, as well as a method of producing and using a composition comprising this protein of interest. The proteins of interest herein may be endogenous proteins or heterologous proteins. The present disclosure also relates to a method for identifying or selecting for an engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain.


[003] The contents of the electronic submission of the text file Sequence Listing, named "40733-PCT-SEQ_Listing.txt" was created on February 08, 2015 and is 30 KB in size, is hereby incorporated by reference in its entirety.


[004] This application contains a reference to a deposit of biological material, which deposit is incorporated herein by reference. Specifically CBS 140022, a Trichoderma reesei strain RLP37 Nikl (M743T) was deposited under the terms of the Budapest Treaty on the international Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure at Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Institute of the Royal Netherlands Academy of Arts and Sciences (KNAW), Uppsalalaan 8, 3584 CT Utrecht, the Netherlands. BACKGROUND OF THE INVENTION

[005] Fungi are known for their commercial applications both as industrial products for their endogenous proteins, and as expression hosts for producing industrially useful proteins. In an example of the direct industrial use of fungi, filamentous fungal strains such as Trichoderma reesei, Humicola insolens, Fusarium oxysporum, and the like, have been applied directly on cellulosic biomass to help break down cellulose and hemicellulose components of such materials into small polymeric and/or monomeric sugars that can be further processed into industrially useful substances. However such direct uses have thus far proven not economically viable largely because of the inherent limitations of the amount of total proteins/enzymes that might be produced by these organisms, especially when counterbalanced by the high levels of enzymatic activities that would be required to break down recalcitrant substrates such as cellulosic biomass.

[006] On the other hand, the use of fungal strains as production hosts for proteins of interest have long been deemed economically viable and widely used in commercial settings for some time. Filamentous fungi's capacity to secret complex proteins, accurately folded into their 3-dimensional structures and disulfide bonds, precisely proteolytically clipped following translation, and relatively predictably glycosylated with n-linked and o-linked glycosylation reactions, renders these organisms highly attractive hosts for producing secreted proteins (MacKenzie, D. A. et al, J Gen Microbiol (1993) 139:2295-2307; Peberdy, J. F, Trends in BioTechnology (1994) 12:50-57). Fungi are known to be efficient enzyme producers for biomass hydrolysis, food and feed additives, textile application, grain processing, cleaning and other industrial usages.

[007] The use of fungal expressed proteins for industrial processes is widespread and steadily increasing, especially given the present interest in employing industrial processes involving enzymes to generate fuels and chemicals from non-petroleum renewable materials or sources. Various techniques of improving the expression of proteins have been developed in the field. Those include, for example, classical strain improvement methods such as subjecting strains to multiple rounds of mutagenesis and selection for high producers, building or genetically engineering a production strain with high copy number of gene of interest inserted into the genome. While many of these methods are effective at improving productivity of the strain, they have limitations including, for example, the labor intensity of strain construction exercise typically required for making each individual product. Therefore, there remains a need for the obtaining of improved fungal strains capable of increased protein production for single proteins of interest, or for panels of proteins of interest, or even for endogenous proteins.


[008] The present disclosure relates to an engineered, transformed or derivative fungal strain capable of producing an altered level of a protein of interest, and the methods of genetically modifying a fungal strain such that it has an ability to produce an altered level of protein of interest. Moreover, the present disclosure pertains to a protein of interest produced by fermenting this engineered, transformed or derivative fungal strain and a composition comprising this protein of interest. Furthermore, the present disclosure pertains to a method of producing a protein of interest employing an engineered, transformed or derivative fungal strain, as well as a method of producing and using a composition comprising the protein of interest. The present disclosure also relates to a method for identifying or selecting for an engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain.

[009] In a first aspect, the present disclosure provides an engineered fungal strain, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the fungal strain comprises a variant histidine kinase gene and/or expresses a variant histidine kinase.

[0010] In some embodiments, the variant histidine kinase gene is a variant of a wild type histidine kinase gene which encodes a hybrid-type histidine kinase. In some embodiments, the variant histidine kinase gene is a variant of a wild type gene encoding a group III histidine kinase. In certain embodiments, the variant histidine kinase gene encodes a polypeptide that functions as part of a signaling pathway that responds to external osmotic pressure. Strains with mutations in the histidine kinase can be identified by screening for resistance or sensitivity to certain antifungal compounds, such as, for example, in the presence of high levels of a dicarboximide fungicide such as iprodione or fludioxonil in the medium. It is to be expected that mutations in other components of this signaling pathway would also be beneficial. These components include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure. Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of sorbitol or salt in the medium. Therefore, relatedly, the present disclosure also provides a method of identifying fungal strains having resistance or sensitivity to osmotic stress, which are advantaged as host organisms useful for producing industrially useful molecules.

[0011] In certain embodiments, a variant histidine kinase gene encodes a polypeptide comprising an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 1 or SEQ ID NO: 43, but is not 100% identical to SEQ ID NO: l or SEQ ID NO: 43.

[0012] In certain embodiments, the variant histidine kinase gene of the engineered fungal strain of this aspect encodes an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 1 and a mutation at position 743 of SEQ ID NO: l. In particular embodiments, the mutation at position 743 of SEQ ID NO: l is one replacing the methionine residue at that position with a threonine residue, namely, M743T.

[0013] In other embodiments, the variant histidine kinase gene of the engineered fungal strain of this aspect encodes an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43. In particular embodiments, the mutation at position 786 of SEQ ID NO: l is one replacing the methionine residue at that position with a threonine residue, namely, M786T.

[0014] In some embodiments, the parental strain of the engineered fungal strain of this aspect is an Ascomycete fungal strain. In particular embodiments, the parental strain is a filamentous fungal strain. Relatedly, the engineered fungal strain comprises a variant histidine kinase encoded by a variant histidine kinase gene, wherein the variant histidine kinase comprises an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to: SEQ ID NO: l and a mutation at position 743 of SEQ ID NO: l or SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43.

[0015] In some embodiments, the engineered fungal strain of this aspect is capable of producing a much greater amount of a protein of interest as compared to its parental strain. For example, the engineered fungal strain is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 100%, or even at least about 150% greater amounts of a protein of interest as compared to its parental strain.

[0016] In a second aspect, the present disclosure provides a transformed fungal strain or a derivative fungal strain thereof, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the transformed fungal strain or the derivative fungal strain comprises a variant histidine kinase gene.

[0017] In some embodiments, the variant histidine kinase gene of the transformed fungal strain or the derivative fungal strain thereof is a variant of a wild type histidine kinase gene encoding a hybrid-type histidine kinase. In some embodiments, the variant histidine kinase gene of the transformed fungal strain or the derivative fungal strain thereof is a variant of a wild type histidine kinase gene encoding a group III histidine kinase. In certain embodiments, the variant histidine kinase gene encodes a polypeptide that functions as part of a signaling pathway that responds to external osmotic pressure. Strains with mutations in this histidine kinase can be identified by selecting or screening for resistance or sensitivity to certain antifungal compounds, such as, for example, in the presence of high levels of a dicarboximide or phenylpyrrole fungicides such as iprodione or fludioxonil in the medium. It is to be expected that mutations in other components of this signaling pathway would also be beneficial. These components include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure. Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of sorbitol or salt in the medium.

[0018] In certain embodiments, the variant histidine kinase gene of the transformed fungal strain or the derivative fungal strain of this aspect encodes a polypeptide comprising an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: l or SEQ ID NO: 43, but is not 100% identical to SEQ ID NO: l or SEQ ID NO: 43. For instance, in certain embodiments, the variant histidine kinase gene of the engineered fungal strain of this aspect encodes an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: l and a mutation at position 743 of SEQ ID NO: l. In particular embodiments, the mutation at position 743 of SEQ ID NO: l is one replacing the methionine residue at that position with a threonine residue, namely, M743T. In other embodiments, the variant histidine kinase gene of the engineered fungal strain of this aspect encodes an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43. In particular embodiments, the mutation at position 786 of SEQ ID NO: 43 is one replacing the methionine residue at that position with a threonine residue, namely, M786T

[0019] In some embodiments, the parental strain of the engineered fungal strain of this aspect is an Ascomycete fungal strain. In particular embodiments, the parental strain is a filamentous fungal strain. Relatedly, the engineered fungal strain comprises a variant histidine kinase encoded by a variant histidine kinase gene, wherein the variant histidine kinase comprises an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to: SEQ ID NO: l and a mutation at position 743 of SEQ ID NO: l or SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43.

[0020] In some embodiments, the transformed fungal strain or the derivative fungal strain of this aspect is capable of producing a much greater amount of a protein of interest as compared to its parental strain. For example, the transformed fungal strain or the derivative fungal strain of this aspect is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 100%, or even at least about 150% greater amounts of a protein of interest as compared to its parental strain. [0021] In a third aspect, the present disclosure provides a method for improving protein production by an engineered, transformed, or derivative fungal strain, as compared to its parental strain, comprising employing an engineered, transformed or derivative fungal strain, wherein the engineered, transformed or derivative fungal strain comprises a variant histidine kinase gene.

[0022] In some embodiments, the variant histidine kinase gene employed in the method of this aspect is a variant of a wild type histidine kinase gene encoding a hybrid-type histidine kinase. In some embodiments, the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a group III histidine kinase. In certain embodiments, the variant histidine kinase gene encodes a polypeptide that functions as part of a signaling pathway that responds to external osmotic pressure. Strains with mutations in this histidine kinase can be identified by selecting or screening for resistance or sensitivity to certain antifungal compounds, such as, for example, in the presence of high levels of a dicarboximide or phenylpyrrole fungicide such as iprodione or fludioxonil in the medium. It is to be expected that mutations in other components of this signaling pathway would also be beneficial. These components include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure. Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of sorbitol or salt in the medium.

[0023] In certain embodiments, the variant histidine kinase gene employed in the method of this aspect encodes a polypeptide comprising an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: l or SEQ ID NO: 43, but is not 100% identical to SEQ ID NO: l or SEQ ID NO: 43. For instance, the variant histidine kinase gene employed in the method of this aspect encodes an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to: SEQ ID NO: l, and a mutation at position 743 of SEQ ID NO: 1 or SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43. In certain particular embodiments, the mutation at position 743 of SEQ ID NO: l is one replacing the methionine residue at that position with a threonine residue, namely, M743T. In other embodiments, the mutation at position 786 of SEQ ID NO: 43 is one replacing the methionine residue at that position with a threonine residue, namely, M786T

[0024] In some embodiments, the parental strain of the engineered fungal strain as employed in the method of this aspect is an Ascomycete fungal strain. In particular embodiments, the parental strain is a filamentous fungal strain. Relatedly, the engineered fungal strain comprises a variant histidine kinase encoded by a variant histidine kinase gene, wherein the variant histidine kinase comprises an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 1, and a mutation at position 743 of SEQ ID NO: 1 or SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43.

[0025] In some embodiments, the engineered, transformed or derivative fungal strain employed in the method of this aspect is capable of producing a much greater amount of a protein of interest, as compared to its parental strain. For example, the engineered, transformed or derivative fungal strain is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 100%, or even at least about 150% greater amounts of a protein of interest as compared to its parental strain.

[0026] In another aspect, the present disclosure provides a method of producing a protein of interest comprising fermenting an engineered, transformed or derivative fungal strain as described herein, wherein the engineered, transformed or derivative fungal strain comprises a variant histidine kinase gene and/or expresses a histidine kinase encoded by the variant histidine kinase gene, secretes the protein of interest.

[0027] In yet another aspect, the present disclosure provides a protein of interest produced by fermenting an engineered, transformed or derivative fungal strain, such as one described herein, wherein the engineered, transformed or derivative fungal strain comprises a variant histidine kinase gene and/or expresses a histidine kinase encoded by the variant histidine kinase gene.

[0028] In embodiments of any of the aspects of invention herein, the protein of interest may be a hemicellulase, a peroxidase, a protease, a cellulase, a xylanase, a lipase, a phospholipase, an esterase, a cutinase, a pectinase, a keratinase, a reductase, an oxidase, a phenol oxidase, a lipoxygenase, a ligninase, a pullulanase, a tannase, a pentosanase, a mannanase, a beta-glucanase, an arabinosidase, a hyaluronidase, a chondroitinase, a laccase, an amylase, a glucoamylase, a mixture thereof, a functional fragment thereof, or a mixture of one or more of the enzymes or functional fragments thereof. Non- limiting examples of proteins may further include proteins or enzymes involved in starch metabolism, proteins or enzymes involved in glycogen metabolism, acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carboxypeptidases, catalases, cellulases, chitinases, chymosin, cutinase, deoxyribonucleases, epimerases, esterases, a-galactosidases, β- galactosidases, a-glucanases, glucan lysases, endo- -glucanases, glucoamylases, glucose oxidases, a-glucosidases, β-glucosidases, glucuronidases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, rhamno-galacturonases, ribonucleases, thaumatin, transferases, transport proteins, transglutaminases, xylanases, hexose oxidase (D-hexose: 02- oxidoreductase, EC, variants thereof, functional fragments thereof, or combinations thereof. The protein of interest may also be a peptide hormone, a growth factor, a clotting factor, a chemokine, a cytokine, a lymphokine, an antibody, a receptor, an adhesion molecule, a microbial antigen (e.g., HBV surface antigen, HPV E7, etc.), or a variant, functional fragment, or a mixture of two of more of the above substances.

[0029] In certain related aspect, the disclosure provides a composition comprising the protein of interest of any of the aspects described herein. The disclosure also provides a method of using such a composition in biomass hydrolysis, cleaning applications, grain processing, animal nutrition, food composition, textile treatment, or the like.

[0030] In a further aspect, the disclosure provides a method for identifying or screening for an engineered fungal strain capable of producing an altered level of a protein of interest, as compared (relative) to a parental strain, comprising the steps of:

(a) inoculating the strain onto the surface of agar plate with osmotic agents or/and dicarboximide fungicide; and

(b) screening or selecting the strains that grow faster or slower than the parental strain.

[0031] For example, in certain embodiments, osmotic agents include, but are not limited to, sugars, sugar alcohols and salts. In certain embodiments, an osmotic agent is a sugar, including, but not limited to, glucose, sucrose, fructose, oligofructose, fructo-oligosaccharide, inverted sugar and the like. In certain other embodiments, an osmotic agent is a sugar alcohol, including, but not limited to, sorbitol, xylitol, galactosylosorbitol and the like. In yet other embodiments, an osmotic agent is a salt, including, but not limited to sodium chloride and potassium chloride. In another embodiment, a fungicide is a dicarboximide or phenylpyrole. In particular embodiments, a fungicide is iprodione or fludioxnil.

[0032] In some embodiments of this aspect, the engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain, comprises a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain. Not wishing to be bound by theory, however, it can be expected that mutations in other components of this signaling pathway are also individually or collectively beneficial to productivity of such fungal strains. Suitable other components of this signaling pathway include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure.

[0033] Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of sorbitol or salt in the medium.

[0034] In some embodiments, the parental strain of the engineered fungal strain of this aspect is an Ascomycete fungal strain. In particular embodiments, the parental strain is a filamentous fungal strain.

[0035] Suitable osmotic agents may include one or a combination of sugars, sugar alcohols or salts. For example, the osmotic agent may be one or more of glucose, sucrose, fructose, oligofructose, fructo-oligosaccharide, inverted sugar, sorbitol, xylitol, galactosylosorbitol, sodium chloride or potassium chloride.


[0036] Figure 1. Depicts a schematic diagram of domain architecture of TrNik-1.

[0037] Figure 2. Depicts a map of pRRAB niklM743T with the gene replacement cassette containing the niklM743T allele.

[0038] Figures 3A-3F. Compares colony phenotypes of RLP37, RLP37 NiklM743T, and RLP37 ΔΝΜ on various media. FIG. 3A depicts the colony phenotype of RLP37 NiklM743T on Vogel's minimal medium. FIG. 3B depicts the colony phenotype of RLP37 on Vogel's minimal medium. FIG. 3C depicts the colony phenotype of RLP37 NiklM743T on Vogel's minimal medium with sorbitol. 3D depicts the colony phenotype of RLP37 on Vogel's minimal medium with sorbitol. FIG. 3E depicts the colony phenotype of RLP37 ANikl on Vogel's minimal medium. FIG. 3F depicts the colony phenotype of RLP37 ANikl on Vogel's minimal medium with sorbitol.

[0039] Figures 4A-4B. Compares the protein production of RLP37 and RLP37 NiklM743T in DASGIP 2 L scale fermentation. FIG. 4A depicts the specific total protein production rate of RLP37 and RLP37 NiklM743T. FIG. 4B depicts the specific yield on fed sugars of RLP37 and RLP37 NiklM743T, during fermentation under the same conditions.

[0040] Figures 5A-5B. Compares the protein production of RLP37 and RLP37 NiklM743T in 14 L scale standard fungal fermentation. FIG. 5A depicts the specific total protein production rate of RLP37 and RLP37 NiklM743T. FIG. 5B depicts the specific yield on fed sugars of RLP37 and RLP37 NiklM743T, during fermentation under the same conditions.

[0041] Figure 6. Depicts a plasmid map of pRRAB Anikl containing the Anikl::hph gene deletion cassette.

[0042] Figures 7A-7B. Compares the specific total protein production rate of RLP37 and RLP37 ANikl during DASGIP 2 L scale fermentation. FIG. 7A depicts the specific total protein production rate of RLP37 and RLP37 ANikl. FIG. 7B depicts the specific yield on fed sugars of RLP37 and RLP37 ANikl, during fermentation under the same conditions.

[0043] Figures 8A-8L. Compares colony phenotypes of various strains on various media. FIG. 8A depicts the colony phenotype of NoCbhl Nikl M743T on Vogel's minimal medium with uridine. FIG. 8B depicts the colony phenotype of NoCbhl on Vogel's minimal medium with uridine. FIG. 8C depicts the colony phenotype of NoCbhl Nikl M743T on Vogel's minimal medium with uridine and sorbitol. FIG. 8D depicts the colony phenotype of NoCbhl on Vogel's minimal medium with uridine and sorbitol. FIG. 8E depicts the colony phenotype of Cbhl Nikl M743T on Vogel's minimal medium with uridine. FIG. 8F depicts the colony phenotype of Cbhl on Vogel's minimal medium with uridine. FIG. 8G depicts the colony phenotype of Cbhl Nikl M743T on Vogel's minimal medium with uridine and sorbitol. FIG. 8H depicts the colony phenotype of Cbhl on Vogel's minimal medium with uridine and sorbitol. FIG. 81 depicts the colony phenotype of TR NiklWT on Vogel's minimal medium. FIG. 8J depicts the colony phenotype of TR Nikl M743T on Vogel's minimal medium. FIG. 8K depicts the colony phenotype of TR Nikl WT on Vogel's minimal medium with sorbitol. FIG. 8L depicts the colony phenotype of TR Nikl M743T on Vogel's minimal medium with sorbitol.

[0044] Figures 9A-9B. Compares the protein production of Cbhl and Cbhl Nikl M743T in DASGIP 2 L scale fermentation. FIG. 9A depicts the specific total protein production rate of Cbhl and Cbhl Nikl M743T. FIG. B depicts the specific yield on fed sugars of Cbhl and Cbhl Nikl M743T during fermentation under the same conditions.

[0045] Figures 10A-10B. Compares the protein production of Cbhl and Cbhl Nikl M743T in 14 L scale standard fungal fermentation. FIG. 10A depicts the specific total protein production rate of Cbhl and Cbhl Nikl M743T. FIG. 10B depicts the specific yield on fed sugars of Cbhl and Cbhl Nikl M743T during fermentation under the same conditions.

[0046] Figure 11. Depicts a map of pRRAB niklWT with the gene replacement cassette containing the niklWT allele.

[0047] Figures 12A-12B. Compares the protein production of RLP37, the parental strain for TR NiklM743T, TR NiklM743T, and TR NiklWT in DASGIP 2 L scale fermentation. FIG. 12A depicts the specific total protein production rate of RLP37, TR NiklM743T and TR NiklWT. FIG. 12B depicts the specific yield on fed sugars of RLP37, TR NiklM743T and TR NiklWT, during fermentation under the same conditions.

[0048] Figure 13. Compares phenotypes of T. reesei strains RLP37 and RLP37 NiklM7 T on media with or without fungicide. FIG. 13A RLP37 on Vogel's minimal medium, FIG. 13B RLP37 NiklM743T on Vogel's minimal medium, FIG. 13C RLP37 on Vogel's minimal medium with 0.15% DMSO, FIG. 13D RLP37 NiklM743T on Vogel's minimal medium with 0.15% DMSO, FIG. 13E RLP37 on Vogel's minimal medium with 4455μμΜΜ iipprrcodione, FIG. 13F RLP37 NiklM 431 on Vogel's minimal medium with 45 μΜ iprodione.

[0049] Figure 14. Depicts a map of pRNnikl with the gene replacement cassette containing the Aspergillus niger niklM786T allele.

[0050] Figure 15. Compares the protein production of strain GICC2071 containing the wild-type nikl allele (control), and GICC2071 NiklM786T mutant strains #99, 117, and 121, containing the m'£iM7S67allele, at shake flask scale. Supernatants from shake flasks were run on SDS-PAGE. [0051] Figure 16. Compares supernatant enzyme activity on PNPG between strain GICC2071 containing the wild-type nikl allele and GICC2071 NiklM786T mutant strains #99, 117, and 121, containing the niklM786T allele, at shake flask scale. Relative absorbance was normalized to GICC2071 control. Error bars represent standard deviation.


I. Overview

[0052] The present strains and methods relate to a variant or mutant filamentous fungus cell having been genetically modified from its wild type parental filamentous fungal cell to comprise a variant histidine kinase gene and/or express a variant histidine kinase encoded by the variant histidine kinase gene, wherein the cell's histidine kinase mediated signal transduction mechanism is substantially altered or eliminated. Such strains are well suited for large scale production of proteins of interest at improved productivity levels.

II. Definitions

[0053] Prior to describing the present strains, compositions and methods, the following terms and phrases are defined. Terms not defined should be accorded their ordinary meaning as used in the art.

[0054] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the present compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the present compositions and methods, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the present compositions and methods.

[0055] Certain ranges are presented herein with numerical values being preceded by the term "about." The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. For example, in connection with a numerical value, the term "about" refers to a range of - 10% to +10% of the numerical value, unless the term is otherwise specifically defined in context. In another example, the phrase a "pH value of about 6" refers to pH values of from 5.4 to 6.6, unless the pH value is specifically defined otherwise.

[0056] The headings provided herein are not limitations of the various aspects or embodiments of the present compositions and methods which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0057] The present document is organized into a number of sections for ease of reading; however, the reader will appreciate that statements made in one section may apply to other sections. In this manner, the headings used for different sections of the disclosure should not be construed as limiting.

[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present compositions and methods belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present compositions and methods, representative illustrative methods and materials are now described.

[0059] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present compositions and methods are not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0060] In accordance with this detailed description, the following abbreviations and definitions apply. Note that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes, and reference to "the dosage" includes reference to one or more dosages and equivalents thereof known to those skilled in the art, and so forth.

[0061] It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0062] It is further noted that the term "consisting essentially of," as used herein refers to a composition wherein the component(s) after the term is in the presence of other known component(s) in a total amount that is less than 30% by weight of the total composition and do not contribute to or interferes with the actions or activities of the component(s).

[0063] It is further noted that the term "comprising," as used herein, means including, but not limited to, the component(s) after the term "comprising." The component(s) after the term "comprising" are required or mandatory, but the composition comprising the component(s) may further include other non-mandatory or optional component(s).

[0064] It is also noted that the term "consisting of," as used herein, means including, and limited to, the component(s) after the term "consisting of." The component(s) after the term "consisting of are therefore required or mandatory, and no other component(s) are present in the composition.

[0065] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present compositions and methods described herein. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

[0066] As used herein, the term "protein of interest" refers to a polypeptide that is desired to be expressed in a filamentous fungus, optionally at high levels and for the purpose of commercialization. Such a protein may be an enzyme, a substrate-binding protein, a surface- active protein, a structural protein, or the like.

[0067] As used herein, the terms "polypeptide" and "protein" are used interchangeably to refer to polymers of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.

[0068] As used herein, "variant," when used in conjunction with a polypeptide, refers to a polypeptide that is derived from a parent (or reference) polypeptide by the substitution, addition, or deletion, of one or more amino acids, typically by applying recombinant DNA techniques. Variant polypeptides may differ from a parent polypeptide by one or more, or a few (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) amino acid residues. Variant polypeptides may be defined by their level of primary amino acid sequence homology/identity with a parent polypeptide. Preferably, variant polypeptides have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% amino acid sequence identity with a parent or reference polypeptide. A variant polypeptide typically does not comprise an amino acid sequence that is 100% identical to that of a parent/reference polypeptide.

[0069] The term "variant," when used in conjunction with a polynucleotide or a gene, refers to a polynucleotide having a specified degree of homology/identity to a parent or reference polynucleotide or gene, or is capable of hybridizing under stringent conditions to a parent or reference polynucleotide or gene sequence, or the complement thereof. For instance, a variant polynucleotide can suitably have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% nucleotide sequence identity with a parent polynucleotide. A variant polynucleotide or gene typically does not comprise a nucleotide sequence that is 100% identical to that of a parent/reference polynucleotide or gene.

[0070] As used herein, the term "histidine kinase" refers to a signaling factor that exists in bacteria, yeasts, filamentous fungi and plants, which mediates histidine phosphorylation. Histidine kinases are mostly transmembrane receptors, a substantial minority of these are soluble cytoplasmic proteins. In either form, these kinases are modular with highly conserved catalytic transmitter regions linked to diverse sensory domains. A receptor histidine kinase links its sensory domain to its cytoplasmic transmitter region through a transmembrane domain. The transmitter region consists of two domains: an N-terminal DHp (dimerization and histidine phosphotransfer) domain and a C-terminal CA (catalytic and ATP-binding) domain (Stock, A. M., et al. Ann. Rev. Biochem. (2000) 69: 183-215). Histidine kinases function as homodimers, with a few exceptions, and their dimerization is mediated by the DHp domain, which forms a four-helix bundle (Goodman et al., Genes Dev. (2009) 23:249-59).

[0071] As used herein, the term "hybrid-type histidine kinase" is a type of histidine kinase, in which the histidine kinase domain and the response regulator domain are present in the same proteins. In a yeast Saccharomyces cerevisiae, only one hybrid-type histidine kinase gene (SLN1) exists in the genome (Ota, I.M., et al., Science (1993) 262, 566-569.). In yeast, Slnl is involved in a high-osmolarity response. This response involves accumulation of glycerol as the primary compatible solute in the cells (Posas, F., et al., Cell (1996) 86, 865- 875). In a plant Arabidopsis thaliana, nine hybrid type and three conventional histidine kinase genes exist in the genome, and 2 of the 12 histidine kinase genes can complement yeast slnl mutants (Reiser, V., et al. J. Cell Biol. (2003) 161, 1035-1040). Aspergillus nidulans also has an SLNl-homolog that can complement a yeast slnl mutant (Furukawa, K., et al, Appl. Environ. Microbiol. (2002) 68, 5304-5310). In the filamentous fungus Neurospora crassa, a hybrid-type histidine kinase Os-l/Nik-1 that is different from Slnl- homolog is involved in the os (osmosensitive) signal transduction pathway and is needed for adaptation to high osmolality conditions (Alex, L.A., et al., Proc. Natl. Acad. Sci. USA (1996) 93, 3416-3421).

[0072] As used herein, the term "group III histidine kinases" refers to a histidine kinase having a unique N-terminal region consisting of HAMP domain repeats, which are found in signaling-related proteins, including histidine kinases, adenylyl cyclases, methyl- accepting chemotaxis proteins, and phosphatases (Aravind L, Ponting CP. FEMS Microbiol Lett (1999)176: 111-116). For example, N. crassa Os-lp (also known as Niklp), B. fuckeliana Daflp (also known as BcOslp), and C. heterostrophus Diclp (also known as ChNiklp), are characterized by a unique N-terminal region consisting of a HAMP domain repeat (Catlett, N.L., et al. Cell (2003) 2, 1151-1161). The phylogenetic analysis revealed 11 major groups of euascomycete (C. heterostrophus, G. moniliformis, N. crassa, and B. f ckeliana) histidine kinases. Many of these groups contain histidine kinases that are highly conserved in filamentous ascomycetes. Other groups are more divergent, containing gene families that have expanded within species and few clear orthologs between species. These groupings suggest that some histidine kinase genes are necessary for basic functions shared by most or all ascomycetes (e.g., osmosensing), while others may have evolved to adapt to specific aspects of the lifestyle of a pathogen. The precise function of these domains is unknown; however, mutations in the NIKl HAMP repeat region are responsible for the most severe osmosensitivity and dicarboximide resistance phenotypes (Miller, T. K., et al, Fungal Genet. Biol. (2002) 35: 147-155.)

[0073] As used herein, the term "fungus" refers to any member of a large group of eukaryotic organisms that includes microorganisms such as yeasts and molds, as well as the mushrooms. These organisms are classified as a kingdom, Fungi, which are separate and distinct from plants, animals, protists, and bacteria. One primary difference is that fungal cells have cell walls that contain chitin, unlike the cell walls of plants and some protists, which contain cellulose, and unlike the cell walls of bacteria.

[0074] As used herein, the term "Ascomycete fungal strain" refers to any organism in the Division Ascomycota in the Kingdom Fungi. Examples of Ascomycetes fungal cells include but are not limited to filamentous fungi in the subphylum Pezizomycotina, such as Trichoderma spp, Aspergillus spp, Myceliophthora spp, and Penicillium spp.

[0075] As used herein, the term "filamentous fungus" refers to all filamentous forms of the subdivision Eumycota and Oomycota. For example, filamentous fungi include, without limitation, Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Scytalidium, Thielavia, Tolypocladium, or Trichoderma species. In some embodiments, the filamentous fungus may be an Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae. In some embodiments, the filamentous fungus is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum. In some embodiments, the filamentous fungus is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, or Thielavia terrestris. In some embodiments, filamentous fungus is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, e.g., RL-P37 (Sheir- Neiss et al., Appl. Microbiol. Biotechnology, 20 (1984) pp. 46-53; Montenecourt B.S., Can., 1- 20, 1987), QM9414 (ATCC No. 26921), NRRL 15709, ATCC 13631, 56764, 56466, 56767, or Trichoderma viride, e.g., ATCC 32098 and 32086. In some embodiments, the filamentous fungus is a Trichoderma reesei RutC30, which is available from the American Type Culture Collection as Trichoderma reesei ATCC 56765. Related to this, in some embodiments, the disclosure provides a whole cell broth preparation of any one of the filamentous fungi described herein.

[0076] A "heterologous" nucleic acid construct or sequence has a portion of the sequence which is not native or existing in a native form to the cell in which it is expressed. Heterologous, with respect to a control sequence refers to a control sequence (i.e. promoter or enhancer) that does not function in nature to regulate the same gene the expression of which it is currently regulating. Generally, heterologous nucleic acid sequences are not endogenous to the cell or part of the genome in which they are present, and have been added to the cell, by infection, transfection, transformation, microinjection, electroporation, or the like. A "heterologous" nucleic acid construct may contain a control sequence/DNA coding sequence combination that is the same as, or different from a control sequence/DNA coding sequence combination found in the native cell.

[0077] The term "host cell", as used herein, may suitably be a cell of any fungus, whether a unicellular organism, a cell derived from a multicellular organism and placed in tissue culture or a cell present as part of a multicellular organism, which is susceptible to transformation with a nucleic acid construct according to the invention. Host cells such as yeast and other fungal cells may be used for replicating DNA and producing polypeptides encoded by nucleotide sequences as used in the invention. Suitable cells are generally filamentous fungi or yeasts. Particularly preferred are cells from filamentous fungi, preferably cells from Aspergillus, such as A. niger and A. tubingensis. Other preferred organisms include Aspergillus oryzae, A. awamori, Myceliophthora thermophile, Trichoderma reesei, T. viride or T. longibrachiatum.

[0078] As used herein, the term "vector" refers to a nucleic acid construct designed for transfer between different host cells. An "expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA fragments in a foreign cell. Many prokaryotic and eukaryotic expression vectors are commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art.

[0079] As used herein, the term "engineered fungal strain" refers to a fungal strain constructed using genetic engineering technology.

[0080] As used herein, the term "parental strain" refers to a microorganism strain the genome of which can be mutated once, twice, or more times, to generate an engineered strain.

[0081] As used herein, the term "transformed" refers to a cell has been transformed by the use of recombinant DNA techniques. Transformation typically occurs by insertion of one or more nucleotide sequences into a cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence, i.e., is a sequence that is not natural to the cell that is to be transformed, such as a fusion protein.

[0082] The term "derived" encompasses the terms "originated" "obtained," "obtainable," and "created," and generally indicates that one specified material find its origin in another specified material or has features that can be described with reference to the another specified material.

[0083] As used herein, the term "gene" means the segment of DNA involved in producing a polypeptide, that may or may not include regions preceding and following the coding region, e.g. 5' untranslated (5" UTR) or "leader" sequences and 3' UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons). In certain embodiments, a gene may suitably encode certain commercially important industrial proteins or peptides, such as enzymes, e.g., proteases, mannanases, xylanases, amylases, glucoamylases, cellulases, oxidases or lipases. A gene of interest may be a naturally occurring gene, a mutated gene or a synthetic gene.

[0084] As used herein, the term "mutation" refers to any change or alteration in a nucleic acid sequence. Several types of mutation exist, including point, frame shift, and splicing mutations. Mutation may be performed specifically (e.g. site directed mutagenesis) or randomly (e.g. via chemical agents, passage through repair minus bacterial strains).

[0085] As used herein, the term "improving the protein production" refers to a protein production process whereby the amount of protein produced from that process is increased. The protein thus produced may be produced into the culture medium or within the host cell, however, the former is preferred. Increased production may be detected for example as higher maximal level of protein or enzymatic activity, such as cellulase or hemicellulase activity, or total extracellular protein produced as compared to the parent host organism.

[0086] As used herein, the term "specific productivity" refers to total amount of protein produced per cell per time over a given time period.

[0087] As used herein, the term "% identity" is used interchangeably with the term "% homology," and both refer to the level of nucleic acid or amino acid sequence identity between the nucleic acid sequences that encode any one of the inventive polypeptides or the inventive polypeptide's amino acid sequences, when aligned using a sequence alignment program.

III. Engineered fungal strain having improved protein production

[0088] The present disclosure relates, in a first aspect, to an engineered, transformed or derivative fungal strain capable of producing an altered level of a protein of interest, and in a second aspect, to methods of genetically modifying a fungal strain such that it has an ability to produce an altered level of protein of interest. Moreover, the present disclosure pertains to a protein of interest produced by fermenting such engineered, transformed or derivative fungal strain, and further, pertains to a composition comprising the protein of interest thus produced. Furthermore, the present disclosure pertains to a method of producing a protein of interest employing an engineered, transformed or derivative fungal strain, as well as a method of producing and using a composition comprising the protein of interest. The present disclosure also relates to a method for identifying or selecting for an engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain.

[0089] In a first aspect, the present disclosure provides an engineered fungal strain, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the fungal strain comprises a variant histidine kinase gene and/or is capable of expressing a variant histidine kinase. In some embodiments, the present disclosure provides an engineered fungal strain capable of producing a significantly greater quantity of a protein of interest as compared to its parental strain. For example, the engineered fungal strain is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, at least about 75%, at least about 100%, or even at least about 150% greater amounts of a protein of interest as compared to its parental strain. [0090] In a second aspect, the present disclosure provides a transformed fungal strain or derivative fungal strain thereof, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the transformed fungal strain or the derivative fungal strain comprises a variant histidine kinase gene and/or is capable of expressing a variant histidine kinase gene.

[0091] In a third aspect, the present disclosure provides a method for improving protein production by an engineered, transformed, or derivative fungal strain, as compared to its native, unengineered, untransformed, or non-derivative parental strain, the method comprising employing an engineered, transformed or derivative fungal strain, wherein the engineered, transformed or derivative fungal strain comprises a variant histidine kinase gene and/or is capable of expressing a variant histidine kinase.

[0092] In any of the aspects presented herein, the variant histidine kinase is a variant of a wild type histidine kinase. In some embodiments, the variant histidine kinase comprises a polypeptide or amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher % ) identical to SEQ ID NO: 1, but is not 100% identical to SEQ ID NO:l. In other embodiments, the variant histidine kinase comprises a polypeptide or amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher % ) identical to SEQ ID NO: 43, but is not 100% identical to SEQ ID NO: 43. For instance, the variant histidine kinase is suitably one encoded by a variant histidine kinase gene, wherein the variant histidine kinase comprises an amino acid sequence that is at least about 60% (e.g., at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or even higher %) identical to SEQ ID NO: 1, and a mutation at position 743 of SEQ ID NO: 1 or SEQ ID NO: 43 and a mutation at position 786 of SEQ ID NO: 43.

A. Histidine kinase

[0093] Histidine kinase is a sensor protein, which can detect and transform external signals into transducible cellular events. Detection of external stimuli and the transfer of these signals within the cell to give an appropriate response are vital for organisms in order to adapt to varying environmental conditions during their life cycles. Signaling mechanisms are found in all living cells as two component systems or as phosphorelay systems in more complex organisms. Such systems confer signal transfer of a phosphoryl group from an, often membrane bound, histidine kinase to a response regulator protein and thus trigger various physiological responses. Phosphorylation can promote oligomerization (Weiss, V., F. Claverie-Martin, and B. Magasanik. Proc. Natl. Acad. Sci. USA (1992) 89:5088-5092; Webber, C. A., and R. J. Kadner. Mol. Microbiol. (1997) 24: 1039-1048), dimerization (Cobb, M. H., and E. J. Goldsmith.Trends Biochem. Sci. (2000) 25:7-9), interactions with other proteins (Blat, Y., and M. Eisenbach. Biochemistry (1994) 33:902-906; Newton, A. C. Chem. Rev. (2001) 101:2353-2364), interactions with DNA (Aiba, H., F. Nakasai, S. Mizushima, and T. Mizuno. J. Biochem. (1989) 106:5-7), or combinations of these mechanisms (Harlocker, S. L., L. Bergstrom, and M. Inouye. J. Biol. Chem. (1995) 270:26849-26856). Phosphorelay systems have been implicated in regulating differentiation processes, chemotaxis, secondary metabolite production, and virulence-associated processes in pathogenic and nonpathogenic bacteria and fungi (Grebe, T. W., and J. B. Stock. Adv. Microb. Physiol. (1999) 41: 139-227; Wolanin, P.M., P. A. Thomason, and J. B. Stock. Genome Biol. (2002) 3: Reviews 3013).

[0094] Hybrid-type histidine kinase, phosphorelay signaling systems, consisting of two components as basic signaling factors: autophosphorylating histidine kinase and a response regulator that receives phosphoric acid therefrom to send the information to the downstream region, are involved in several signal transduction pathways in plants, slime molds, fungi, and bacteria, but not in animals (Catlett, N.L., et al. Cell (2003) 2, 1151-1161). They play pivotal roles in responses to environmental stimuli and regulate various processes, including virulence in plant and animal pathogens (Wolanin, P.M., P. A. Thomason, and J. B. Stock. 2002. Genome Biol. (2002) 3: Reviews 3013).

[0095] In fungi, histidine kinases are classified into 11 groups (Catlett, N.L., et al. Cell (2003) 2, 1151-1161). Typically, the hybrid-type histidine kinase genes contain in addition to the HisKA domain, a REC (signal receiver) domain (PF00072), a HATPase (histidine-like ATPase; PF02518) domain, and different signaling domains, for example, HAMP-(histidine kinase, adenylyl cyclase, methyl- accepting protein, and phosphatase; PF00672), and ATPase domains (PF13191). Group III histidine kinases, have a unique N-terminal region consisting of HAMP domain repeats, which are found in signaling-related proteins, including HKs, adenylyl cyclases, methyl- accepting chemotaxis proteins, and phosphatases (Aravind L, Ponting CP. FEMS Microbiol Lett (1999)176: 111-116).

[0096] The group III histidine kinases were known as mediators of environmental stress responses, pathogenicity, hyphal development, and sporulation (Li, S., et al. EMBO J. (1998) 17:6952-6962.; Hohmann, S. Mol. Biol. Rev. (2002) 66:300-372.; Nemecek, J. C, et al. Science (2006) 312:583-588.; Viaud, M., et al. Mol. Plant Microbe Interact. (2006) 19: 1042- 1050; Islas-Flores, et al. Asian J. Biochem. (2011) 6: 1-14.). The mutation of these histidine kinase genes resulted in resistance to phenylpyrrole and dicarboximide fungicides and also in increased osmosensitivity (Cui, W.; Beever, R. E., Parkes, S. L., Weeds, P. L. & Templeton, M. D. Fungal Genet. Biol. (2002), 36, 187-198; Ochiai, N.; Fujimura, M., Motoyama, T, Ichiishi, A., Usami, R., Horikoshi, K. & Yamaguchi, I. Pest. Manag. Sci., (2001) 57, 437- 442). In C. heterostrophus, null mutants for dicl and mutants with a deletion or point mutation in the HAMP domain repeat were highly sensitive to osmotic stress and highly resistant to the previously mentioned fungicides (Yoshimi A, Tsuda M, Tanaka C Mol Genet Gennomics (2004) 271: 228-236). Similar effects resulting from mutations were observed in N. crassa os-1 and B. fuckeliana dafl (Cui, W.; Beever, R. E., Parkes, S. L., Weeds, P. L. & Templeton, M. D. Fungal Genet. Biol. (2002), 36, 187-198; Ochiai, Ν.; Fujimura, M., Motoyama, T, Ichiishi, A., Usami, R., Horikoshi, K. & Yamaguchi, I. Pest. Manag. Sci., (2001) 57, 437-442). A single amino acid change within the kinase domain or the regulator domain of C. heterostrophus dicl altered the sensitivity to osmotic stress and conferred a moderate resistance to the fungicides. Thus, the group III histidine kinase is considered to be a putative osmosensor (Schumacher, M. et al, CURR MICROBIOL (1997) 34, 340-347). Furthermore, members of group III histidine kinases are believed to be the target of commercial pesticides such as fludioxonil, iprodione, and the antifungal natural product ambruticin (Motoyama, T; Ohira, T, Kadokura, K., Ichiishi, A., Fujimura, M., Yamaguchi, I. & Kubo, T. Curr. Genet., (2005b) 47, 298-306; Dongo A, Bataille-Simoneau Ν, Campion C, Guillemette T, Hamon B, et al. Appl, Environ. Microbiol. (2009) 75: 127-134).

[0097] In one example, the domain architecture of T. reesei histidine kinase gene (TrNik- 1) was analyzed by bioinformatics in this present disclosure, and it was shown that TrNik-1 contains 5 HAMP functional domains, 1 HisKA functional domain, 1 HATPase domain and 1 REC functional domain (Figure 1). According to the domain architecture, TrNik-1 belongs to group III histidine kinase. The amino acid or polypeptide sequence of Trichoderma reesei histidine kinase (TrNikl) is presented herein below as SEQ ID NO: l : MIEDTAALAAAAELIASLACDPASASASSSLVSVGPGSSIKLPGRENPAKRTLEIELEKL






















The amino acid or polypeptide sequence of Aspergillus niger histidine kinase (AnNikl) is presented herein below as SEQ ID NO: 43:





















B. Engineered fungal strain comprising a mutated or knocked out histidine kinase

[0098] In one embodiment, the modification of the Trichoderma reesei native nikl histidine kinase allele can cause an increase in the amount of secreted proteins. The nikl modification was a single nucleotide T to C substitution in the open reading frame (ORF) (SEQ ID NO:l) that changes the amino acid at position 743 of the Nikl protein from Met (ATG) to Thr (ACG).

[0099] The comparison of the protein production of a strain containing the modified niklM743T histidine kinase allele with the host strain containing the nikl wild type (native) allele has been carried out, and it was found that the specific total protein production rate and yield on fed sugars of RLP37 NiklM743T showed a significant improvement over RLP37 (Figure 4). This indicated that introducing the modified nikl histidine kinase into a host T. reesei strain causes an increase in protein production.

[00100] In other embodiments, the modification of the Aspergillus niger native nikl histidine kinase allele can cause an increase in the amount of secreted proteins. The nikl modification was a single nucleotide T to C substitution in the open reading frame (ORF) (SEQ ID NO: 43) that changes the amino acid at position 786 of the Nikl protein from Met (ATG) to Thr (ACG).

[00101] The comparison of the protein production of a strain containing the modified niklM786T histidine kinase allele with the host strain containing the nikl wild type (native) allele has been carried out, and it was found that the protein production and enzyme activity on p-nitrophenyl-a-D-glucopyranoside (PNPG) substrate of GICC2071 NiklM786T showed an improvement over wild-type parent GICC2071 (Figures 15 and 16). This indicated that introducing the modified nikl histidine kinase into a host A. niger strain causes an increase in protein production.

[00102] In some embodiments, the variant histidine kinase is a variant of the native histidine kinase in that it comprises a mutation of any kind, e.g., single, or multiple (e.g., a few, namely, 1, 2, 3, 4, 5, 6, 7, 8, 9, or even 10 or more) mutations, such as replacements, insertions, deletions, transpositions, terminations (stop codons introduced) and point mutations. In certain instances, a single base pair substitution whereby a single nucleotide base is substituted with a different nucleotide base at the same position, with the corresponding substitution of the complementary base on the other strand of the DNA, can occur. Any such single base pair substitution is contemplated herein as an embodiment of the invention, and accordingly the variant histidine kinase may be encoded by a polynucleotide sequence that comprises a single base-pair substitution as compared to the wild type, parent, histidine kinase gene. The mutations of the variant polynucleotide can appear in protein coding regions or in regions which encode ribosomal or transfer RNAs.

[00103] The mutations can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.

[00104] Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent. Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and the insert to ligate to one another. See, e.g., Scherer and Davis, Proc. Natl. Acad. Sci. USA (1979) 76: 4949-4955; and Barton et al, Nucleic Acids Res. (1990) 18: 7349-4966. Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171154; Storici et al, Nature Biotechnol. (2001) 19: 773-776; Kren et al, Nat. Med. (1998) 4: 285- 290; and Calissano and Macino, Fungal Genet. Newslett. (1996) 43: 15-16. Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.

[00105] Random mutagenesis may be accomplished through one of various means. One method is chemical mutagenesis by outgrowth in the presence of a mutagenizing reagent such as 2-aminopurine (2AP), N-methyl-N-nitro-N-nitrosoguanidine (MNNG), or ethyl methane sulfonate (EMS), among others (Foster, P. L. Methods Enzymol (1991) 204: 114-125.). Methods for chemical mutagenesis are well known in the art and are described in detail by Miller, J. H. (A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory Press, Plainview, N.Y. 1992). Mutagenesis may also be accomplished by expressing a mutator gene such as mutD5 off of a plasmid as described by Selifonova et al. (Appl Environ. Microbio. (2001) 167: 3645- 3649). Cellular genomes may also be manipulated through transposon mutagenesis, genome shuffling, overexpression of genes from a plasmid, or other cellular engineering techniques (Kleckner, N., Bender, J., and Gottesman, S., Methods Enzymol (1991) 204: 139-180; Patnaik, R., Biotechnol. Prog. (2008) 24: 38-47). Mutant cells may also be produced by simply outgrowing cells and allowing replication errors to naturally occur, as in the method of Miroux and Walker (U.S. Pat. No. 6,361,966). In order to obtain increasingly better mutants, 2 or more rounds of mutagenesis may be performed, and each round may use the same or a different method of mutagenesis.

[00106] In certain embodiments, the variant histidine kinase is a variant group III histidine kinase, and may be a naturally-occurring variant of TrNik- 1 or AnNik- 1 that has at least at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% amino acid sequence identity to an amino acid sequence of SEQ ID NO: l or SEQ ID NO: 43, although the variant histidine kinase does not have 100% identical sequence to SEQ ID NO: l or SEQ ID NO: 43.

[00107] In certain embodiments, the variant histidine kinase may be identified by screening for resistance or sensitivity to certain antifungal compounds, such as, for example, in the presence of high levels of a dicarboximide or phenylpyrrole fungicide such as iprodione or fludioxonil in the medium.

[00108] In some embodiments, the variant histidine kinase may be obtained from a fungal strain that is not Trichoderma reesei or Aspergillus niger, and the variant histidine kinase comprises a polypeptide sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99% identical to the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 43; however the variant histidine kinase is not 100% identical to SEQ ID NO: l or SEQ ID NO: 43. [00109] In some embodiments, the histidine kinase is derived from Trichoderma spp., particularly Trichoderma reesei (longibrachiatum). The histidine kinase may also be derived from another fungus, such as Absidia spp.; Acremonwm spp.; Agancus spp., Anaeromyces spp ; Aspergillus spp , including A. auculeatus, A. awamon, A. flavus, A. foetidus, A. jumaricus, A. jumigatus, A. nidulans, A. niger, A. oryzae, A. terreus and A. versicolor, Aeurobasidium spp.; Cepha/osporum spp.; Chaetomium spp.; Chrysosporium spp ; Coprinus spp ; Dactyllum spp.; Fusarium spp., including F. conglomerans, F. decemcellulare, F. javanicum, F. Urn, Foxysporum and F. solani; Gliocladium spp.; Humicola spp , including H. insolens and H. lanuginosa; Mucor spp.;Myceliophthora spp, including M. thermophila; Neurospora spp., including N. crassa and N. sitophila; Neocallimastix spp ; Orpinomyces spp.; Penicillium spp; Phanerochaete spp.; Phlebia spp.; Piromyces spp.; Pseudomonas spp. ; Rhizopus spp.; Schizophyllum spp.; Trametes spp ; Trichoderma spp., including T reesei, T reesei (longibrachiatum) and T. vinde; or Zygorhynchus spp. Similarly, it is envisioned that histidine kinase may be found in bacteria such as Bacillus spp., Cellulomonas spp.; Clostridium spp., Myceliophthora spp.; Thermomonospora spp ; Streptomyces spp., S. olivochromogenes ; Fibrobacter succinogenes, and in yeast including Candida torresn; C. parapsllosis; C. sake; C. zeylanoides, Pichia minuta; Rhodotorula glutinis; R. mucilaginosa, or Sporobolomyces roseus.

[00110] In one example, a Nikl deletion strain (RLP37 ANikl) was constructed in order to determine if the niklM743T allele resulted in a gain-of-function or loss-of-function. The comparison of protein production and other features of the RLP37 ANikl strain with the RLP37 host strain containing the wild type allele showed that the niklM743T allele is a gain-of- function allele resulting in a gain-of-function phenotype (Figure 12).

[00111] In certain embodiments, the variant histidine kinase gene encodes a polypeptide that functions as part of a signaling pathway that responds to external osmotic pressure. It may be expected that mutations in other components of this signaling pathway would also be beneficial. These components include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure. Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of sorbitol or salt in the medium.

[00112] For purposes of the present invention, the term "osmotic pressure" refers to the hydrostatic pressure required to stop the net flow of water across the cell membrane of a filamentous fungus. For example, osmotic pressure exposed to a fungal cell can vary by the concentration of components such as salts or sorbitol (e.g., as high as 1.2M) in the growth medium where the fungal cell is cultivated. A cell's capability to withstand high osmotic pressure is beneficial and can be connected with the cell's capacity to produce greater amount of a protein of interest. Along these lines, the engineered fungal strains or derivative fungal strains of the present invention has improved capacity to withstand osmotic pressure as compared to their parental strains.

C. Detection of protein production

[00113] To confirm that an engineered fungal strain has a capability of producing an improved level of a protein of interest, various methods of screening may be performed. The expression vector may encode a polypeptide fusion to the target protein which serves as a detectable label or the target protein itself may serve as the selectable or screenable marker. The labeled protein may be detected via western blotting, dot blotting (methods available at the Cold Spring Harbor Protocols website), ELISA, or, if the label is GFP, whole cell fluorescence or FACS. For example, a 6-histidine tag would be included as a fusion to the target protein, and this tag would be detected by western blotting. If the target protein expresses at sufficiently high levels, SDS-PAGE combined with Coomassie/silver staining, may be performed to detect increases in mutant expression over wild type, in which case no label is necessary. In addition, other methods may be used to confirm the improved level of a protein of interest, such as, the detection of the increase of protein activity or amount per cell, protein activity or amount per milliliter of medium, allowing cultures or fermentations to continue efficiently for longer periods of time, or through a combination of these methods.

[00114] The detection of specific productivity is another method to evaluate the protein production. Specific productivity (Qp) can be determined by the following equation:

Qp = gP/gDC Win- wherein "gP" is grams of protein produced in the tank, "gDCW" is grams of dry cell weight (DCW) in the tank, "hr" is fermentation time in hours from the time of inoculation, which include the time of production as well as growth time.

[00115] In some embodiments, the engineered, transformed or derivative fungal strain is capable of producing at least about 0.5%, for example, at least about 0.5%, at least about 0.7%, at least about 1%, at least about 1.5%, at least about 2.0%, at least about 2.5%, or even at least about 3%, or more of a protein of interest, as compared to its parental strain.

D. Employing the engineered, transformed or derivative fungal strain for production of proteins of interest

[00116] In one aspect, the present disclosure provides a method of producing a protein of interest comprising fermenting an engineered, transformed or derivative fungal strain, wherein the engineered, transformed or a derivative fungal strain secrete the protein of interest, wherein the engineered, transformed or a derivative fungal strain comprises a mutation in its histidine kinase gene.

[00117] The standard techniques for transformation of fungi and culturing the fungi are well known in the art can be used to transform the improved hosts of the present invention for the production of recombinant proteins. Introduction of a DNA construct or vector into a host cell includes techniques such as transformation; electroporation; nuclear microinjection; transduction; transfection, e.g., lipofection mediated and DEAE-Dextrin mediated transfection; incubation with calcium phosphate DNA precipitate; high velocity bombardment with DNA-coated microprojectiles; gene gun or biolistic transformation and protoplast fusion. General transformation techniques are known in the art. See, e.g., Ausubel et al. (1987), supra, chapter 9; Sambrook et al. (2001), supra; and Campbell et al, Curr. Genet. (1989)16: 53-56. The expression of heterologous protein in Trichoderma is described, for example, in U.S. Pat. Nos. 6,022,725; 6,268,328; Harkki et al, Enzyme Microb. Technol. (1991) 13: 227-233; Harkki et al, BioTechnol. (1989) 7: 596-603; EP 244,234 and EP 215,594. Reference is also made to Cao et al, Science (2000) 9: 991-1001 for transformation of Aspergillus strains.

[00118] Usually transformation of Trichoderma sp. uses protoplasts or cells that have been subjected to a permeability treatment, typically at a density of 105 to 107/mL, particularly 2xl06/mL. A volume of 100 iL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM &C ) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives, such as dimethyl sulfoxide, heparin, spermidine, potassium chloride and the like, may also be added to the uptake solution to facilitate transformation. Similar procedures are available for other fungal host cells. See, e.g., U.S. Pat. Nos. 6,022,725 and 6,268,328, both of which are incorporated by reference. [00119] In some embodiments, the present invention provides a method of producing a protein of interest comprising fermenting the engineered fungal strain or the transformed fungal strain and derivative fungal strain, wherein the engineered or transformed and derivative fungal strain secret the protein of interest. The fermentation method well known in the art can be used to ferment the engineered or the transformed or the derivative fungal strain. In some embodiments, fungal cells are grown under batch or continuous fermentation conditions. Aclassical batch fermentation is a closed system, where the composition of the medium is set at the beginning of the fermentation and is not altered during the fermentation. At the beginning of the fermentation, the medium is inoculated with the desired organism(s). In this method, fermentation is permitted to occur without the addition of any components to the system. Typically, a batch fermentation qualifies as a "batch" with respect to the addition of the carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass compositions of the batch system change constantly up to the time the fermentation is stopped. Within batch cultures, cells progress through a static lag phase to a high growth log phase and finally to a stationary phase, where growth rate is diminished or halted. If untreated, cells in the stationary phase eventually die. In general, cells in log phase are responsible for the bulk of production of product.

[00120] A suitable variation on the standard batch system is the "fed-batch fermentation" system. In this variation of a typical batch system, the substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression likely inhibits the metabolism of the cells and where it is desirable to have limited amounts of substrate in the medium. Measurement of the actual substrate concentration in fed-batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors, such as pH, dissolved oxygen and the partial pressure of waste gases, such as CO2. Batch and fed-batch fermentations are common and well known in the art.

[00121] Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor, and an equal amount of conditioned medium is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density, where cells are primarily in log phase growth. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and/or product concentration. For example, in one embodiment, a limiting nutrient, such as the carbon source or nitrogen source, is maintained at a fixed rate and all other parameters are allowed to moderate. In other systems, a number of factors affecting growth can be altered continuously while the cell concentration, measured by media turbidity, is kept constant. Continuous systems strive to maintain steady state growth conditions. Thus, cell loss due to medium being drawn off should be balanced against the cell growth rate in the fermentation. Methods of modulating nutrients and growth factors for continuous fermentation processes, as well as techniques for maximizing the rate of product formation, are well known in the art of industrial microbiology.

E. Proteins of interest produced by the engineered, transformed or derivative strain

[00122] In certain aspects, the present disclosure provides a protein of interest produced by fermenting an engineered, transformed or a derivative fungal strain, wherein the engineered, transformed or a derivative fungal strain comprises a variant histidine kinase gene and/or is capable of expressing a variant histidine kinase.

[00123] The protein of interest can be any endogenous and heterologous protein. The protein can contain one or more disulfide bridges or is a protein whose functional form is a monomer or multimer, i.e. the protein has a quaternary structure and is composed of a plurality of identical (homologous) or nonidentical (heterologous) subunits, wherein the protein of interest is preferably the protein with properties of interest. The protein of interest or the variant protein of interest may be a hemicellulase, peroxidases, protease, cellulase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratinase, reductase, oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tannase, pentosanase, mannanase, beta- glucanase, arabinosidase, hyaluronidase, chondroitinase, laccase, amylase, glucoamylase, a mixture of two or more of these enzymes, a functional fragment of any of these enzymes, or a mixture of any of these enzymes and functional fragments thereof. Non- limiting examples of proteins of interest or variant proteins may also include proteins or enzymes involved in starch metabolism, proteins or enzymes involved in glycogen metabolism, acetyl esterases, aminopeptidases, amylases, arabinases, arabinofuranosidases, carboxypeptidases, catalases, cellulases, chitinases, chymosin, cutinase, deoxyribonucleases, epimerases, esterases, a- galactosidases, β-galactosidases, a-glucanases, glucan lysases, endo- -glucanases, glucoamylases, glucose oxidases, a-glucosidases, β-glucosidases, glucuronidases, hemicellulases, hexose oxidases, hydrolases, invertases, isomerases, laccases, lipases, lyases, mannosidases, oxidases, oxidoreductases, pectate lyases, pectin acetyl esterases, pectin depolymerases, pectin methyl esterases, pectinolytic enzymes, peroxidases, phenoloxidases, phytases, polygalacturonases, proteases, rhamno-galacturonases, ribonucleases, thaumatin, transferases, transport proteins, transglutaminases, xylanases, hexose oxidase (D-hexose: 02- oxidoreductase, EC, variants thereof, functional fragments thereof, or combinations thereof.

[00124] The protein of interest may also suitably be a peptide hormone, a growth factor, a clotting factor, a chemokine, a cytokine, a lymphokine, an antibody, a receptor, an adhesion molecule, a microbial antigen (e.g., HBV surface antigen, HPV E7, etc.), a variant thereof, a functional fragment thereof, or a mixture of any of these substances above.

[00125] Other types of proteins or variants of interest may include those capable of providing nutritional value to a food or to a crop. Non-limiting examples include plant proteins that can inhibit the formation of anti-nutritive factors and plant proteins that have a more desirable amino acid composition (e.g., a higher lysine content than a non-transgenic plant).

F. Use of the composition thus made

[00126] In certain aspects, the present disclosure provides a composition comprising a protein of interest produced by an engineered fungal cell, wherein the engineered fungal cell comprises a variant histidine kinase gene and/or is capable of expressing a variant histidine kinase. The composition is suitably produced using a method provided herein. The composition comprises a protein of interest, encoded by a gene of interest, expressed using a method described herein. The composition may be used in various useful industrial applications such as, for example, in biomass hydrolysis, cleaning applications, grain processing, animal nutrition, food composition, textile treatment, and the like.

[00127] For example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith, can be used in lignocellulosic biomass hydrolysis. Lignocellulose, the world's largest renewable biomass resource, is composed mainly of lignin, cellulose, and hemicellulose, of which the large part of the latter is xylan. The conversion of lignocellulosic feedstocks into ethanol has the advantages of the ready availability of large amounts of feedstock, the desirability of avoiding burning or land filling the materials, and the cleanliness of the ethanol fuel. Wood, agricultural residues, herbaceous crops, and municipal solid wastes have been considered as feedstocks for ethanol production. Once the lignocellulose is converted to fermentable sugars, e.g., glucose, the fermentable sugars are easily fermented by yeast into ethanol. Cellulose is a polymer of the simple sugar glucose covalently linked by beta-l,4-bonds. Many microorganisms produce enzymes that hydrolyze beta-linked glucans. These enzymes include endoglucanases, cellobiohydrolases, and beta-glucosidases. Xylans are polysaccharides formed from l,4- -glycoside-linked D-xylopyranoses. Xylanases (e.g., endo-l,4-beta-xylanase, EC hydrolyze internal -l,4-xylosidic linkages in xylan to produce smaller molecular weight xylose and xylo-oligomers. The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such lignocellulosic biomass use.

[00128] In another example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith can be used in cleaning application. Enzymatic cleaning components are popular because of their ability to break down soils, stains, and other debris that are otherwise not readily removed by conventional chemical detergents. Well-known enzymes useful for cleaning include proteases and amylases, with other enzymes such as lipases, pectinases, mannanases, even certain cellulases, each providing a set of different functionalities. Proteases combat protein- based stains; amylases work on carbohydrates and starches; and lipases break down lipids or fats, for example. The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such use in cleaning applications.

[00129] In another example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith can be used in grain procession. Starch is the commonest storage carbohydrate in plants, used by the plants themselves as well as by microbes and by higher organisms. A great variety of enzymes are able to catalyze starch hydrolysis. Starch from all plant sources occurs in the form of granules, but depending on the species of the plant source, starch presents in markedly different size and physical characteristics. Acid hydrolysis of starch had widespread use in the past, however this process has now largely been replaced by enzymatic processes, which are known to demand less corrosion-resistant materials and other benefits, need less energy for heating and are relatively easier to control than the acid process. The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such use in starch degradation and grain processing. [00130] In another example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith can be used in food application. Enzymes produced by bacteria, yeasts and molds (or moulds) have been used in food application to make foods such as bread, cheese, beer and wine for many thousands of years. Today enzymes are used in bakery, cheese making, starch processing and production of fruit juices and other drinks, providing various benefits such improved texture, appearance and nutritional value, generate desirable flavors and aromas, and the like. Food enzymes typically originate in animals and plants (for example, a starch-digesting enzyme, amylase, can be obtained from germinating barley seeds) as well as from a range of beneficial microorganisms. Enzymes are deemed viable and desirable alternatives to traditional chemical-based technology, replacing synthetic chemicals in many processes. Enzymes can help improve the environmental performance of food production processes, reducing energy consumption and improving biodegradability of waste or side products. Enzymes tend to be more specific in their actions than synthetic chemicals, and as such, enzymatic processes tend to give fewer side reactions and waste or byproducts, and consequently producing higher quality products and reducing the likelihood of pollution. Enzymatic processes are often also the only processes possible. An example of this is in the production of clear apple juice concentrate, which relies on the use of the enzyme, pectinase. Most of the food enzymes are produced from microorganisms such Bacillus, Aspergillus, Streptomyces or Kluyveromyces. The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such use in food applications.

[00131] In another example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith can be used in animal feed additive. Cellulase, xylanase, beta-glucanase, alpha-amylase, protease, lipase, phytase and other carbohydrase have been widely used in animal feed industry. Since many plant based feeds contain substances with anti-nutritional factors that reduce animal growth, the enzymes added to such feeds improve digestibility of these anti-nutritional factors by degrading fibers, proteins, starches and phytates, rendering them more digestible by the animals, and enabling the use of cheaper and often locally produced feeds, while maximizing meat, egg or milk productivity. At the same time, the enzymes added to such feeds also may provide benefits supporting gut health and enhanced animal performance. The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such use in animal feed applications.

[00132] In yet a further example, the composition produced by the engineered host cell of the present disclosure, and/or using the method or process provided herewith can be used in textile applications. Enzymes have become an integral part of the textile processing. There are two well-established enzyme applications in the textile industry. First, enzymes such as amylases are commonly used in the preparatory finishing area for desizing. Second, enzymes such as cellulases are commonly used in the finishing area for softening, bio-stoning and reducing of pilling propensity of cotton goods. Other enzymes such as, for example, pectinases, lipases, proteases, catalases, xylanases etc., are also used in textile processing. Moreover, there are various applications which entail enzymes included fading of denim and non-denim, bio-scouring, bio-polishing, wool finishing, peroxide removal, decolourization of dyestuff, etc. (Cavaco-Paulo A and Giibitz GM. Textile Processing with Enzymes, 2003, 1st Edition; Chelikani P, Fita I, Loewen PC. Cell Mol Life Sci. (2004) 61: 192-208; Nalankilli.G.,Colourage, 1998, XLV (10), 17-19; Shenai, V.A. and Saraf, N.M. Technology of Finishing, (1990),Vol. X.II Edition). The disclosure provides a transformed fungal cell, which has demonstrated improved protein production, suitable and advantageous as a producer of industrial enzymes, variants, and mixtures of interest to such use in textiles applications.

G. The screening method for identifying the fungal strain capable of producing an altered level of a protein of interest

[00133] In a further aspect, the disclosure provides a method for identifying or selecting for an engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain, comprising the steps of:

(a) inoculating the strain onto the surface of agar plate with osmotic agents or/and dicarboximide or phenylpyrrole fungicide; and

(b) selecting or screening for the strains that grow faster or slower than the parental strain.

[00134] In some embodiments, the engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental (unaltered) strain, comprises a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain. [00135] In some embodiments, the engineered fungal strain capable of producing an altered level of protein of interest as compared to a parental (unaltered) strain, comprises a mutation that causes altered sensitivity or resistance to a dicarboximide or phenylpyrrole fungicide as compared to the parental strain.

[00136] In some embodiments, the engineered fungal strain capable of producing an altered level of protein of interest as compared to a parental (unaltered) strain comprises a mutation that causes altered sensitivity or resistance to osmotic pressure and altered sensitivity or resistance to a dicarboximide or phenylpyrrole fungicide compared to the parental strain.

[00137] It is believed that mutations in other components of this signaling pathway would also be beneficial to the productivity of the fungal strain. These components include, without limitation, MAP kinase proteins and transcription factors that regulate expression of other genes in response to osmotic pressure.

[00138] Strains with mutations in this pathway can be identified by screening for resistance or sensitivity to osmotic stress, such as, for example, in the presence of high levels of osmotic agent in the medium. In general, the strains are inoculated onto the surface of nutrient agar plates with various levels of osmotic agent, which can be one or a combination of one or more sugars, sugar alcohols or salts (e.g. glucose, sucrose, fructose, oligofructose, fructo-oligosaccharide, inverted sugar, sorbitol, xylitol, galactosylosorbitol, sodium chloride or potassium chloride), such that individual colonies arise and can be distinguished upon culture. The growth of the mutant was significantly impaired; it tended to form small clumps of irregular-shaped hyphae that were hyper-branched and swollen. These results indicated that the mutant is unable to form a well-defined mycelium under conditions of high osmotic pressure.

[00139] The altered sensitivity may manifest itself as an ability to grow faster than the parent, non-mutated cell under conditions of high osmotic pressure (i.e., resistance to high osmotic pressure) or as a reduced growth rate compared to the parent, non-mutated cell under conditions of high osmotic pressure (i.e., sensitivity to high osmotic pressure).

[00140] Individual colonies that grow faster or slower than the parental type are picked for further evaluation by growth under identical conditions in submerged (liquid culture) and their specific total secreted protein production rates and yields on fed sugar compared. In this way, mutant fungal strains are identified that have altered sensitivity to osmotic pressure and increased secreted protein production rates compared to a parental strain.


[00141] Aspects of the present strains, compositions and methods may be further understood in light of the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art.

Example 1

Creating an engineered fungal strain with one mutation in nikl gene

1.1 Generation ofniklM743T gene replacement cassette

[00142] A gene replacement construct was made (Figure 2) by fusing a DNA fragment containing the 5' region upstream of the nikl locus, a /ox -flanked hygromycin B -resistance marker cassette and two DNA fragments containing the promoter and nikl gene (including the T to C substitution that changes the amino acid at position 743 from methionine to threonine), with the 2μ backbone-containing yeast vector pRS426 (from pRS426 phagemid in E. coli, ATCC® 77107™).

[00143] The following primers were prepared by Integrated DNA Technologies, Inc. (Coralville, IA, USA)

[00144] RRab88 (Forward) -



-3' (SEQ ID NO:2), which was used to amplify DNA sequence upstream of nikl (5' Flank) with Avrll restriction site and vector backbone tail overhang for plasmid pRRabniklM743T.

[00145] RRab89 (Reverse) - 5 ' -


-3' (SEQ ID NO:3), which was used to amplify the vector backbone with an Avrll restriction site and 5' Flank tail overhang for plasmid pRRabniklM743T.

[00146] RRab90 (Forward) - 5 ' -

CTGCTCGAGAAGAACCGTGAGCGAGCCTAGGGTGAGGGTTAATTGCGCGCTTGG C -3' (SEQ ID NO:4), which was used to amplify the vector backbone with an Avrll restriction site and 3' Flank fragment 2 tail overhang for plasmid pRRabniklM743T.

[00147] RRab91 (Reverse) - 5 ' -


-3' (SEQ ID NO:5), which was used to amplify nikl DNA sequence (3' Flank, fragment 2) with Avrll restriction site and vector backbone tail overhang for plasmid pRRabniklM743T.

[00148] RRab92 (Forward) - 5 ' -

GAATCCACGTGCCGCGAGGCTCAGCATTTAAATATAACTTCGTATAGCATACATT ATACGAAGTTATCCTGGGCTTGTGACTGGTCGCGA -3' (SEQ ID NO:6), which was used to amplify the hygromycin resistance marker with a loxP site along with a Swal restriction site and 5' Flank tail overhang for plasmid pRRabniklM743T.

[00149] RRab93 (Reverse) - 5'-

TCGCGACCAGTCACAAGCCCAGGATAACTTCGTATAATGTATGCTATACGAAGTT ATATTTAAATGCTGAGCCTCGCGGCACGTGGATTC -3' (SEQ ID NO:7), which was used to amplify DNA sequence upstream of nikl (5 ' Flank) with a Swal restriction site and hph + loxP site tail overhang for plasmid pRRabniklM743T.

[00150] RRab94 (Forward) - 5 ' -

CGTAACACCCAATACGCCGGCCGATAACTTCGTATAGCATACATTATACGAAGTT ATGCGGCCGCGCCCAGGATCACAAACCCACCGCAG -3' (SEQ ID NO: 8), which was used to amplify nikl gene (3' Flank Fragment 1) with No tl restriction site and hph + loxP site tail overhang for plasmid pRRabniklM743T.

[00151] RRab95 (Reverse) - 5'-

CTGCGGTGGGTTTGTGATCCTGGGCGCGGCCGCATAACTTCGTATAATGTATGCT ATACGAAGTTATCGGCCGGCGTATTGGGTGTTACG -3' (SEQ ID NO: 9), which was used to amplify the hygromycin resistance marker with a loxP site along with a Notl restriction site and 3' Flank fragment 1 tail overhang for plasmid pRRabniklM743T.

[00152] RRab 110 (Forward) - 5 ' -

GAAATTGCCTCCGTCACAACAGCCGTCGCTCACGGCGATCTGACAAAGAA - 3'(SEQ ID NO: 10), which was used to amplify nikl DNA sequence (3' Flank Fragment 2) with 3' Flank fragment 1 overhang for plasmid pRRabniklM743T. [00153] RRabl 11 (Reverse) - 5'-

TTCTTTGTCAGATCGCCGTGAGCGACGGCTGTTGTGACGGAGGCAATTTC -3 ' (SEQ ID NO: 11), which was used to amplify nikl gene (3' Flank Fragment 1) with 3' Flank fragment 2 overhang for plasmid pRRabniklM743T.

[00154] PCR amplifications were performed using the PfuUltrall Fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) and a Tetrad 2 thermal cycler (Bio-Rad, Hercules, CA, USA). PCR products were separated on EX gels (Life Technologies, Grand Island, NY, USA), and fragments of the correct length were purified using the QIAquick Gel Extraction kit (Qiagen Inc., Valencia, CA, USA). Each of the four DNA fragments had a 5' primer extension complementary to the adjacent DNA fragment to provide a sufficient length of homologous sequence for recombination, and all were recombined into the final construct in the Saccharomyces cerevisiae strain YPH499 (ATCC 76625) using the yeast's native recombination machinery. The Frozen EZ Yeast Transformation II™ kit (Zymo Research, Orange, CA, USA) was used for yeast transformations. Transformants were plated on SD-U plates to select for complementation of uridine auxotrophy. Individual colonies from the transformation plates were selected to extract plasmid DNA using the Zymoprep™ Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA). From each miniprep 1 μΐ^ was directly transformed into One Shot® TOP10 chemically competent E. coli cells (Life Technologies, Grand Island, NY, USA), and plated on LB plates with carbenicillin. Individual colonies from the transformation plates were selected to extract plasmid DNA using the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA). DNA obtained this way was sequenced at Sequetech Corporation (Mountain View, CA, USA), and a plasmid with the correct sequence selected for DNA amplification. The gene replacement cassette was amplified with PCR using the following primers:



[00155] The PCR product was purified and concentrated using a QIAquick PCR purification kit (Qiagen Inc., Valencia, CA, USA).

1.2. RLP37 host strain transformation with nikl allele-containing gene replacement cassette, candidate selection, verification and characterization [00156] The purified concentrated gene replacement cassette was transformed into the T. reesei host strain RLP37 (described by Sheir-Neiss, et al., Appl. Microbiol. Biotechnol. 20:46-53 (1984)) using PEG-mediated transformation (Penttila et al., Gene, 61(2): 155-64 (1987)). Transformants were plated on Vogel's medium (Vogel, Microbial Genet. Bull. 13:42-43 (1956); Vogel, Am. Nat. 98:435-446 (1964)) containing 100 μg/mL hygromycin B using overlays, and incubated at 28°C. Genomic DNA from stable transformants resistant to hygromycin B was extracted using the NucleoSpin® Plantll kit (Machery-Nagel, Bethlehem, PA, USA). This genomic DNA was then used as template for diagnostic PCRs to confirm homologous recombination of the gene replacement at the native nikl locus. The primer pairs RRabl l7 and RRabl67 used for diagnostic PCR are specified.

RRabl l7 (5'- CGAACTGTGACCTTTCAAGT -3') (SEQ ID NO: 14); and


[00157] A strain with verified homologous integration of the niklM743T - niammg gene replacement cassette labeled RLP37 NiklM743T was selected and spore-purified. Spore- purification was performed by harvesting mature aerial conidiospores produced on a PDA plate culture in water, making lOx serial dilutions of the conidiospore suspension, plating the serial dilutions of the suspension on PDA plates and incubating them overnight at 28° C. The selected spore -purified strain was used for determining the effect of the gene replacement on protein production and remaining experiments. The phenotype of the RLP37 NiklM743T strain on PDA plates consisted of slower growth and a lower yield of conidiospores when compared to the host RLP37 strain (Figures 3 A and 3B). When sorbitol was added to Vogel's minimal medium colony growth of the strain was restricted compared to RLP37, indicating sensitivity to sorbitol most likely due to an inability to regulate a response to osmotic stress (Figures 3 C and 3 D).

1.3 Fermentation of T. reesei RLP37 NiklM743T to evaluate total protein production

[00158] Trichoderma reesei strains RLP37 NikM743T and RLP37 were grown under identical conditions in submerged (liquid culture), and their specific total protein production rates and yields on fed sugar compared in 2 L (DASGIP) and 14 L fermentors.

[00159] To create a seed culture, the spores of each strain were added separately to 50 mL of citrate minimal medium in a 250 mL flask. The cultures were grown for 48 h at 30°C and 170 rpm in a shaking incubator. After 48 h, 145.6 mL of 50% glucose, and 0.6 g/kg of CaCi2, adjusted to pH 3.5 was inoculated with the seed culture. Thereafter, the temperature was maintained at 30°C, and pH at 3.5. A glucose-sophorose feed was thereafter introduced, and the temperature was dropped to 25° C, pH increased to 4.8.

[00160] Dry cell weight, total protein concentrations and other parameters were measured, and specific total protein production rates and yield on fed sugars calculated. The RLP37 NiklM743T strain containing the niklM743T allele at the native locus showed an improvement in the specific total protein production rate (Figure 4A) and an improvement in yield on fed sugars over the RLP37 host containing the native nikl allele (Figure 4B).

[00161] For 14L fermentations, strains RLP37 NikM743T and RLP37 were grown under identical conditions in submerged (liquid culture), and their total protein production and specific protein production rates were also compared. Fermentation runs were carried out using a similarly-prepared seed culture, and in 14 L fermenters. Post fermentation, total protein production and specific protein production rates were compared.

[00162] The RLP37 NiklM743T strain showed a 101% increase in total protein specific production rate (Figure 5A), and a 46% improvement in yield on fed sugars (Figure 5B), indicating that introducing the modified nikl histidine kinase into a host T. reesei strain causes an increase in protein production.

Example 2

Creating a fungal strain with nikl gene deletion

2.1 Anikl : :hph deletion cassette design and creation

[00163] A gene replacement construct was made (Figure 6) by fusing a DNA fragment containing the 5' flank of the nikl gene, a /ox -flanked hygromycin B-resistance cassette and a DNA fragment containing the 3' flank of the nikl gene with the 2μ backbone-containing yeast vector pRS426 (from pRS426 phagemid in E. coli, ATCC® 77107™). The following primers were made by Integrated DNA Technologies Inc. (Coralville, IA, USA).

[00164] RRab266 (Forward) - 5'-

CCTGGGGAACCCCCCAGCGCCCGGCGAGCTCATAACTTCGTATAGCATACATTAT ACGAAGTTATCCTGGGCTTGTGACTGGTCGCGAGC-3' (SEQ ID NO: 16), which was used to amplify the hygromycin resistance marker with a loxP site along with a Sacl restriction site and 5' Flank tail overhang for plasmid pRRabAnikl. [00165] RRab267 (Reverse) - 5'-

CTTTCGCCGTCCAGGCGTCCAGACACCTGGTATAACTTCGTATAATGTATGCTAT ACGAAGTTATCGGCCGGCGTATTGGGTGTTACGGA-3' (SEQ ID NO: 17), which was used to amplify the hygromycin resistance marker with a loxP site along with a SexAI restriction site and 3' Flank tail overhang for plasmid pRRabA nikl.

[00166] RRab268(Forward) - 5'-

TCCGTAACACCCAATACGCCGGCCGATAACTTCGTATAGCATACATTATACGAAG TTATACCAGGTGTCTGGACGCCTGGACGGCGAAAGA-3' (SEQ ID NO: 18), which was used to amplify DNA sequence downstream of nikl (3' Flank) with SexAI restriction site and hph + loxP site tail overhang for plasmid pRRabAnikl.

[00167] RRab269 (Reverse) - 5' -

CGCCAAGCGCGCAATTAACCCTCACGGCCATAATGGCCGCTGGGTTCTGAACCTG TAAAGTAC-3' (SEQ ID NO: 19), which was used to amplify DNA sequence downstream of nikl (3' Flank) with Sfil restriction site and vector backbone tail overhang for plasmid pRRabAnikl.

[00168] RRab270 (Forward) - 5 ' -

GTACTTTACAGGTTCAGAACCCAGCGGCCATTATGGCCGTGAGGGTTAATTGCGC GCTTGGCG-3' (SEQ ID NO:20), which was used to amplify the vector backbone with Sfil restriction site and 3' flank tail overhang for plasmid pRRabAnikl.

[00169] RRab271 (Reverse) -5'-


C-3' (SEQ ID NO:21), which was used to amplify DNA sequence upstream of nikl (5' Flank) with Hindlll restriction site and vector backbone tail overhang for plasmid pRRabAnikl.

[00170] RRab272 (Forward) - 5 ' -


A-3' (SEQ ID NO:22), which was used to amplify DNA sequence upstream of nikl (5' Flank) with Hindlll restriction site and vector backbone tail overhang for plasmid pRRabAnikl.

[00171] RRab273 (Reverse) - 5'-

GCTCGCGACCAGTCACAAGCCCAGGATAACTTCGTATAATGTATGCTATACGAAG TTATGAGCTCGCCGGGCGCTGGGGGGTTCCCCAGG-3' (SEQ ID NO:23, which was used to amplify DNA sequence upstream of nikl (5 ' Flank) with Sacl restriction site and hph + loxP site tail overhang for plasmid pRRabDelta nikl.

[00172] PCR amplifications were performed using the PfuUltrall Fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) and a Tetrad 2 thermal cycler (Bio-Rad, Hercules, CA, USA). PCR products were separated on EX gels (Life Technologies, Grand Island, NY, USA), and fragments of the correct length were purified using the QIAquick Gel Extraction kit (Qiagen Inc., Valencia, CA, USA). Each of the four DNA fragments had a 5' primer extension complementary to the adjacent DNA fragment to provide a sufficient length of homologous sequence for recombination, and all were recombined into the final construct in the Saccharomyces cerevisiae strain YPH499 (ATCC 76625) using the yeast's native recombination machinery. The Frozen EZ Yeast Transformation II™ kit (Zymo Research, Orange, CA, USA) was used for yeast transformations. Transformants were plated on SD-U plates to select for complementation of uridine auxotrophy. Individual colonies from the transformation plates were selected to extract plasmid DNA using the Zymoprep™ Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA). From each miniprep 1 μΐ^ was directly transformed into One Shot® TOP10 chemically competent E. coli cells (Life Technologies, Grand Island, NY, USA), and plated on LB plates with carbenicillin. Individual colonies from the transformation plates were selected to extract plasmid DNA using the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA). DNA obtained this way was sequenced at Sequetech Corporation (Mountain View, CA, USA), and a plasmid with the correct sequence selected for DNA amplification. The gene deletion cassette was amplified using primers RRab 296 and RRab297.


[00173] The PCR product was purified and concentrated using a QIAquick PCR purification kit (Qiagen Inc., Valencia, CA, USA).

2.2 RLP37 host strain transformation with Anikl::hph deletion cassette, candidate selection. verification and characterization [00174] The purified concentrated Anikl::hph cassette was transformed into the T. reesei host strain RLP37 using PEG-mediated transformation (Penttila, M., Nevalainen, H., Ratto, M., Salminen, E., and Knowles, J. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene (1987) 61: 155-164.)· Transformants were plated on Vogel's minimal medium containing 100 μg/mL hygromycin B using overlays, and incubated at 28°C. Genomic DNA from stable transformants resistant to hygromycin B was extracted using NucleoSpin® Plantll kit (Machery-Nagel, Bethlehem, PA, USA). This genomic DNA was then used as template for diagnostic PCRs to confirm homologous recombination of the deletion cassette at the native nikl locus.

[00175] A strain with verified homologous integration of the Anikl::hph deletion cassette labeled RLP37 NiklM743T was selected and spore-purified. Spore -purification was performed by harvesting mature aerial conidiospores produced on a PDA plate culture in water, making lOx serial dilutions of the conidiospore suspension, plating the serial dilutions of the suspension on PDA plates and incubating them overnight at 28°C. The selected spore- purified strain was used for determining the effect of the gene replacement on protein production and remaining experiments. The phenotype of the RLP37 ANikl strain on PDA plates consisted of slower growth and a lower yield of conidiospores when compared to the host RLP37 strain (Figures 3B and 3E). When sorbitol was added to Vogel's minimal medium colony growth of the strain was restricted compared to strain RLP37, indicating sensitivity to sorbitol possibly due to an inability to regulate a response to osmotic stress (Figures 3D and 3F).

2.3 Fermentation of T. reesei RLP37 ANikl to evaluate total protein production

[00176] The RLP37 host strain and the RLP37 ANikl strain were tested for the total protein production rate and yield on fed sugars in 2 L DASGIP fermentors. Seed cultures and fermentation procedures were performed in accordance with the same as described above in Example 1.

[00177] Dry cell weight, total protein concentrations and other parameters were measured, and specific total protein production rates and yield on fed sugars calculated. The total protein production rate of strain RLP37 ANikl was reduced by 85%, and the yield on fed sugars by 39%, compared to the RLP37 control strain. This indicates that the deletion of the nikl gene is detrimental to total protein production, and does not have the same effect as the replacement of the native nikl allele with the nikl allele. This also indicates that the niklM743T allele is a gain-of-function allele resulting in a gain-of-function phenotype (Figure 7).


Engineered Fungal Strain as an Expression Host of a Cellulase of Interest

3.1 Transformation of T. reesei host strain overexpressing CBH1 with niklM743T allele- containing gene replacement cassette, candidate selection, verification and characterization

[00178] The purified concentrated gene replacement cassette described in example 1.1 was transformed into a T. reesei host strain overexpressing CBH1 using PEG-mediated transformation (Penttila et al., Gene, 61(2): 155-64 (1987)). Transformants were plated on Vogel's minimal medium containing 30 μg/mL hygromycin B using overlays, and incubated at 28°C. Genomic DNA from stable transformants resistant to 100 μg/mL hygromycin B was extracted using the NucleoSpin® Plantll kit (Machery-Nagel, Bethlehem, PA, USA). This genomic DNA was then used as template for diagnostic PCRs to confirm homologous recombination of the gene replacement at the native nikl locus. The primer pairs RRabll7 (SEQ ID NO: 14) and RRabl67 (SEQ ID NO: 15) were used for diagnostic PCR.

[00179] A strain with verified homologous integration of the niklM743T -containing gene replacement cassette labeled Cbhl NiklM743T was selected and spore-purified. Spore- purification was performed by harvesting mature aerial conidiospores produced on a PDA plate culture in water, making lOx serial dilutions of the conidiospore suspension, plating the serial dilutions of the suspension on PDA plates and incubating them overnight at 28 °C. The selected spore-purified strain was used for determining the effect of the gene replacement on protein production and remaining experiments.

[00180] When sorbitol was added to Vogel's minimal medium, colony growth of the Cbhl Nikl™ strain was restricted, indicating sensitivity to sorbitol possibly due to an inability to regulate a response to osmotic stress (Figures 8E-8H). The native niklWT was replaced with the niklM743T allele in the T. reesei strain that does not overexpress the CBH1 cellulase (NoCbhl). It showed the same response to sorbitol, confirming that the niklM743T is responsible for this response (Figures 8A-8D).

3.2 Fermentation of T. reesei Cbhl Nikl to evaluate total protein production [00181] Trichoderma reesei CBH1 overexpression strain as described above and Trichoderma reesei Cbhl NiklM743T were grown under identical conditions in submerged (liquid) culture. The respective specific total protein production rates and yields on fed sugar were compared in 2 L (DASGIP) and 14 L scale fermentors.

[00182] To create a seed culture, the spores of each strain were added separately to 50 mL of citrate minimal medium in a 250 mL flask. The cultures were grown for 48 h at 30°C and 170 rpm in a shaking incubator. After 48 h, 145.6 mL of 50% glucose, and 0.6 g/kg of CaCl2, adjusted to pH 3.5, was inoculated with the seed culture. Thereafter, the temperature was maintained at 32°C, and pH at 3.5. A glucose-sophorose feed was thereafter introduced, and the temperature was dropped to 28°C, pH increased to 4.5.

[00183] Dry cell weight, total protein concentrations and other parameters were measured, and specific total protein production rates and yield on fed sugars calculated. The Cbhl NiklM743T strain showed a 19 % improvement in total specific protein production rate, and a 46 % improvement in yield on fed sugars over strain Cbhl (Figure 9).

[00184] For 14L fermentations, Trichoderma reesei Cbhl strain and Trichoderma reesei Cbhl NiklM743T were grown under identical conditions in submerged (liquid culture), and their total protein production and specific protein production rates were compared. Fermentation runs were carried out using a similarly prepared seed culture, and in 14 L fermenters. Post fermentation, total protein production and specific protein production rates were compared.

[00185] The Cbhl NiklM743T strain showed a 30% increase in total protein specific production rate (Figure 10A), and a 20% improvement in yield on fed sugars (Figure 10B) over Cbhl strain, indicating that introducing the modified nikl histidine kinase into a T. reesei CBH1 overexpressing strain causes an increase in protein production.


Reversion of the Gain-of-Function Phenotype by Replacement of niklM743T allele with niklwt allele in a T. reesei host

4.1 niklWT gene replacement cassette design and creation

[00186] A gene replacement construct was prepared (Figure 11) by fusing a DNA fragment containing the 5' region upstream of the nikl locus, a /ox -flanked hygromycin B-resistance cassette and a DNA fragment containing the promoter and nikl wild type gene, with the 2μ backbone-containing yeast vector pRS426 (from pRS426 phagemid in E. coli, ATCC® 77107™).

[00187] Primer pairs, RRab88 (SEQ ID NO:2) and RRab89 (SEQ ID NO:3); RRab90 (SEQ ID NO:4) and RRab91 (SEQ ID NO:5); RRab92 (SEQ ID NO:6) and RRab93 (SEQ ID NO:7); RRab94 (SEQ ID NO:8) and RRab95 (SEQ ID NO:9); RRabl lO (SEQ ID NO: 10) and RRablll (SEQ ID NO: 11) were used to amplify the DNA fragments (as described in Example 1.1, above).

[00188] PCR amplifications were performed using the PfuUltrall Fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) and a Tetrad 2 thermal cycler (Bio-Rad, Hercules, CA, USA). PCR products were separated on EX gels (Life Technologies, Grand Island, NY, USA), and fragments of the correct length were purified using the QIAquick Gel Extraction kit (Qiagen Inc., Valencia, CA, USA). Each of the four DNA fragments had a 5' primer extension complementary to the adjacent DNA fragment to provide a sufficient length of homologous sequence for recombination, and all were recombined into the final construct in the Saccharomyces cerevisiae strain YPH499 (ATCC 76625) using the yeast's native recombination machinery. The Frozen EZ Yeast Transformation II™ kit (Zymo Research, Orange, CA, USA) was used for yeast transformations. Transformants were plated on SD-U plates to select for complementation of uridine auxotrophy. Individual colonies from the transformation plates were selected to extract plasmid DNA using the Zymoprep™ Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA).

[00189] From each miniprep 1 μΐ^ was directly transformed into One Shot® TOP10 chemically competent E. coli cells (Life Technologies, Grand Island, NY, USA), and plated on LB plates with carbenicillin. Individual colonies from the transformation plates were selected to extract plasmid DNA using the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA). DNA obtained this way was sequenced at Sequetech Corporation (Mountain View, CA, USA), and a plasmid with the correct sequence selected for DNA amplification. The gene replacement cassette was amplified using primers RRal56 (SEQ ID NO: 12) and RRabl57 (SEQ ID NO: 13), and the PCR product was purified and concentrated using a QIAquick PCR purification kit (Qiagen Inc., Valencia, CA, USA).

4.2 T. reesei strain TR Nikl transformation with nikl allele-containing gene replacement cassette, candidate selection, verification and characterization [00190] The purified concentrated nikl -containing gene replacement cassette was transformed into the T. reesei TR NiklM743T host strain containing niklM743T at the native nikl locus, using PEG-mediated transformation (Penttila et al, Gene, 61(2): 155-64 (1987)). The TR NiklM743T host strain was derived from strain RLP37. Transformants were plated on Vogel's minimal medium (Vogel, Microbial Genet. Bull. 13:42-43 (1956); Vogel, Am. Nat. 98:435-446 (1964)) containing 30 μg/mL hygromycin B using overlays, and incubated at 28°C. Genomic DNA from stable transformants resistant to 100 μg/mL hygromycin B was extracted using a NucleoSpin® Plantll kit (Machery-Nagel, Bethlehem, PA, USA). This genomic DNA was then used as template for diagnostic PCRs to confirm homologous recombination of the gene replacement at the native nikl locus. The primer pairs RRabll7 (SEQ ID NO: 14) and RRabl67 (SEQ ID NO: 15) were used for diagnostic PCR.

[00191] A strain with verified homologous integration of the nikl wr-containing gene replacement cassette at the native nikl locus was selected, labeled TR NiklWT, and spore- purified. Spore-purification was performed by harvesting mature aerial conidiospores produced on a PDA plate culture in water, making lOx serial dilutions of the conidiospore suspension, plating the serial dilutions of the suspension on PDA plates and incubating them overnight at 28°C. The selected spore-purified strain was used for determining the effect of the gene replacement on protein production and remaining experiments. The phenotype of the TR NiklWT strain on Vogel's minimal medium plates consisted of faster growth and a higher yield of conidiospores when compared to the TR NiklM743T strain (Figures 81 and 8J).

[00192] When sorbitol was added to Vogel's minimal medium colony growth of the strain was not restricted compared to TR NiklM743T, indicating that the sensitivity to sorbitol possibly due to an inability to regulate a response to osmotic stress was reverted (Figures 8K and 8L).

4.3 Fermentation of T. reesei Nikl to evaluate total protein production

[00193] Trichoderma reesei strains TR NiklWT, and TR NiklM743T were grown under identical conditions in submerged (liquid) culture, and their specific total protein production rates and yields on fed sugar were compared in 2 L (DASGIP) fermentors.

[00194] To create a seed culture, the spores of each strain were added separately to 50 mL of citrate minimal medium in a 250 mL flask. The cultures were grown for 48 h at 30°C and 170 rpm in a shaking incubator. After 48 h, 145.6 mL of 50% glucose, and 0.6 g/kg of CaC12, adjusted to pH 3.5 was inoculated with the seed culture. Thereafter, the temperature was maintained at 30°C, and pH at 3.5. A glucose-sophorose feed was thereafter introduced, and the temperature was dropped to 25° C, pH increased to 4.8.

[00195] Dry cell weight, total protein concentrations and other parameters were measured, and specific total protein production rates and yield on fed sugars calculated. The TR NiklWT strain containing the niklWT allele at the native nikl locus showed a 36% reduction in the specific total protein production rate and a 29% reduction in yield on fed sugars compared to the TR NiklM743T strain containing the nikl M743T allele at the nikl locus (Figure 12). This showed that replacing the niklM743T allele with the native nikl WT allele returns the gain-of- function phenotype to the wild type phenotype, confirming that the niklM743T allele alone is responsible for the improved total protein production rate and yield on fed sugars.


Screening for Osmotic Sensitivity or Resistance, and Improved Secreted Protein


[00196] Any method may be employed to create a population of Trichoderma reesei mutated cells. For example, conidiospores may be obtained from a strain of T. reesei and subjected to treatment with UV irradiation, X-ray irradiation, gamma-ray irradiation or chemical mutagenesis with a mutagenic agent such as NTG (N-methyl-N'-nitro-N- nitrosoguanidine) or EMS (ethylmethanesulfonate) (Davis, R.H. and De Serres, F. J. (1970) Genetic and microbiological research techniques for Neurospora crassa. In, Methods in Enzymology Voll7A. Eds. Tabor, H. and Tabor, C.W. pp79-143). Alternatively, spontaneous mutation may be relied upon. Additionally, molecular biology methods of mutagenesis such as insertional mutagenesis via Agrobacterium transformation may be employed (Sugui, J.A., Chang, Y.C. and Kwon-Chung, K.J. (2005) Appl. Environ. Microbiol. 71:1798-17802).

[00197] The population of mutated cells is subjected to a screen to identify those with altered sensitivity to high osmotic pressure. The altered sensitivity may manifest itself as an ability to grow faster than the parent non-mutated cell under conditions of high osmotic pressure (i.e., resistance to high osmotic pressure) or as a reduced growth rate compared to the parent, non-mutated cell under conditions of high osmotic pressure (i.e., sensitivity to high osmotic pressure).

[00198] To screen for altered sensitivity to high osmotic pressure, T. reesei cells are inoculated onto the surface of nutrient agar plates with various levels of added sugars, sugar alcohols or salts such that individual colonies arise and can be distinguished upon culture. The nutrient agar is Vogel's minimal medium with glucose (Vogel, Microbial Genet. Bull. 13:42-43 (1956); Vogel, Am. Nat. 98:435-446 (1964)). This medium is supplemented with 1M - 1.2M sorbitol, or 0.7M - 1.4M sodium chloride, or 0.5M - 1.4M potassium chloride. Individual colonies that grow faster or slower than the parental type are picked for further evaluation by growth under identical conditions in submerged (liquid culture) and their specific total secreted protein production rates and yields on fed sugar compared. In this way, mutant strains of T. reesei are identified that have altered sensitivity to osmotic pressure and increased secreted protein production rates compared to a parental strain.


Screening or Selecting for Resistance to Fungicide and Improved Secreted Protein


[00199] Any method may be employed to create a population of Trichoderma reesei mutated cells. For example, conidiospores may be obtained from a strain of T. reesei and subjected to treatment with UV irradiation, X-ray irradiation, gamma-ray irradiation or chemical mutagenesis with a mutagenic agent such as NTG (N-methyl-N'-nitro-N- nitrosoguanidine) or EMS (ethylmethanesulfonate) (Davis, R.H. and De Serres, F. J. (1970) Genetic and microbiological research techniques for Neurospora crassa. In, Methods in Enzymology Voll7A. Eds. Tabor, H. and Tabor, C.W. pp79-143). Alternatively, spontaneous mutation may be relied upon. Additionally, molecular biology methods of mutagenesis such as insertional mutagenesis via Agrobacterium transformation may be employed (Sugui, J.A., Chang, Y.C. and Kwon-Chung, K.J. (2005) Appl. Environ. Microbiol. 71 : 1798-17802).

[00200] The population of mutated cells can also be subjected to a screen to identify those with altered sensitivity to a dicarboximide and phenylpyrrole fungicides such as iprodione or fludioxonil in the medium. The altered sensitivity may manifest itself as an ability to grow faster than the parent non-mutated cell in the presence of the fungicide (i.e. resistance to fungicide), or as a reduced growth rate compared to the parent non-mutated cell in the presence of the fungicide (i.e. sensitivity to fungicide).

[00201] To select for resistance to iprodione or fludioxonil, T. reesei cells are inoculated onto the surface of nutrient agar plates with various levels of these fungicides such that individual colonies arise and can be distinguished upon culture. The nutrient agar is Vogel's minimal medium with glucose (Vogel, Microbial Genet. Bull. 13:42-43 (1956); Vogel, Am. Nat. 98:435-446 (1964)). Individual colonies that grow faster than the parental type are picked for further evaluation by growth under identical conditions in submerged (liquid culture) and their specific total secreted protein production rates and yields on fed sugar compared. In this way, mutant strains of T. reesei are identified that are resistant to iprodione or fludioxonil and have increased secreted protein production rates compared to a parental strain.

[00202] For use in liquid medium fungicide screens, conidiospores from T. reesei strains RLP37 and RLP37 NikM743T were harvested and diluted to a concentration of 10,000/ml. Equal numbers of spores were inoculated into liquid YEG medium (5g/L yeast extract, 22g/l glucose. H20) containing 0, 11.25, 22.5, 45 or 90 μΜ iprodione or fludioxonil and allowed to germinate overnight at 28oC. RLP37 conidiospores germinated and produced elongated hyphae in medium with no iprodione or fludioxonil. At 11.25 μΜ iprodione or fludioxonil germination of this strain was apparent but there was clear inhibition of hyphal growth. At concentrations of iprodione or fludioxonil above 11.25 μΜ there was complete inhibition of germination and growth with strain RLP37. In contrast, RLP37 NikM743T conidiospores germinated and produced elongated hyphae at all concentrations of iprodione or fludioxonil tested. This clearly demonstrated that the NikM743T mutation confers resistance to the fungicides iprodione and fludioxonil. Furthermore, sensitivity of RLP37 and resistance of RLP37 NikM743T persisted when inoculation culture was scaled up to 107 spores/ml.

[00203] For use in agar (solid) medium fungicide screens or selections, conidiospores from T. reesei strains RLP37 and RLP37 NikM743T were harvested and diluted to a concentration such that a known number of spores were plated per 10 cm plate containing nutrient agar Vogel's minimal medium with glucose (Vogel, Microbial Genet. Bull. 13:42-43 (1956); Vogel, Am. Nat. 98:435-446 (1964)). Equal numbers of spores for each strain were spread onto the surface of nutrient agar plates containing 0, 11.25, 22.5, 45 or 90 μΜ iprodione and allowed to grow for 3 days at 32°C. At 11.25 and 22.5 μΜ, RLP37 colonies failed to grow to any larger than the size of the tip of a pin. At 45 μΜ and above, RLP37 colonies failed to grow at all. In contrast, RLP37 NikM743T colonies grew similarly to colonies growing on nutrient agar plates without iprodione. This clearly demonstrated that the niklM743T mutation confers resistance to iprodione in solid agar media (Figures 13). To establish the sensitivity of iprodione in selecting for nikl mutants occurring infrequently in a large population of cells containing wild type nikl, a known number of RLP37 NikM743T spores (down to 5 spores) were mixed into a known, much higher number of RLP37 (105-108). This mixed population of spores was spread onto Vogel's minimal medium agar containing 45 μΜ iprodione and allowed to grow for 3 days at 32°C. Colonies were counted and evaluated for presence of the niklM743T mutation by PCR and sequencing (Sequetech, Mountain View, CA, USA), using the following primers:

[00204] RRabl26 (forward) 5' - CGGCATGGCCATGAACCTCA - 3' (SEQ ID NO:40)

[00205] RRabl61 (reverse) 5' - GCACTGAAGCCGGTTAGTTC - 3' (SEQ ID NO:41)

[00206] RRabl28 (forward) 5' - CTGTCCAGCTTCTGCTACGA - 3' (SEQ ID NO:42)

[00207] Selective plating on 45 μΜ iprodione is sensitive enough to detect as few as 5 mmuuttaannttss iinn 110066 wwiilldd ttyyppe spores. High false positive rates occur when plating more than spores per 10 cm plate.

[00208] Since the nikl mutation confers sorbitol sensitivity as well as iprodione resistance, a depletion of non-sorbitol sensitive spores may enrich for nikl mutants with desired features. RLP37 and RLP37 NikM743T were grown up in YEG containing 1.2 M sorbitol overnight at 28°C and then filtered through 4 layers of Miracloth (VWR, Radnor, PA, USA) prior to plating known numbers of spores on Vogel's minimal medium agar containing 45 μΜ iprodione. The Miracloth filtration resulted in a 98% reduction in number of RLP37 colonies compared to unfiltered RLP37. In contrast, only a 2-8% reduction was observed for RLP37 NikM743T post-filtration. However, although >90% of RLP37 NikM743T spores passed through the Miracloth filter, only 1-2% of RLP37 Nik'117431' spores that came through filtration were able to be recovered on plates. Depending on the frequency of spontaneous mutation in nikl, this depletion method may offer an advantage prior to selection on agar plates containing iprodione. If enough mutants were accumulated, although the sorbitol depletion may eliminate the majority of mutants, there is also a reduction in false positives from filtering wild-type spores that germinate under sorbitol, therefore increasing the potential throughput. Sorbitol sensitivity and dicarboximide fungicide resistance are both features associated with desired outcome in protein productivity, so by combining the sorbitol depletion method with selection on fungicide plates, the potential increase in throughput may improve the chances of identifying spontaneous mutants with desired specific productivity.

[00209] To select for cells spontaneously mutated to have fungicide resistance, conidiospores from T. reesei strain RLP37 were harvested and diluted such that 106 spores were spread onto the surface of each nutrient agar plates containing 45 μΜ iprodione. The nutrient agar is Vogel's minimal medium with glucose (Vogel, Microbial Genet. Bull. 13:42- 43 (1956); Vogel, Am. Nat. 98:435-446 (1964)). Individual colonies that grew were picked for further evaluation by sequencing of the nikl locus. Colonies resistant to fungicide contained at least one mutation in the coding region of nikl. By this method, iprodione resistant mutant strains of T. reesei containing mutations in nikl were, obtained.


Creating an Engineered Aspergillus niger strain with one mutation in nikl gene

7.1 Generation of niklM786T gene replacement cassette

[00210] A gene replacement construct was made (Figure 14) by fusing a DNA fragment containing the 5' region upstream of the nikl locus, a pyrG marker cassette, and three DNA fragments containing the promoter and nikl gene (including the T to C substitution that changes the amino acid at position 786 from methionine to threonine), with the 2μ backbone- containing yeast vector pRS426 (from pRS426 phagemid in E. coli, ATCC® 77107™).

[00211] The following primers were prepared by Integrated DNA Technologies, Inc. (Coralville, IA, USA):

[00212] RN0286 (Forward) - 5 ' -

CGATAAGCTTGATATCGAATTCCTGGTTCCTGAATAGACTTGGGGTTG -3' (SEQ ID NO:26), which was used to amplify the DNA sequence upstream of nikl (5' Fragment) for plasmid pRNniklM786T, and contains a vector backbone tail overhang.

[00213] RN0508 (Reverse) - 5'-

CCGGGTACCGAGCTCGAATTCGTAATCATGGGCCCAGTACTAGATAGATACCTG -3 ' (SEQ ID NO:27), which was used to amplify the DNA sequence upstream of nikl (5' Fragment) for plasmid pRNniklM786T, and contains a pyrG marker cassette tail overhang.

[00214] RN0428 (Forward) - 5'- GCCAGTGCCAAGCTTATCACC -3' (SEQ ID NO:28), which was used to amplify the pyrG marker cassette for plasmid pRNniklM786T.

[00215] RN0172 (Reverse) - 5'- CCATGATTACGAATTCGAGCT -3' (SEQ ID NO:29), which was used to amplify the pyrG marker cassette for plasmid pRNniklM786T.

[00216] RN0509 (Forward) - 5 ' -

GATAAGGGACGGTGATAAGCTTGGCACTGGCGGATTTGCTGCCAGCTTTAC -3 ' (SEQ ID NO:30), which was used to amplify the DNA sequence upstream of nikl and the 5' end of nikl (3' Fragment 1) for plasmid pRNniklM786T, and contains a pyrG cassette tail overhang. [00217] RN489 (Reverse) - 5'- CTTCAACTCTGCGATCTCTCC -3' (SEQ ID NO:31), which was used to amplify the DNA sequence upstream of nikl and the 5 ' end of nikl (3 ' Fragment 1) for plasmid pRNniklM786T.

[00218] RN0495 (Forward) - 5'- CACGGTTACCAAGGCTGTGG -3' (SEQ ID NO:32), which was used to amplify nikl (3' Fragment 2) for plasmid pRNniklM786T.

[00219] RN0498 (Reverse) - 5 ' - CCAATGATACCGTTCGTGGGCGTCCGGATCTCG -3 ' (SEQ ID NO:33), which was used to amplify nikl (3' Fragment 2) for plasmid

pRNniklM786T, and incorporate the M786T mutation.

[00220] RN0161 (Forward) - 5 ' -

CCGGACGCCCACGAACGGTATCATTGGTATGACGCAGTTGAC -3 '(SEQ ID NO: 34), which was used to amplify nikl (3' Fragment 3) for plasmid pRNniklM786T, and

incorporate the M786T mutation.

[00221] RN0182 (Reverse) - 5 '-

CGGTGGCGGCCGCTCTAGAACTAGTGGATCGGGTGCATTTCACCACTACTTGAG - 3'(SEQ ID NO:35), which was used to amplify nikl (3' Fragment 3) for plasmid

pRNniklM786T, and contains a vector backbone overhang.

[00222] PCR amplifications were performed using the PfuUltrall Fusion HS DNA polymerase (Agilent Technologies, Santa Clara, CA, USA) and a Tetrad 2 thermal cycler (Bio-Rad, Hercules, CA, USA). PCR products were separated on E-gels (Life Technologies, Grand Island, NY, USA), and fragments of the correct length were purified using the QIAquick Gel Extraction kit or QIAquick PCR Purification kit (Qiagen Inc., Valencia, CA, USA). The vector backbone was linearized by digestion with BamHI (Thermo Scientific, Grand Island, NY, USA), followed by de-phosphorylation by Alkaline Phosphatase (Roche, Indianapolis, IN, USA), and purification using the QIAquick PCR Purification kit.

[00223] Each of the five DNA fragments contain sequences on both ends that overlap sequence of adjacent DNA fragments to provide a sufficient length of homologous sequence for recombination, and all were recombined into the final construct in the Saccharomyces cerevisiae strain YPH499 (ATCC 76625) using the yeast's native recombination machinery. The Frozen EZ Yeast Transformation II™ kit (Zymo Research, Orange, CA, USA) was used for yeast transformations. Transformants were plated on SD-U plates to select for complementation of uridine auxotrophy. Individual colonies from the transformation plates were selected to extract plasmid DNA using the Zymoprep™Yeast Plasmid Miniprep II kit (Zymo Research, Orange, CA, USA). From each miniprep 1 μL· was directly transformed into One Shot® TOP10 chemically competent E. coli cells (Life Technologies, Grand Island, NY, USA), and plated on LB plates with carbenicillin. Individual colonies from the transformation plates were selected to extract plasmid DNA using the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA). DNA obtained this way was sequenced at Sequetech Corporation (Mountain View, CA, USA), and a plasmid with the correct sequence was linearized by restriction digest with SnaBI (Thermo Scientific, Grand Island, NY, USA), followed by de- phosphorylation by Alkaline Phosphatase (Roche, Indianapolis, IN, USA). The resulting gene replacement cassette was purified using the QIAquick PCR Purification kit (Qiagen Inc., Valencia, CA, USA) or ethanol precipitation.

7.2. GICC2071 host strain transformation with nikl allele-containing gene replacement cassette, candidate selection, verification and characterization

[00224] The purified concentrated gene replacement cassette was transformed into the Aspergillus niger host strain GICC2071 ( a non-recombinant strain derived from a glucoamylase over-producing mutant, UVK143f, itself derived from Aspergillus niger var. awamori NRRL3112, and having an inactive pyrG gene) using PEG-mediated transformation (Campbell et al., "Improved transformation efficiency of Aspergillus niger using the homologous niaD gene for nitrate reductase", Current Genetics, 16:53-56, 1989). Transformants were plated on minimal medium without uridine using overlays, and incubated at 32°C. Genomic DNA from transformants was extracted using CelLytic™ Y Cell Lysis Reagent (Sigma-Aldrich Co., St. Louis, MO, USA). This genomic DNA was then used as template for diagnostic PCRs to confirm homologous recombination of the gene replacement at the native nikl locus. The primer pairs used for diagnostic PCR are specified below.

[00225] RN0591 (5 ' -GACGTGAATACGATGGCCGA -3') (SEQ ID NO: 36); and

[00226] RN0592 (5'-AACGTTTGGGCTTGCGAGG -3') (SEQ ID NO: 37).

[00227] RN0577 (5'- AGGTCGACTATCCGGTTAGAC -3') (SEQ ID NO: 38); and

[00228] RN0583 (5'- GCGACTCCCAAGCAGAAGC -3') (SEQ ID NO: 39).

[00229] Integration of the niklM786T mutation was confirmed by sequencing (Sequetech, Mountain View, CA, USA).

[00230] Three strains with verified homologous integration of the niklM786T-cont&imng gene replacement cassette labeled GICC2071 NiklM786T mutants #99, 117 and 121 were selected. The selected strains were used for determining the effect of the gene replacement on protein production.

7.3 Fermentation of A. niger GICC2071 NiklM786T to evaluate total protein production

[00231] Aspergillus niger control strain GICC2071 and GICC2071 NikM786T mutants #99, 117, and 121 were grown under identical conditions in 50-ml submerged (liquid) culture, and their total protein production was compared in shake flasks.

[00232] To create a seed culture, the spores of each strain were added separately to 50 mL of YEG (5g/L yeast extract, 22g/l glucose, ¾0) in a 250 mL flask. The cultures were grown for 24 hours at 37°C and 200 rpm in a shaking incubator. After 24 hours, 5ml of seed culture were added to 45 ml of Promosoy Special media (Ward, M. et al. (2004) Appl. Environ. Microbiol. 70:2567-2576) in 250-ml 4-baffled shake flasks, in triplicate, for protein production. Flasks were incubated at 37°C with shaking at 200 rpm for 4 days. Secreted protein was harvested by spinning down cultures at 4000 rpm for 25 minutes in an Eppendorf 5804 R (Fisher Scientific, Pittsburgh, PA, USA) and collecting the supernatant.

[00233] Total protein production was evaluated by SDS-PAGE (Life Technologies, Grand Island, NY, USA), and by precipitating the proteins with trichloroacetic acid (TCA) followed by a BCA protein assay (ThermoFisher Scientific, Grand Island, NY, USA). The activity of proteins that use p-nitrophenyl-a-D-glucopyranoside (Sigma-Aldrich Co., St. Louis, MO, USA) as substrate, such as glucoamylase, was evaluated as well.

[00234] A supernatant volume of 4 μΐ from each of the control strain GICC2071 containing the wild type nikl allele, as well as GICC2071 NiklM786T mutants #99, 117, and 121, was run on 4-12% NuPAGE gels (Life Technologies, Life Technologies, Grand Island, NY, USA) based on the manufacturer-provided protocol. SDS-PAGE revealed that GICC NiklM786T mutant strain #99 produced protein at levels lower than GICC2071 control, whereas GICC NiklM786T mutants #117 and 121 showed an improvement in total protein over the GICC2071 control containing the native nikl allele (Figure 15).

[00235] For the BCA protein assay, supernatant from control strain GICC2071, GICC2071 NiklM786T mutants #99, 117, and 121, were precipitated in trichloroacetic acid and re- suspended in 0.1 N sodium hydroxide prior to BCA protein assay. The BCA protein assay was performed according to manufacturer protocol. GICC NiklM786T mutants #99 and #121 showed reduced total protein compared to GICC control containing the native nikl allele, and mutant #117 had equivalent total protein compared to the GICC2071 control.

[00236] Activity of supernantant enzymes on p-nitrophenyl-a-D-glucopyranoside - PNPG substrate (Sigma- Aldrich Co., St. Louis, MO, USA) was evaluated. Supernatant from control strain GICC2071, and GICC2071 NiklM786T mutants #99, 117, and 121 was aliquoted into wells of a 96-well plate (Corning, Corning, NY, USA), followed by incubation with PNPG for 8 minutes and 45 seconds. The enzymatic reaction was stopped by addition of 0.1 M borate solution, pH 9.2, and absorbance was read at 400 nm. GICC NiklM786T mutant #99 showed decreased supernatant enzyme activity on PNPG substrate compared to GICC2071 containing the wild type nikl allele, whereas GICC NiklM786T mutants #117 and 121 showed higher supernatant enzyme activity on PNPG substrate compared to the GICC2071 control (Figure 16).

[00237] GICC2071 NiklM786T mutant #117 showed protein production higher than the GICC2071 control, as seen on SDS gels (Figure 15), as well as higher PNPG activity (Figure 16), suggesting that introducing the mutated niklM786T histidine kinase gene allele into Aspergillus niger can cause an increase in protein production.


What is claimed is:

1. An engineered fungal strain, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the engineered fungal strain comprises a variant histidine kinase gene.

2. An engineered fungal strain, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the engineered fungal strain comprises a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain.

3. An engineered fungal strain, capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the engineered fungal strain comprises a mutation that causes altered sensitivity or resistance to a fungicide as compared to the parental strain.

4. The engineered fungal strain of any one of claims 1-3, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a hybrid-type histidine kinase.

5. The engineered fungal strain of any one of claims 1-3, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a group III histidine kinase.

6. The engineered fungal strain of any one of claims 1-5, wherein the variant histidine kinase gene encodes a polypeptide comprising an amino acid sequence comprising a mutation at position 743 of SEQ ID NO:l, and has at least 60% identity to SEQ ID NO: 1.

7. The engineered fungal strain of any one of claims 1-5, wherein the variant histidine kinase gene encodes a polypeptide comprising an amino acid sequence comprising a mutation at position 786 of SEQ ID NO:43, and has at least 60% identity to SEQ ID NO: 43.

8. The engineered fungal strain of claim 6, wherein the mutation at position 743 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M743T.

9. The engineered fungal strain of claim 7, wherein the mutation at position 786 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M786T.

10. The engineered fungal strain of any one of claims 1-9, wherein the parental strain is an Ascomycete fungal strain.

11. The engineered fungal strain of any one of claims 1-9, wherein the parental strain is a filamentous fungal strain.

12. The engineered fungal strain of any one of claims 1-11, which is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, or at least about 100% more of a protein of interest, as compared to its parental strain.

13. A transformed fungal strain or a derivative fungal strain thereof capable of producing an altered level of a protein of interest as compared to a parental strain, wherein the transformed fungal strain or the derivative fungal strain comprises a variant histidine kinase gene or a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain.

14. The fungal strain of claim 13, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a hybrid-type histidine kinase.

15. The fungal strain of claim 13 or 14, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a group III histidine kinase.

16. The fungal strain of any one of claims 13-15, wherein the variant histidine kinase gene encodes a polypeptide comprising a mutation at position 743 of SEQ ID NO:l, and has an amino acid sequence that is at least 60% identical to SEQ ID NO: 1.

17. The fungal strain of claim 16, wherein the mutation at position 743 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M743T.

18. The fungal strain of any one of claims 13-15, wherein the variant histidine kinase gene encodes a polypeptide comprising a mutation at position 786 of SEQ ID NO: 43, and has an amino acid sequence that is at least 60% identical to SEQ ID NO: 43.

19. The fungal strain of claim 18, wherein the mutation at position 786 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M786T.

20. The fungal strain of any one of claims 13-19, wherein the parental strain is an Ascomycete fungal strain.

21. The fungal strain of any one of claims 13-19, wherein the parental strain is a filamentous fungal strain.

22. The fungal strain of any one of claims 13-21, which is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, or at least about 100% more of a protein of interest, as compared to its parental strain.

23. A method for improving protein production, comprising employing an engineered, transformed or derivative fungal strain, which comprises a variant histidine kinase gene, or a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain.

24. The method of claim 23, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a hybrid-type histidine kinase.

25. The method of claim 23 or 24, wherein the variant histidine kinase gene is a variant of a wild type histidine kinase gene encoding a group III histidine kinase.

26. The method of any one of claims 23-25, wherein the variant histidine kinase gene encodes a polypeptide comprising a mutation at position 743 of SEQ ID NO: 1, and an amino acid sequence that is at least 60% identical to SEQ ID NO: 1.

27. The method of claim 26, wherein the mutation at position 743 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M743T.

28. The method of any one of claims 23-25, wherein the variant histidine kinase gene encodes a polypeptide comprising a mutation at position 786 of SEQ ID NO: 43, and an amino acid sequence that is at least 60% identical to SEQ ID NO: 43.

29. The method of claim 28, wherein the mutation at position 786 is a mutation replacing the methionine residue at that position with a threonine residue, namely, M786T.

30. The method of any one of claims 23-29, wherein the parental strain is an Ascomycete fungal strain.

31. The method of any one of claims 23-29, wherein the parental strain is a filamentous fungal strain.

32. The method of any one of claims 23-29, wherein the engineered, transformed, or derivative fungal strain is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, or at least about 100% more of a protein of interest, as compared to its parental strain.

33. A method of producing a protein of interest comprising fermenting the engineered fungal strain of any one of claims 1-12 or the transformed fungal strain or the derivative fungal strain of any one of claims 13-22, wherein the engineered, transformed or derivative fungal strain secretes the protein of interest, wherein the engineered, transformed or a derivative fungal strain comprises a variant histidine kinase gene, or a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain.

34. The method of claim 33, wherein the protein of interest is a hemicellulase, peroxidase, protease, cellulase, xylanase, lipase, phospholipase, esterase, cutinase, pectinase, keratinase, reductase, oxidase, phenol oxidase, lipoxygenase, ligninase, pullulanase, tannase, pentosanase, malanase, beta-glucanase, arabinosidases, hyaluronidase, chondroitinase, laccase, amylase, glucoamylase, a functional fragment thereof, or a mixture of one or more of the enzymes and fragments thereof.

35. The method of claim 33 or 34 wherein the protein of interest is an acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, oc- galactosidase, β-galactosidase, oc-glucanase, glucan lysase, endo- -glucanase, glucoamylase, glucose oxidase, a- glucosidase, β-glucosidase, glucuronidase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, lipase, lyase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetyl esterase, pectin depolymerase, pectin methyl esterase, pectinolytic enzyme, peroxidase, phenoloxidase, phytase, polygalacturonase, protease, rhamno-galacturonase, ribonuclease, thaumatin, transferase, transport protein, transglutaminase, xylanase, hexose oxidase, a functional fragment thereof, or a mixture of one or more thereof.

36. The method of any one of claims 33-35, wherein the protein of interest is a peptide hormone, growth factor, clotting factor, chemokine, cytokine, lymphokine, antibody, receptor, adhesion molecule, microbial antigen, a functional fragment thereof, or a mixture of one or more thereof.

37. A protein of interest produced by applying the method of any one of claims 33 to 36.

38. A composition comprising the protein of interest of claim 37.

39. A method of using the composition of claim 38 in biomass hydrolysis, cleaning applications, grain processing, animal nutrition, food composition or textile treatments.

40. A method for identifying or selecting for an engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain, comprising the steps of:

(a) inoculating the strain onto the surface of agar plates with osmotic agents; and

(b) selecting the strains that grow faster or slower than the parental strain.

41. The method of claim 40, wherein the engineered fungal strain capable of producing an altered level of a protein of interest as compared to a parental strain, comprises a mutation that causes altered sensitivity or resistance to external osmotic pressure as compared to the parental strain.

42. The method of claim 40 or 41 wherein the parental strain is an Ascomycete fungal strain.

43. The method of claim 42, wherein the parental strain is a filamentous fungal strain.

44. The method of any one of claims 40-43, wherein the engineered fungal strain is capable of producing at least about 5%, at least about 10%, at least about 20%, at least about 50%, or at least about 100% more of a protein of interest, as compared to its parental strain.

45. The method of any one of claims 40-44, wherein the osmotic agents include one or more of sugars, sugar alcohols or salts.

46. The method of claim 45, wherein the sugar may be glucose, sucrose, fructose, oligofructose, fructo-oligosaccharide, or inverted sugar.

47. The method of claim 45, wherein the sugar alcohol may be sorbitol, xylitol or galactosylosorbitol.

48. The method of claim 45, wherein the salt is sodium chloride or potassium chloride.

49. A method of screening or selecting mutants with increased specific productivity using fungicide resistance in submerged culture and/or on solid agar medium.

50. A method of screening or selecting for mutants with modifications in histidine kinases or other genes involved in regulation of osmotic homeostasis using fungicide resistance in submerged culture and/or on solid agar medium.

51. A method of screening or selecting for mutants with modifications the nikl gene using fungicide resistance in submerged culture and/or on solid agar medium.

52. A method of screening or selecting mutants with increased specific productivity simultaneously or successively combining osmotic sensitivity and fungicide resistance in submerged culture and/or on solid agar medium.

53. A method of screening or selecting for mutants with modifications in histidine kinases or other genes involved in regulation of osmotic homeostasis simultaneously or successively combining osmotic sensitivity and fungicide resistance in submerged culture and/or on solid agar medium.

54. A method of screening or selecting for mutants with modifications the nikl gene simultaneously or successively combining osmotic sensitivity and fungicide resistance in submerged culture and/or on solid agar medium.

55. The methods in claims 49-54 where the fungicide is dicarboximide or phenylpyrrole such as iprodione or fludioxonil.

Download Citation

Sign in to the Lens
