Temperature Sensing In Plants

TEMPERATURE SENSING IN PLANTS

FIELD OF THE INVENTION

Temperature is an important factor in crop productivity. Identifying factors and compounds that modulate perception of temperature in plants can alter crop productivity.

BACKGROUND OF THE INVENTION

Temperature stress is one of the major factors limiting crop productivity. It has been shown that every 1°C increase in mean global temperatures causes crop yields to decrease by 2.5-16%. While many of the factors that affect crop performance, such as nutrients, water and pathogens can to some extent be controlled by agronomy, there is a need to identify compounds that directly modulate the temperature perception status/temperature response of a crop plant.

Sessile organisms, such as plants, continually sense environmental conditions to adapt their growth and development. Temperature varies both diurnally, which is important for entraining the clock (Michael et al . , 2008; Salome and McClung, 2005), as well as seasonally, providing information for the timing of reproduction (Heggie and Halliday, 2005; Samach and Wigge, 2005; Sung and Amasino, 2005). Extremes of temperature represent a significant stress for plants, and are a major factor limiting global plant distribution (Mittler, 2006) . The sensitivity of plants to small changes in temperature is highlighted by significant changes in flowering time (Fitter and Fitter, 2002) and distributions of wild-plants that have occurred in the last 100 years due to climate change (Kelly and Goulden, 2008; Lenoir et al., 2008; Willis et al., 2008). Projected increases in mean global temperature, as well as extremes of temperature in the next 100 years, are significantly larger than what has occurred so far, suggesting significant future disruption to wild plants and crops.

Plants must constantly respond to changes in the environment whilst maintaining developmental and growth processes if they are to survive into the next generation. A complex network of signals from temperature and light must correctly converge to achieve successful development, through vegetative to reproductive growth. Temperature can be thought of as an environmental factor that provides both 'inductive' and 'maintenance' signals in development. It can stimulate developmental processes such as seed dormancy release, germination, vernalization and flowering. Thus, being able to control how a plant perceives temperature is desirable. The responses of organisms to temperature, particularly in crop plants, are often detrimental, and the targeted alteration of these responses may improve the yield, quality and predictability of crops. For example grain-fill in wheat and rice is particularly sensitive to high temperatures. Preventing a heat shock response in the developing grain would protect grain composition and quantity from being perturbed by a high temperature stress response. High temperature stress responses have been selected for in evolution and breeding in order to maximise embryo survival, but these responses are detrimental to grain quality. This is already a major cause of reduced wheat and rice yields during hot summers, and these problems will be exacerbated by future climate change.

Additiona1 ly many crops flower or bolt prematurely when exposed to high or low temperatures (for example sugar beet, lettuce, onions, cabbage and broccoli) , which is a major cause of crop loss. Specifically controlling the flowering responses to temperature in such crops is desirable. Furthermore, reducing temperature sensitivity may enable a more uniform development within a crop, which is important, since it enables farmers to schedule harvests reliably and optimises crop yield and quality. Additionally, many harmful eukaryotic micro-organisms use temperature perception as a signal to induce pathogeresis, for example Histoplasma capsulatum and Candida albicans (Nguyen and Sil, 2008) . The ability to selectively perturb temperature perception in these organisms would provide means to prevent pathogenesis.

Temperature sensing in eukaryotes is a complex process that is not yet fully understood. In plants, factors that are involved in temperature sensing include calcium signalling and low temperature is known to change membrane fluidity.

In summary, being able to control temperature regulated responses in plants is of major importance in protecting yield, in particular in view of climate change. Genes encoding heat shock proteins are known to respond to temperatures that induce a heat shock response in plants. Larkindale et al describe transcriptome studies in plants subjected to heat shock-inducing temperatures. Sung (2001) describes expression studies of HSP70 genes. However, to be able to assay temperature response, genes that respond to changes in ambient growth temperature at non-stress inducing temperatures are of great value. Importantly, such assays should be able to measure absolute temperature perception status of the organism at a given temperature in a way that is not dependent on a temperature change.

Variation in temperature is a major factor influencing plant growth and has a large impact on the yields of crop plants. While the responses of plants to temperature stresses (high and low temperatures that threaten plant survival) is relatively well studied, much less is known of how plants measure and respond to smaller fluctuations in temperature during the day-night cycle and seasonally. While these are often not stress-response inducing, they nonetheless have very large effects on crop physiology and yield. It is therefore important to identify new plant varieties or substances that enable beneficial modulation of the temperature response pathway .

We have identified methods and assays which are aimed at meeting this need.

SUMMARY OF THE INVENTION

To identify new genetically modified plants or substances that enable beneficial modulation of the temperature response pathway and temperature perception, it is highly advantageous to have a sensitive, non-destructive, reproducible and robust assay of the temperature status of a plant which applies to a full range of non-stress inducing temperatures pnysiological temperatures. We describe such an assay and describe how it might be exploited in a number of ways to discover genes and substances that enable the targeted manipulation of a plant' ^ temperature responsiveness. These aspects of the invention are based on the observation that certain promoters respond to increasing temperature by upregulating or downregulating gene expression. This can be measured, thus establishing assays and methods for assessing the absolute temperature status of a plant .

In a first aspect, the invention relates to a method for identifying a compound that regulates temperature perception in a plant comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of the reporter nucleic acid sequence which increases with increasing temperature over a temperature range of 12°C to 27°C exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

In a second aspect, the invention relates to a compound identified by any of the methods described herein.

In another aspect, the invention relates to a compound that modifies temperature perception of a plant.

In another aspect, the invention relates to a method for identifying a mutant plant defective in the temperature signalling pathway comprising

monitoring expression of a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant c >: plant cell, wh■■■· cein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C at at least two different temperatures.

In another aspect, the invention relates to a method for regulating temperature-dependent expression of a target gene in a plant or plant cell comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a target nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said target nucleic acid sequence which changes with increasing temperature at at least two different temperatures .

In another aspect, the invention relates to a an in vitro assay for identifying a target compound that regulates temperature perception in a plant comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant cell to a test compound and

monitoring expression of said reporter gene at at least two different temperatures.

In another aspect, the invention relates to the use of a temperature responsive plant promoter sequence as an indicator of temperature perception in plant, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12°C to 27°C.

In another aspect, the invention relates to the use of a temperature responsive plant promoter sequence, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12°C to 27°C in a method for identifying a target compound that regulates temperature perception in a plant .

In another aspect, the invention relates to an assay for identifying a target compound that regulates temperature perception in a plant expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C. exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

In another aspect, the invention relates to a transgenic plant expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C.

In another aspect, the invention relates to a method for identifying a compound that regulates temperature perception in a plant comprising

Measuring expression of an endogenous gene regulated by a promoter that regulates temperature-dependent expression of the reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

The promoter used in the methods and assays can induce increased or decreased expression in response to increasing temperatures. Expression can be compared to expression in a control plant or plant cell. The promoter may comprise a HSE 5tif wherein said motif consists of either G ANNTTC or TTCNNGAA or both, where N is any base.

It may a HSP70 promoter, for example comprising or consisting of SEQ ID NO. 1. It may be selected from SEQ ID NO. 2 to expression is monitored at at least two different temperatures a temperature range of about 1°C to 30°C, preferably 12°C to about 27°C.

The various embodiments of these aspects are described in detail below. These embodiments can be combined with any aspect of the invention unless clearly indicated to the contrary. Other objects and advantages of this invention will be appreciated from a review of the complete disclosure provided herein and the appended claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. HSP70 expression is an output of the ambient temperature sensing pathway.

(A) Transcript profiling experiments show a robust transcriptional response to chances in ambient te erature.

(B) HSP70 (black line, marked with an arrow) is induced strongly with increasing ambient temperature. In contrast, the other members of the HSP70 family genes (gray) require a hejt stress to be up-regulated.

(C) HSP70 (black line, marked with an arrow) has a uniform linear expression pattern at various constant growth temperatures, in contrast to the rest of the HSP70 family (gray) . HSP70 is therefore an excellent output of the thermosensory pathway over a wide temperature range.

(D) HSP70::LUC in Arabidopsis mimics the endogenous HSP70 expression pattern in response to temperature. LUC transcript analysis and live luciferase imaging of plants shifted to 17°C, 22°C and 27°C for two hours from 12°C show a temperature dependent LUC expression and luciferase activity. LUC transcript levels were normalised to UBQ10.

(E) Identification of entrl through a forward genetic screen as a mutant with enhanced temperature response at the seedling stage (upper panel) , this phenotype is present throughout the life cycle. Lower panel shows the HSP70::LUC expression in adult wild-type and entrl plants.

(F) Transcript profiling analysis showing ARP6 gene expression in T and entrl. ARP6 transcripts were absent in entrl. The bar represents normalised expression levels from the microarray experiment.

(G) Complementation of entrl: a binary construct containing the ARP6 genomic fragment including the native promoter and coding regions {PARP6: :ARP6) completely rescued the HSP70::LUC as well as the developmental phenotypes of entrl.

Figure 2. arp6~10 displays developmental and architectural phenotypes of warm grown plants .

(A-D) arp6-10 flowers significantly earlier than wild-type (gray, marked with arrow) under long-day (A, B) and short day conditions (C, D) at 22 °C. When grown in short days at 27 °C (E, F) , arp6-10 shows a very strong thermal induction of flowering. In comparison, wild-type flowering time is similar to arp6-10 at 22 °C. (x-axis shows the number of rosette leaves at the time of flowering, y-axis shows the corresponding number of plants) . (G, H) In addition to the flowering time phenotypes, arp6-10 displays all the architectural responses of wild-type plants grown at high temperature. arp6-10 seedlings at 17 °C, show hypocotyl (G) and petiole elongation (H) that is equivalent to the wild-type phenotype at higher temperatures. (Petiole elongation was analysed on the first four true leaves of 20-day-old wild-type and arp6-10 seedlings) .

Figure 3. The temperature transcriptome is globally mis- regulated in arp6~10. Genes that are 2 fold up- (A) or down-regulated (B) In wild- type seedling within 2 hours of shifting to 27 °C are constitutively repressed or activated in the arp6-10 background. Similarly genes that are 2 fold up- (C) or down- regulated (D) in arp6-10 compared to the wild type at 12 °C (0 h) were down- or up-regulated in the wild-type upon shift to 27 °C. Median and mean values are represented respectively by the solid and dotted horizontal lines. 5th and 95th percentiles represent outlier values (dots) .

(E) Comparison of arp6-10 induced genome-wide transcriptional changes with responses to increasing temperature from 12 °C to 27 °C in wild-type. Whole genome scatter plot analysis of expression log ratios, x-axis: comparison of wild-type after 24h at 27 °C with seedlings kept at 12 °C. y-axis: comparison of arp6-10 grown at 12 °C with wild-type at 12 °C. The arp6-10 mutation accounts for nearly half (R2 = 0.466) of the changes in the transcriptome in response to an increase in ambient temperature .

Figure 4. Induction of wheat HSP70 in response to temperature.

The y axis shows relative HSP expression levels and the x axis temperatures. Expression of what HPP70 at 12, 22 and 27°C is thus shown. Paragon seedlings (2 per rep) were grown for lOd at 16°C in a LD cabinet (Snijders cabinet, 16 K_:s light, dawn at Noon) . They were then chilled to 12°C for 2 hrs in a matching cabinet, and the OH samples taken. The remaining plants were divided between 2 more matching cabinets, one at 22°C and one at 27°C. Samples were taken from each 2 and 24 hours after transfer.

Figure 5. Temperature response of Arabxdopsis promoters

Temperature is shown on the x axis and normalised expression of the y axis. Expression in response to temperature is shown for a) At3gl2580, b) At3g24500, c) At5g48570, d) At5g52640, e) At4gl2400, f) At4gl2480, g) At4g34950 and h) At4gl2470.

DETAILED DISCLOSURE OF THE INVENTION

The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous .

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiorogy, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, which are within the skill of the art. Such techniques are explained fully in the literature.

As used herein, the words "nucleic acid", "nucleic acid sequence", "nucleotide", or "polynucleotide" are intended to include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA) , natural occurring, mutated, synthetic DNA or RNA molecules, and analogs of the DNA or RNA generated using nucleotide analogs. It can be single-stranded or double- stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, anti-sense sequences, and non-coding regulatory sequences that do not encode IUK AS or protein products. These terms also encompass a gene. The term "gene" or "gene" is used broadly to refer to a DNA nucleic acid associated with a biological function. Thus, genes may include introns and exons as in genomic sequence, or may comprise only a coding sequence as in cDNAs, and/or may include cDNAs in combination regulatory sequences .

As used herein, the terms "change" or "changes" with respect to a change in expression can relate t an increase n expression or a decrease in expression.

Plants are highly sensitive to temperature and can perceive a difference of as little as 1°C. How growth temperature is sensed and integrated in development is largely unknown.

We have found that certain plant genes are expressed in seedlings and throughout adult plants at a level proportionate to ambient growth temperature. For example, genes such as Arabidopsis HSP70 (At3gl2580) are up-regulated at higher growth temperatures. HSP70 gene transcription follows a proportionate pattern with increasing temperature over a wide range (about 12 °C to >37 °C) and can therefore be used as a marker gene which indicates up or down-regulation of the temperature transcriptome . HSP70 expression does not require a temperature change to be induced. The expression of HSP70 therefore provides a direct read-out of the temperature perception status of the plant. In addition to HSP70, we have shown that there are four other genes that display a very similar pattern of expression in Arabidopsis at 12-27°C (At3g24500, At5g52640, At4gl2400, At5g48570) and can substitute for HSP70. Thus, the promoters of these genes can also be used according to the methods of the invention described herein. In other aspects of the methods described herein, expression of these genes is measured. Similarly, other genes have an expression that decreases with increasing temperature, allowing the assay of responses to lower temperatures (for example At4gl2480, At4g34950 and At4gl2470) . Expression of these genes reflects the absolute temperature status at lower temperatures. Thus, the promoters of these genes can also be used according to the methods of the invention described herein. In other aspects of the methods described herein, expression of the genes is measured. The term "growth temperature" as used herein defines a temperature that does not induce a stress response. A skilled person would know that this temperature varies amongst different plant species, but it is typically in the range of about 12°C to about 27°C.

Expression of these plant genes is regulated by temperature- responsive promoters. Some of these respond to an increase in temperature with increasing expression gene, other with decreasing expression, leading to a switch off of expression at high stress temperatures. This temperature-dependent expression is observed across the whole plant, in different plant tissues and plant organs. The temperature-dependent response is induced by non-stress inducing temperatures and is observed at increasing growth temperatures over a range of about 1°C to 30°C, for example about 12°C to about 27°C. Thus, temperature-responsive plant promoters can be used as indicators for temperature perception of a plant. We have developed methods and assays that employ a temperature- responsive plant promoter to identify compounds and genes that are involved in temperature perception. The methods described herein can be carried out in vivo and in vitro.

It is envisaged that the compounds identified by methods described herein can be used as small molecule tools to manipulate the temperature perception and thus thermosensory response in plants. Thermosensory responses are those responses that are observed in an organism in response to changes in temperature or growth at different constant temperatures. These include changes in gene transcription. Transcriptional changes also influence developmental processes and in plants an increase of temperature affects a number of developmental processes, such as flowering, hypocotyl elongation and petiole growth. It also leads to an increase in the rate of transition through different developmental phases. Juvenile to adult transition is therefore accelerated by higher ambient temperature. An increase in temperature typically leads to acceleration of flowering time, greater hypocotyl elongation, petiole growth, germination, and general acceleration of plant growth and development. Compounds identified by the methods described herein can be used to stimulate or suppress a temperature response in a plant. Said thermosensory responses in a plant may include one or more of and preferably all of the following developmental responses: seed dormancy release, germination, hypocotyl elongation, petiole growth, vernalisation, juv.iile to adult tj ansition, flowering, biomass accumulation, senescence and temperature- protective responses.

For example, compounds identified can be used to stimulate a temperature response that corresponds to a response induced by warm ambient temperatures, leading to a stimulation of a variety of biological processes as set out above, including growth and flowering, regardless of ambient temperature. Accordingly, such compounds can be used to increase yield.

Thus, in one aspect, the invention relates to a method for identifying a compound that regulates temperature perception in a plant comprising: expressing a nucleic acid construct comprising a plant promoter nucleic sequence operably linkea to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of the reporter nucleic acid sequence which changes with increasing temperature over a temperature range of about 12° C to about 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures .

In one embodiment, expression driven by said promoter increases with increasing temperature. In another embodiment, expression driven by said promoter decreases with increasing temperature .

According to the different methods of the invention, the promoter is temperature-responsive and thus induces temperature-dependent gene expression of the gene it is operbaly linked to, for example a reporter gene (i.e. the reporter nucleic acid sequence) or the endogenous gene. There is a direct correlation between a rise in growth temperature and expression driven by the temperature-responsive promoter such that said expression changes (increases or decreases, depending on the promoter used) directly with increasing ambient temperature (see figures) . As shown herein, the expression is proportional to ambient temperature. In other words, expression changes, for example increases or decreases, as a function of increasing temperature. Expression directed by said promoter at various constant growth temperatures has a uniform linear relationship that changes (increases or decreases, depending on the promoter used) with increasing temperature. Thus, there is a proportionate relationship between expression regulated by the promoter and temperature rise. This can be positive or negative. The promoter is preferably induced by non-stress inducing temperatures in the range of 12°C to 27°C and responds to fluctuations of temperatures as small as 1°C within that range with a proportional increase in expression. According to the different methods, uses and assays of the invention, expression changes over a temperature range from about 0°C to 30°C, preferably about 12°C to about 27°C, more preferably from about 12°C to about 20°C.

According to the different methods uses and assays of the invention, expression is measured at two or more different temperatures, preferably growth temperatures within a range of about 10°C to 30°C, preferably from about 12°C to about 27°C, more preferably from about 15°C to about 25°C. preferably, expression is measured at at least 3, 4 or 5 different temperatures. For example, expression may be measured at four temperatures, for example about 5°C, 12°C, about 17°C, about 22°C and about 27°C.

Expression is compared to expression in a control plant or control plant cell. The term "control" as used herein refers to a plant cell, an explant, seed, plant component, plant tissue, plant organ, or whole plant used to compare against the test plant or plant cell for the purpose of identifying a difference in the expression pattern. The control plant or plant cell also expresses the promoter :: reporter gene construct expressed by the test plant or plant cell, but it has not been exposed to a test compound. In the control plant if, expression is measured at about 12°C, about 17°C, about 22°C and about 27°C, a change, for example an increase or decrease, in expression can be observed at each increasing temperature .

According to the different aspects of the invention, the gene construct comprises a temperature-dependent promoter as described herein operably linked to a reporter gene. Alternatively, the endogenous gene may be measured for its activity directly, for example using Quantitative Polymerase Chain Reaction (Q-PCR) on a cDNA template created for plants under a particular temperature condition. This allows, for example, one to screen germplasm for particular temperature responsive properties. Thus, in another aspect, the invention relates to a method for identifying a compound that regulates temperature perception in a plant comprising

measuring expression of an endogenous gene regulated by a promoter that regulates temperature-dependent expression of the reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures. Expression of the gene is thus measured at different temperatures in response to exposure to a test compound and expref, ion is compared to expression without exposure to the test compound.

Primers that can be used are described in the examples and can be used in specific embodiments of the invention.

In one embodiment, expression driven by said promoter increases with increasing temperature. In another embodiment, expression driven by said promoter decreases with increasing temperature .

The genes used in the method are defined herein. In one embodiment, expression driven by said promoter increases with increasing temperature. Thus, the genes may be selected from At3gl2580, At3g24500, At5g52640, At4g124u0, At5g48570., wheat HSP70, rice HSP70 or Brachypodium HSP70. Specifically, expression of a gene as set out in SEQ ID No. 20 to 26 may be measured. In another embodiment, expression driven by said promoter decreases with increasing temperature. Thus, the genes may be selected from At4gl2480, At4g34950 or At4gl2470. Specifically, expression of a gene as set out in SEQ ID No. 27 to 29 may be measured.

The term "promoter" as used herein refers to a DNA sequence which when ligated to a reporter gene sequence and is capable of controlling the transcription of the reporter gene or test gene. As used herein "operably linked" includes reference to a functional linkage between a promoter and a second sequence, such as the reporter gene or test gene, wherein the promoter sequence initiates and mediates transcription of the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame .

The expression construct according to the methods of the invention herein may also comprise additional regulatory sequences, including enhancers. The const uct may also comprise further marker genes, such as those conferring resistance to antibiotics.

Reporter gene expression confers easily measurable phenotypes that form the basis of rapid, easy, sensitive, quantitative and reproducible assays of gene expression and regulation. In particular, by employing reporter genes, gene expression, protein localization and intracellular protein traffic can be observed in situ, without the need of destroying the plant or plant cell. Thus, the assay is highly reproducible. Moreover, the reporter genes do not have endogenous activity in plant cells and a relatively rapid degradation of the gene product.

Reporter genes that can be used according to the different aspects of the invention described herein are known to a skilled person. A non-limiting list of reporter genes includes luciferase (for example firefly or Renilla luciferase) , green fluorescent protein (GFP) , lacZ, cat (chloramphenicol acetyltransferase from bacteria) and gus (beta-glucoronidase) . In one embodiment, the reporter gene is a visual marker whose expression can be detected and assayed using imaging-based reporter ge ^ assays. For example, fluorescent proteins can be used. In a preferred embodiment, the reporter gene is luciferase or GFP. For example, the reporter gene is luciferase. There is little or no endogenous luciferase activity in plant cells, the detection assay is sensitive, and the enzyme is stable in plants. Alternatively, the endogenous gene expression activity may be measured by Q- PCR from cDNA prepared from plant material. This method allows a direct assay of HSP70 expression independently of the need to make a transgenic construct.

The compound identified by the methods of the invention regulates temperature response/perception. In other words, the compound influences temperature perception of the plant. For example, it may induct, or suppress a temperature response. The compound to be tested may be a small molecule.

In one embodiment of the invention for identifying a test compound, the method is carried out in a plant. As described in the examples, plants may be transformed with an expression cassette comprising the temperature-responsive promoter described herein operably linked to a reporter nucleic acid sequence. This expression cassette may be included in a vector. Suitable vectors are known to the person skilled in the art. The expression cassette or vector is stably introduced into the plant genome by a transformation. The term "transformation" as used herein refers to the introduction of genetic material (e.g., a transgene) into a cell, tissue or organ. Transformation of a cell, tissue or organ may be stable or transient. The term "transient transformation" refers to the introduction of one or more transgenes into a cell, tissue or organ in the absence of integration of the transgene into the host's genome. In contrast, the term "stable transformation" refers to the introduction and integration of one or more transgenes into the genome of a cell, tissue or organ, preferably resulting in chromosomal integration and stable heritability through meiosis. Transformation may be carried out using Agrobacterium- based transformation or particle bombardment. Other suitable techniques are known to the person of skill in the art. Stably transformed plants homozygous for the transgene are thus generated using standard techniques .

According to the methods of the invention, the transgenic plant expressing said reporter gene construct is then exposed to a test compound at at least two different growth non-stress inducing temperatures within a range of from about 12°C to about 27°C to establish if there is a difference in expression at the test temperatures compared to a control plant. Expression of the reporter gene is then measured and can be compared to a control plant.

In another embodiment, the method is carried out in vitro. In this embodiment, plant tissue or plant cells in cell culture are used. Accordingly, a plant cell is transformed with the expression construct comprising a temperature-responsive promoter as described herein operably linked to a reporter gene. Transient or stable transformation may be used. According to the methods of the invention, the transgenic plant cell expressing said reporter gene construct is then exposed to a test compound at at least two different temperatures. Expression of the reporter gene is measured suing a reporter gene based assay. Expression is compared to a expression in control plant cell. Different cell culture systems may be used; these are known to the skilled person. One example of a suitable cell culture system comprises tobacco BY2 cells. A callus-derived cell suspension culture from Arabidopsis thaliana or Brachypodium disachyon may also be used.

Thus, in one aspect, the invention relates to an in vitro assay for identifying a target compound that regulates temperature perception in a plant comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter gene in a plant cell, wherein said promoter regulates temperature-dependent expression which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant cell to a test compound and

monitoring expression of said reporter gene at at least two different temperatures.

In one embodiment, expression increases with increasing temperature. In another embodiment, expression decreases with increasing temperature.

In one embodiment of the methods, assays and uses of the invention, measuring expression at temperatures that cause a heat shock response is specifically disclaimed from the methods of the invention. Stress-inducing temperatures are generally temperatures higher than 27°C. Temperature-responsive plant promoters that respond to high temperatures and induce stress response, but do not respond to increases in growth temperatures in the range of 12°C to 27°C with a proportional increase in expression, are specifically disclaimed.

The promoter according to the different methods, assays and uses described herein, is a plant promoter. In one embodiment, the promoter is a promoter that responds to an increase in temperature with an increase in expression. Preferably, the promoter is a heat shock promoter. In one embodiment, the promoter is a HSP70 promoter. Preferably, the HSP70 promoter is derived from Arabidopsis thaliana, preferably At3gl2580. A preferred sequence is shown in SEQ ID No. 1. Thus, the promoter sequence may comprise or consist of SEQ ID No. 1. Also with.vn the scope of the invention are nucleic acid sequences that are substantially as SEQ ID No. 1. As used herein, the term "substantially" means that the nucleic acid sequences are at least 80% identical to the wild type sequence. Preferably, the nucleic acid sequences are complementary at least at 85%, 90%, 95%, 96%, 97%, 98%, 99% identical. Sequences complementary to SEQ ID No. 1 or substantially complementary are also within the scope of the invention. Examples of sequences particularly relevant for monocotyledonous plants are those which are closely related to Hf "70 relatives in Brachypodium · istachyon (Brad:5 °g23250 ) , Oryza sativa (Os05g38350) and Triticum aestivum (TA62920_4565) .

In another embodiment , the promoter sequence may comprise or consist of a functional variant of HSP70 as shown in SEQ ID No.l. A functional variant is a variant nucleic acid sequence with nucleic acid substitutions, deletions or additions that do not affect the function of the promoter sequence. In other words, the promoter sequence remains responsive to temperature in substantially the same way as the wild type promoter sequence. In another embodiment, nucleic acid modifications in the promoter sequence may improve the ability of the promoter to respond to a change in temperature.

In addition to HSP70, we have shown that there are four other genes that display a very similar pattern of expression in Arabidopsis at 12-27 °C (At3g24500, At5g52640, At4gl2400, At5g48570) and can substitute for HSP70. Thus, promoters that regulate expression of these genes can also be used according to the methods, uses and assays described herein. Using methods of sequence analysis and alignment of At3G12580, At3g24500, At5g52640, At4gl2400 and At5g48570 we have also found that the genes that show the temperature dependent expression as described herein all have very good HSE motifs (either GAANNTTC or TTCNNGAA or both, where N is any base) in their promoters. These sites have been characterised as Heat Shock Factor (HSF) binding elements in eukaryotes. Thus, in one embodiment, the promoter according to the invention comprises a HSE motif wherein said motif consists of either GAANNTTC or TTCNNGAA or both, where N is any base.

Thus, in another embodiment, the promoter sequence may comprise or consist of SEQ Id No. 2, 3, 4 or 5. In another embodiment, the promoter sequence may comprise or consist of a functional variant of SEQ Id No. 2, 3, 4 or 5 or a sequence substantially identical to one of these sequences.

In another embodiment, the HSP70 promoter is derived from an orthologue of the Arabidopsis thaliana HSP70 promoter. For example, the promoter may be a wheat or a rice HSP70 promoter. Thus, in another embodiment, the promoter sequence may comprise or consist of SEQ Id No. 6. In another embodiment, the promoter sequence may comprise or consist of a functional variant of SEQ Id No. 6 or a sequence substantially identical to SEQ Id No. 6. In another embodiment, the promoter sequence may be the Brachypodium distachyon HSP70 promoter. Thus, in another embodiment, the promoter sequence may comprise or consist of SEQ Id No. 7. In another embodiment, the promoter sequence may comprise or consist of a functional variant of SEQ Id No. 7 or a sequence substantially identical to SEQ Id No. 7.

In one embodiment, the promoter is a promoter that responds to an increase in temperature with a decrease in expression. For example, these promoters may be selected from the promoters of genes At4gl2480, At4g34950 or At4gl2470. Thus, in one embodiment, the promoter may comprise or consists of a nucleic acid a as set forth in SEQ ID No. 30 to 32.

As set out in the examples, the plant transformed is Arabidopsis and the cell culture is tobacco cells. Thus, the construct using one of the Arabidopsis promoter sequence as shown herein can be used in a plant species that is not Arabidopsis .

The plant according to the different aspects of the invention it may be a moncot or a dicot.

A dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus) , Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae) , Malvaceae, Rosaceae or Solanaceae . For example, the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, yam, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species. In one embodiment, the plant is oilseed rape.

Also included are biofuel and bioenergy crops such as rape/canola, linseed, lupin and willow, poplar, poplar hybrids, Miscanthus or gymnosperms, such as loblolly pine. Also included are crops for silage (maize) , grazing or fodder

(grasses, clover, sanfoin, alfalfa), fibres (e.g. cotton, flax), building materials (e.g. pine, oak), pulping (e.g. poplar), feeder stocks for the chemical industry (e.g. high erucic acid oil seed rape, linseed) and for amenity purposes

(e.g. turf grasses for golf courses), ornamentals for public and private gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp.) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant) .

A monocot plant may, for example, be selected from the families Arecaceaef Amaryllidaceae or Poaceae. For example, the plant may be a cereal crop, such as wheat, rice, barley, maize, oat sorghum, rye, onion, leek, millet, yam, buckwheat, turf grass, Italian rye grass, sugarcane or Festuca species.

Preferably, the plant is a crop plant. By crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use.

Preferred plants are maize, wheat, rice, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.

In another aspect, the invention relates to a compound identified by any of the methods for identifying a compound that regulates temperature perception described herein. The invention also relates to a compound that modifies temperature perception of a plant.

Such a compound includes a compound that

-alters the activity of proteins or genes necessary to insert or remove H2A.Z nucleosomes from chromatin, e.g. modulating the activity of the SWRl complex;

-alters the activity of proteins or genes necessary for the post-translational modifications of histones, including H2A.Z. For example, histone acetlyltransferase inhibitors would be expected to reduce the thermal induction of temperature induced genes. These compounds are also commonly screened for as cancer drugs .

For example, the compounds may be compounds that could alter the activity of Heat Shock Factor Transcription factor genes or proteins. HSFs are necessary for thermal induction of gene expression, as indicated by the presence of HSE elements in the promoters of our thermally responsive genes.

In another aspect, the invention relates to a genetic screen using a promoter as described herein. Thus, the invention relates to a method for identifying a mutant plant defective in the temperature signalling pathway comprising

monitoring expression of a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter gene in a plant or plant cell, wherein said promoter regulates temperature-dependent expression which changes with increasing temperature over a temperature range of 12°C to 27°C at at least two different temperatures.

In one embodiment, the promoter responds to increasing temperature with regulating increased expresisoon. In one embodiment, the promoter responds to increasing temperature with regulating decreased expression.

For example, a plant population comprising an expression construct comprising temperature-response promoter operably linked to a reporter gene can be mutagenised using standard methods in the art, for example fast neutron irradiation. Expression of the reporter gene in the resulting M2 plants is analysed and compared to control plants that express the expression construct, but have not been mutagenised. Alternatively, a plant population may be mutagenised and M2 plants can then transformed with the expression construct to analyse expression of the reporter gene compared to its expression in control plants. Alternatively, plants with different genotypes, induced through artificial means, or having originated through natural sequence divergence, may be screened for the expression of the endogenous HSP70 gene to identify germplasm or plants with particular temperature response characteristics.

In a farther aspect, the invention relates to a method for regulating temperature-dependent expression of a target nucleic acid sequence in a plant or plant cell comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a target nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression which changes with increasing temperature. In one embodiment, the promoter increases expression. In one embodiment, the promoter decreases expression.

The nucleic acid construct of may also optionally comprise a reporter nucleic acid sequence as described herein to allow monitoring of gene expression, for example by imaging methods. The different embodiments of this method are in accordance with the description above. For example, the promoter according to the method is defined above and thus includes, in one embodiment, a HSP70 promoter. Preferably, the HSP70 promoter is derived from Arabidopsis thaliana. A preferred sequence is shown in SEQ ID No. 1. Thus, the promoter sequence may comprise or consist of SEQ ID No. 1. Also within the scope of the invention are nucleic acid sequencer that are substantially as SEQ ID No. 1 as well as functional variants of HSP70 as shown in SEQ ID No.l. In another embodiment, the HSP70 promoter is derived from an orthologue of the Arabidopsis thaliana HSP70 promoter. For example, the promoter may be a wheat or rice HSP70 promoter. The temperatures used are also as defined in this disclosure. The method enables expression of a target gene based on ambient temperature. Thus, by increasing or decreasing ambient temperature, the expression of the target gene can be decreased or increased accordingly, leading to decreased or increased production of the gene product. In this way, production of a target peptide encoded by the target gene can be manipulated by exposing the transgenic plant to certain temperatures. Moreover, transgenic plants expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a target nucleic acid sequence grown in geographical regions with a warmer climate will constitutively produce the target peptide, based on the altered expression of the target gene at higher growth temperatures .

Thus, another object of this invention is to provide a method to enhance yield in a plant, preferably a crop plant, by expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a target nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said target gene which changes with increasing temperature. In one embodiment, the promoter increases expression. In one embodiment, the promoter decreases expression.

The target gene may be involved in regulating developmental processes, such as growth or flowering.

In another aspect, the invention relates to an assay for identifying a target compound that regulates temperature perception in a plant expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

In one embodiment, the promoter increases expression. In one embodiment, the promoter decreases expression.

Different embodiments of said assay are as set out herein. For example, the promoter according to the method is defined above and thus includes, in one embodiment, a HSP70 promoter. Preferably, the HSP70 promoter is derived from Arabidopsis thaliana. A preferred sequence is shown in SEQ ID No. 1. Thus, the promoter sequence may comprise or consist of SEQ ID No. 1. Also within the scope of the invention are nucleic acid sequences that are substantially as SEQ ID No. 1 as well as functional variants of HSP70 as shown in SEQ ID No .1. In another embodiment, the HSP70 promoter is derived from an orthologue of the Arabidopsis thaliana HSP70 promoter. For example, the promoter may be a wheat or rice HSP70 promoter. The temperatures and reporter nucleic acid sequences used are also as defined in this disclosure.

As explained elsewhere in this disclosure, a temperature- dependent promoter that regulates gene expression proportional to increases in ambient growth temperature can be used as an indicator of temperature perception or temperature status of a plant or part thereof, such as a cell, tissue or organ. Thus, in another aspect, the invention relates to the use of a temperature-responsive plant promoter sequence as an indicator of temperature perception in plant, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12°C to 27°C. Expression directed by said promoter can be measured to ascertain the temperature status of a plant, for example by quantitative PCR (Q-PCR) . This is illustrated in non-limiting example 5. Primers that can be used in such methods are described herein (see examples) .

In one embodiment, said promoter is operably linked to a reporter gene. Paid reporter gene may be as defined herein. As also defined herein, the promoter according to the use may be a HSP70 promoter. Preferably, the HSP70 promoter is derived from Arabidopsis thaliana. A preferred sequence is shown in SEQ ID No. 1. Thus, the promoter sequence may comprise or consist of SEQ ID No. 1. Also within the scope of the invention are nucleic acid sequences that are substantially as SEQ ID No. 1 as well as functior il variants of Hr?70 as shown in SEQ ID No .1. In another embodiment, the HSP70 promoter is derived from an orthologue of the Arabidopsis thaliana HSP70 promoter. For example, the promoter may be a wheat or rice HSP70 promoter.

In a further aspect, the invention relates to the use of a temperature responsive plant promoter nucleic acid sequence, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12°C to 27 °C in a method for identifying a target compound as described herein, for example an in vivo or in vitro method.

In another aspect, the invention relates to1 a transgenic pi ¾nt expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant cell, wherein said promoter regulates temperature-dependent expression which changes with increasing temperature over a temperature range of 12°C to 27°C. Other objects and advantages of this invention will be appreciated from a review of the complete disclosure provided herein and the appended claims .

While the present invention has been generally described above, the following non limiting examples are provided to further describe the present invention, its best mode and to assist in enabling those skilled in the art to practice this invention to its full scope. The specifics of these examples should not be treated as limiting, however.

EXAMPLES

EXPERIMENTAL PROCEDURES

Unless otherwise stated herein, materials and methods used were as described here:

Genetic screens for temperature perception

All experiments were carried out in Col-0 background. A forward genetic screen of fast neutron mutagenized population of HSP70: : LUC reporter strain was carried out to identify mutants perturbed in the ambient temperature perception pathway (seeds irradiated at HAS KFKI-Atomic Energy Research Institute, Hungary) . Seven-day-old seedlings were incubated at 12 °C for 48 h before shifting to 27 °C for three hours and screening for LUC expression by spraying with Luciferin. The entr mutations were identified as having significantly higher LUC induction than the reporter line. ENTRl was identified as ARP6 through a microarray-based transcript analysis. Genomic fragment of containing ARP6 genomic fragment {PARP6--'ARP6) was used to complement entrl mutants.

Transcript analysis

Transcript analyses were done on total RNA was extracted using Trizol (Invitrogen) Labeled targets were hybridized to Affymetrix ATH1 array according to the manufacturer's instructions. Microarray data were analyzed using GenespringGX 7.3 (Agilent) .

Chromatin Immuno-purification (ChIP)

ChIP wa^ performed as described (Gendrel et al., 2002) with minor modifications. Seven-day-old seedlings grown at 17°C were shifted to 27 °C for 2 hours and ChIP experiments were performed in parallel on chromatin from both temperatures. For H2A.Z and H3 ChIP, cross-linked chromatin was fragmented with 0.2 units of Micrococcal nuclease (Sigma) in 1 ml of MNase digestion buffer (10 mM Tris-HCl [pH 8.0], 50 mM NaCl, 1 mM β- mercaptoethanol, 0.1% NP40, 1 mM CaCl2 and lx protease inhibitor cocktail [Roche] ) . Digestion was stopped using 5 mM EDTA. HTA11, one of the Arabidopsis H2A.Z homologues, was GFP tagged and ChIL' was performed sing GFP polyclonal antibody

(Abeam, ab290) . Histone H3 dynamics were assayed using H3 antibody (Abeam, abl791). For RNA polymerase II occupancy dynamic experiments chroma* in was fragmente'"' by sonication in lysis buffer (10 mM Tris-HCl [pH 8], 150 mM NaCl, 1 mM EDTA

[pH 8], 0.1% deoxycholate and lx protease inhibitor cocktail) and ChIP was performed using monoclonal antibody to RNA polymerase II CTD repeat YSPTSPS (Abeam, ab817). All ChIP experiments were performed in buffer containing 10 mM Tris-HCl

[pH 8.0], 5 mM EDTA [pH 8.0], 150 mM NaCl, 1 % Triton X-100 and lx protease inhibitor cocktail. Relative enrichment of associated DNA fragments were analysed by quantitative PCR

(qPCR) . All oligonucleotide sequences used for target DNA detection and quantification in ChIP experiments are given in supplementary material, "-ach ChIP experiment was repeater1 at least three times and the data presented are from a representative experiment.

EXAMPLE 1

HSP70 is an output of the ambient temperature sensing pathway To identify the major ambient temperature responses in seedlings, we analysed the transcriptomes of 12 day old plants grown at 12 °C and shifted to 27 °C. We found that 2454 genes are upregulated at least 2-fold under these conditions and 2880 genes are 2-fold down-regulated (the ambient temperature transcriptome; Figure 1A) . As in similar studies, there was not a significant induction of stress markers, suggesting that this temperature range is not causing heat stress (Balasubramanian et al., 2006). We found that HSP70 (At3gl2580), is strongly up-regulated at higher temperature (Figure IB) . While this transcriptome is characterised by a response to ambient temperature change, we wanted to determine if any of these genes were also responsive to differences in constant growth temperature, since the transcriptional output of a i'herraosensory pathway should be different at various constant temperatures. We therefore analysed the behaviour of the induced ambient temperature transcriptome genes in publicly available data for plants grown at 12 °C, 17 °C, 22 °C and 27 °C ( NASCARRAYS-147

(http : //affymetrix . arabidopsis . info/narrays/experimentpage .pi? experimentid=147 ) . ) . We found HSP70 is expressed at a level proportionate to the ambient temperature within this temperature range (Figure 1C) . While these experiments were performed on seedlings, HSP70 also shows these expression dynamics in the adult plant. We therefore used a fusion of the HSP70 promoter to Luciferase (HSP70::LUC) to monitor the activity of the endogenous gene non-destructively . HSP70: :LUC recapitulates the expression of HSP70 (Figure ID), providing us with a dynamic and sensitive assay for temperature perception status in planta, independent of high temperature stress .

EXAMPLE 2 ARP6 is in the ambient temperature sensing pathway that controls flowering

To identify genes required to control the ambient temperature transcriptome, we screened 2,600 individual M2 families of fast neutron irradiated HSP70::LUC seedlings. Two mutations, entrl and entr2 (enhanced temperature responsel and 2), displayed a constitutively higher LUC expression (Figure IE) . Genetic analysis using a complementation cross revealed that these mutations are allelic. Transcript based cloning revealed that the ARP6 transcript is absent in both entrl and entr2 (Figure IF) . Transformation of entrl with a genomic fragment of ARP6 is able to rescue both the HSP70::LUC expression level as well as the altered development of entrl (Figure 1G) , confirming that it is a new arp6 allele. We will refer to entrl and entr2 as arp6-10 and arp6-ll respectively. Arabidopsis mutants in ARP6 have been identified in flowering time screens (Choi et al., 2005; Deal et al., 2005; Martin- Trillo et al . , 2006). To determine if ARP6 acts in the ambient temperature pathway for flowering, we analysed flowering in arp6-10. Consistent with earlier reports, arp6-10 flowers earlier at 21 °C in long and 22 °C in short days (Figure 2Ά- 2D) . We then studied the response of arp6-10 to 27 °C in short days, since the thermal induction of flowering is most pronounced in short days (Balasubramanian et al . , 2006). Remarkably, arp6-10 flowers with about 5 leaves in short days at 27 °C (Figure 2E and 2F) . ARP6 therefore acts in the ambient temperature pathway that controls flowering.

EXAMPLE 3

ABP6 controls developmental responses to ambient temperature globally

Specific adaptive changes occur to plant architecture in response to higher ambient temperature, including increases in hypocotyl growth and petiole elongation (Gray et al., 1998; Koini et al. , 2009). We analysed these traits to see if arp6- 10 exhibits a global high temperature response in its architecture as well as HSP70 expression and flowering time. f'7e find that architecture responses are strongly enhanced in the arp6 background (Figure 2G and 2H and FIGURE 8), such that arp6 plants grown at 17 °C exhibit greater hypocotyl elongation and petiole growth than wild-type plants grown at 22 °C, with an equivalent difference between 22 °C and 27 °C. These phenotypes have been shown to be dependent on the PIF4 transcription factor (Koini et al., 2009), so it is not surprising that we still observe a temperature-induced difference, even in the arp6-10 mutant. A functional ARP6 is required however for controlling the correct level of expression of these phenotypes. A longstai ding observation in plant biology is that thermal time is a key measure for the rate of transition through the developmental phases, and that phase transition is accelerated by higher ambient temperature (Poethig, 2003) . In addition to the flowering time acceleration in arp6-10, we observe a more rapid juvenile to adult transition (data not shown) , consistent with earlier studies (Martin-Trillo et al . , 2006). Thus arp6-10 causes a specific up-regulation of all the developmental decisions known to be regulated by temperature that we have examined. Plants deficient in ARP6 therefore display a constitutive warm temperature developmental program.

EXAMPLE 4

The ambient temperature transcriptome is globally misregulated in arp6

To determine if the global mis-regulation of developmental responses in the absence of ARP6 occurs at the transcriptional level, we compared the ambient temperature transcriptomes of arp6-10 and wild-type. While 2,454 genes are upregulated 2- fold or more on shifting from 12 °C to 27 °C in wild-type (Figure 3A, grey bars), we observe this ambient temperature transcriptome is consistently expressed in arp6-10, even at 12 °C (Figure 3A, blue bars) . Interestingly, this effect reflects more than a constitutive up-regulation of gene expression per se, since the 2880 genes that are down regulated at least 2- fold on increasing temperature in wild-type (Figure 3B, grey bars) are also constitutively repressed in arp6-10. Thus, transcriptionally, the arp6-10 mutant at 12 °C resembles a plant at a higher temperature. In a reciprocal analysis, transcripts that are 2-fold more highly expressed at 12 °C in arp6-10 compared to wild-type (Figure 3C, blue bars) are strongly induced by higher ambient temperature in wild-type, while those genes that are repressed in arp6-10 compared to wild-type at 12 °C (Fi.ure 3D, blue bars), are transcriptionally repressed by higher temperature in wild-type (Figure 3D, grey bars) . These results show that in the absence of ARP6, the ambient temperature regulated genes are constitutively mis-expressed. To determine what proportion of the entire ambient temperature transcriptome is ARP6 dependent we compared the change of gene expression in response to higher ambient temperature in wild-type with the change in expression resulting from arp6-10 at constant temperature. Remarkably, there is a strong correlation for the entire transcriptome: a functional ARP6 allele accounts for almost half of the ambient temperature transcript responses (R2 = 0.466, P < 0.001). ARP6 is therefore necessary for coordinating the transcriptome in response to ambient temperature .

EXAMPLE 5

The use of HSP70 or HSP70 orthologs as an indicator temperature responsiveness in different germplasm. HSP70 expression levels can be detected using the following protocol :

Plant material is grown and subjected to a particular temperature treatment (either different constant temperatures or shifted between two different temperatures). Aerial plant tissue (100 mg) is flash frozen in liquid nitrogen and ground briefly in a pre-chilled microfuge tube. The tissue powder is resuspended and dissolved into 1 ml TRIzol reagent and gx und until no tissue remains. The sample is incubated for 5 minutes at room temperature. 0.2 ml chloroform is added to the sample and mixed. The sample is spun for 15 minutes at 12, 000g at 4 °C. The aqueous phase is transferred to a fresh tube and the RNA precipitated with 250 μΐ of isopropanol. The tubes are incubated for 10 minutes at room temperature and then centrifuged for 10 minutes at 12,000 g at 4 °C. The RNA pellet is washed with 1 ml of 75 % Ethanol and centrifuged at 7500 g for 5 minutes at 4 °C. Following drying at room temperature, the RNA pellet is resuspended in RNase-free water ,-.nd stored at -70 °C.

RNA is converted to cDNA using commercially available kit from Invitrogen (Superscript III First-Strand Synthesis System for RT-PCR Cat. No: 18080-051) following the manufacturers instructions. A brief summary of the method is as follows: Combine the following components in a microfuge tube: 2 pg RNA, 1 μΐ of 50 μΜ oligo (dT)20 primer, 1 μΐ of 10 mM dNTP mix. Make final to 10 μΐ with water. Incubate at 65 °C for 5 min, then on ice for 1 min. Carry out cDNA synthesis with the following components: 2 μΐ 10X RT buffer, 4 μΐ 25 mM MgC12, 2 μΐ 0.1 M DTT, 1 μΐ RNaseOUT, 1 μΐ Superscript RT (200ϋ/μ1) . Add this mix to each primer/RNA mixture. Incubate at 50 °C for 50 min. Terminate at 85 °C for 5 min. Chill on ice. Add 1 μΐ RnaseH. Incubate 20 min at 37 °C. Store cDNA at -20 °C. Carry out Q-PCR using Sybr green reaction mix (Sigma Chemical S4438) following manufacturers instructions. Briefly, perform PCR using primers to measure HSP70 (Arabidopsis primers: Forward = ACACCGTCTTCGATGCTAAGCGT SEQ ID No. 8 (Reverse = AGGCCAGTGACTCTTATCCGCT SEQ ID No. 9) and standard primers against Ubiquitin (Forward

AGAACTCTTGCTGACTACAATATCCAG SEQ ID No. 10 Reverse ATAGTTTTCCCAGTCAACGTCTTAAC SEQ ID No. 11). Perform Q-PCR in a Roche LightCycler or similar machine. For crop-related plant species, it will be necessary to directly identify the cognate HSP70. This may be done by BLAST alignment of At3gl2580 against the necessary genomic sequence and the design of equivalent Q-PCR primers to measure gene expression levels.

EXAMPLE 6

The use of HSP70 reporter constructs to screen for novel germplasm with altered tempera" ire responsiveness

Since we have determined that the 5' 1239 bp upstream of the start ATG codon of HSP70 confers temperature inducible gene expression, this region ^erves as a useful region to create reporter genes whose expression is controlled by temperature. To clone the HSP70 promoter use the following primers: HSP70F: CATATGctttgcaatgttacccttgtagtct SEQ ID No. 12 HSP70R: GAATTCtattagagatcagaattgttcgccggaaag SEQ ID No. 13. Amplify from genomic Arabidopsis thaliana DNA using Phusion DNA polymerase (NEB) using the manufacturers instructions. Purify PCR product using Qiagen Gel extraction kit (Qiagen, manufacturers instructions) . Clone this PCR product by digesting the ends with Ndel and EcoRI (NEB) using manufacturers instructions, and clone into the vector BJ36, also cut with Ndel and EcoRI, and ligo.ce with T4 DNA ligase (NEB) to create BJ36 LUC. To insert LUCIFERASE reporter downstream of the HSP70 reporter, amplify LUCIFERASE using PCR as described above, but using the primers LUCF: GAATTCATGGTCACCGACGCCAAAAACATAAAG SEQ ID No. 14 and LUCR: GGATCCTTACACGGCGATCTTTCCGCCCTTCTT SEQ ID No. 15. As above, purify this PCR fragment and digest with EcoRI and BamHI, and insert into BJ36 LUC cut with EcoRI and BamHI and ligate with T4 DNA ligase (NEB) . Once this construct has been transformed into chemically competent DH5 alpha E. coli and plasmid recovered and sequenced to confirm successful vector construction, BJ36 HSP70 LUC must be digested with Notl, and the insert ligated to p LBART also linearised with Notl. Ligation of HSP70LUC into pMLBART creates a binary vector that may then be transformed into suitable agrobacterium strains (GV3101 for example) . Agrobacteria carrying the pMLBART HSP70 LUC construct may then be used to transform plants by the floral dip method. Generation of stably transformed T2 and later generation plants enables the routine assaying of temperature responsiveness of plants to temperature.

EXAMPLE 7

The use of HSP70 reporter constructs to screen for novel chemicals that altf*r temperature responsiveness.

The construct obtained above in Agrobacterium GV3101 (pMLBART HSP70 LUC) may also be used to infect and stably transform BY2 cells. BY2 suspension cells are commonly available from a number of labs, and obtain these in advance. Inoculate 5 ml of YEB with the GV3101 transformed with pMLBART HSP70 LUC. Inoculate 18 hours with shaking at 25 °C. Add 1 ml of a 3-day old BY2 suspension culture to a sterile petri dish. Add 50 μΐ of Agrobacterium culture and gently mix. Seal plate and incubate for 2 days at 25 °C in dark. Add 1 ml fresh liquid BY2 medium and collect cells with a 1 ml pipette tip. Transfer to a sterile 1.5 ml microfuge tub . Let cells settle to bottom of tube. Remove excess medium and add 1 ml fresh BY2 medium. Repeat last two steps two more times. Resuspend cells with 1 ml BY2 medium. Transfer cells to BY2 medium solid plates with plant selectable antibiotic (phosphinothricin, 50 μΜ) , 100 pg/ml carbenicillin and 20 pg/ml Timentin. Seal plate and incubate in dark at 25 °C until microcalli appear (about 1 month) . Excise microcalli with sterile forceps and plate on fresh solid BY2 plates with phosphinothricin . Passage calli three times, allowing a 1-month interval between each passage before establishing suspension cultures. mhese cultures then represent a useful resource for establishing temperature sensing assays. In particular the availability of a tissue culture system allows the screening of large numbers of chemicals from libraries in high throughput.

Example 8 Identification of wheat HSP70

The identifier for the gene in the correctly sequenced and annotated monocot genome available (Brachypodium distachyon) is Bradi2g23250. By taking the protein sequence of T?radi2g23250 and blasting it against the wheat r8Ts it was possible to identify a wheat HSP70 used in these experiments. This wheat HSP70 gene shows robust proportional expression at a range of temperatures and does not require a heat stress for expression, indicating it is a good indicator of temperature status in wheat germplasm. The complete wheat genome is not available at the time of filing, so it is not yet possible to obtain the promoter sequence of the wheat HSP70, but this will be possible later. For reference, a rice HSP70 ( Os05g38530 ) , closely related to Bradi2g23250 , is available. This may facilitate interrogation of the wheat genome once it is available. Since wheat is a hexaploid plant, it is envisaged that there will be multiple homeologs of HSP70, and it may be necessary to design sequence dependent assays to distinguish between them in the identification of the ptimal wheat HSP70 Promoter ( s ) .

SeQ Id no. 16 FWD: TCGCCATGAA CCCCACCAAC ACCGTC SeQ Id no. 17REV: CAGGGATGACCTTGAACGGCCACAGC

WHEAT : SeQ Id no. 18 F D: TGCGCGCTACTTGATGGGTTCGCTGTC SeQ Id no. 19 REV: CGACTCCATCGAACGACTACTACTACT Sequence listing

SEQ ID No. 1 (nucleic acid promoter sequence Arabidopsis HSP70 At3gl2580) gtgatgatattttagaatgatgtaaggctttttagtttatactagtattatctgtgtttcaa actgagaagagataataacagtctttgttgagatgataatgttttcaagatgttcctaatec atttcacatcttctcaattttatatgcatgtgcatatatatgttccctccaattatgttgtt cgaatgtttgatgaaactttgaatttttttctttaagcaaaaaaaaatctcaaacaccaaag cgaggagtcattctagttcagttttgagtcattctagttatttttacaaagttttgagtcaa attgggtaaattttttggttattttggtcataaaaataactagattatctcttatatcttat gagttaatttggtaaataaaccatttatttgggtcaaactatttttttccccatatatatat ccaal caataataaattcataatatatttcattaacgcc; ittgaaatactagtaat 'aattg aggactaaagaaaaagtaatttcctttttatctttaaaatgtgcaaaaaaaacaaaaatgtt aattgggtgatgaaataacttgttttcaaaacgggagttactatttgacaatttaaaaaaga cccatctcgaaggagctagaagcgataacaaaataaaaaggaaacaatagtaattagatggc gcaaaaataagatccaacggctgagatctttactcgtgaacgttctcgaaagctctttgccg acccactcttcattcatatataaacaaacacctctctgccttctcttcctcacacaatcata aacacaacaacactcacaaattctcttaaagctcacagacgaattctttctatttttaatct ttccggcgaacaattctgatctctaata

SEQ ID No. 2 promoter sequence Arabidopsis At3g24500 tttttggaattgtgagagagagtgagagagaaacgatgttttgagctgag agaattcgaaaggggggaaagattggcgccaaaaattttcgccttgcgtc gtagaaatggcGGAaacgatacTCCtcagggctcaactttttttgttgac tgttcactctttgaggctttgatgaccgtccgatttatgttctattattg tataccgttggatctttctagccaacgagtcaatcaggcattggtattcg gttcggctaaccccggtttcgaataattcggTTCTGGAAgtaagggatcc gaattgaaaccgaaataaattttacgaaaatttttggttagcttaatttt aatgataactcataaccgaaccgaaaaccaaatttatataaaaccattga gccaaatcggataatatggtgtaccacgaatccaacccaaaaagcattgg ttaactgcaaatcagataatgacacgtcgtcaatcatctctaaGAACGTT Ccagae,acgaaaatggagaaaaagatgatcgaattctccagaaaccaatc ttcgtatatataaatatcacaatcctctcaacaacattcttcatcttcat cgtttctcaatttcaaaactcagattaataaaattttcgcgttgttcctt tctctcaattcatcgacg

SEQ ID No. 3 promoter sequence Arabidopsis AT5G52640 agaagacaaatgagagttggtttatatttaaccataatttcaTTCAGTTC acactgaaccggcgaaatttctttgccagacctattcggaattgaaacaa gtggagtctcgaaacgaaaaGAACTTTCTGGAAttcgtttgctcacaaag ctaaaaacggttgatttcatcgaaatacggcgtcgttttcaaagaacaat ccagaaatcactggttttcctttatttcaaaagaagagactagaacttta tttctcctctataaaatcactttgttttttcctctcttcttcataaatca acaaaacaatcacaaatctctcgaaacgctctcgaagttccaaattttct cttagcattctctttcgtttctcgtttgcgttgaatcaaagttcgttgcg

SEQ ID No. 4 promoter sequence Arabidopsis AT4G12400 tttgaatttataaaatagtcaaaaatcaaaagaggattaaaaaaatttat atacac ,tatacagtacagagaaggatgatttcctttaatttgtgaatat tagttttttttaccatctatgttatacgataaataccgattcataaatac aagataattatttgtatcagtttatttcatggatgatagaccacattgac atcctataatactatatggtttagatttatgtgtgtaattttataagtta gaacaaaactgaaattatgttctaacttataaaattacacacataaaaac tgaaattaaaaaaaaaaaacagaaaaaactgaaattgggctatcagtatt tttgaatacttatatttcaatatatcaaatacagtgagtgatggtgtatt gctgtatctgaaacctatcatccactataaaccccaattgaagtga^aca atcaatatttagaatttccatataatgttaattatgaaattacttctatc taaatatatttcagaagaatttttgagataccacttttatgatttttatt tttttttaataataccactgttttttttttttgttaattttcaatgtaac acaaaatgcaatcatagaatttgttttattaacttttatagagcatatta taaaaacgtttataaagtttctataatgcataatatcaaacatttataag atttttcacaaaatttttaatgttttatagtgcttagaagatttttctta agaaatgatatgaaactagaatttttgaacaacctttttctggtcttttt gaaaaatggtatcataaaggtggtaattttcaaaatttcccaaatttgaa tacaaattcaaatcatattgtaggaaagtgatcaaatatgttaaaattta gaagatgaggtgagaacaaatgtgcagaggagatgcacttgctaaatttg catcttcatgtgatttgtattttgctttttagattgtagtttaccacttt ggttggttacaagtatttggagaaaccatgtactacttgttctttgagta ttaatatatatgattatatgtggtatgtttagaaaaaaacaaaaaaacca aatatcaaacctaaacttattaaaagtaaagacacatttgattaaaacct aaaccaaaaacgtacaaaactattcgcttatgatgatattatttatcata accaaaactttaatcaecatacatacctccgatttggttttctctcccaa actggtcgtcttctcacctctggtttactactactteggattgaagaatt ttgatcgtctcgttgctaactccacgatgtctttctgacgcttaatcttc tgacagaagacaaagacatagcataaaaaagtaagcacagaacataaacg gatgtttattcttttctagacggtatatttacataaataacgaatcactt atcaaaaaGCTGGAGTAGCTCAGTTGGTTAGAGCGTGTGGCTGTTAACCA CAAGGTCAGAGGTTCGACCCCTTTCTCTAGCGtttcttttccttttgtat ttttaagatttaaaaacatttt LCcacggctacaaaaGAACATTCtcgac atacacaaaaaaattcGAAATTTCGAGAActctcttgtgccttcttcttc atcttcctctgtttttaaaaatgcaatcaagcagattctcacgataccta aaccaaatccaattca

SEQ ID No. 5 promoter sequence Arabidopsis AT5G48570 aataaaggcaagaaagatgggtatttgacatgcacaacggcacaacaaac agagattaagaagacaatcactaagtgggaacaagtcacaaccaaattcg ttgagaccgctattcagagcgagacatctacaacttcttcctcttctccc ggcaagatcaagtcaacttgaactcaaaggcataactatacataaactag ttagccacaaatcataaaaaaaattgaaccaaccatacgaaatacagatc aattaactagctaataattttagtttttgtgtttattgtaaataaaacca cggctatagatatttcaaaaagataaatcgtttaagtctttatgctcttt ttaatttttattagtcaaggatgatgaatagtaaattgtataaaataaaa tattatttgatttagaataataaaaaaaaatctagtcacaaaaataatgc ttctataatcaaattttaaattttaagtatttaaaatgattcaaaacttg tgtgtttttaaaaaattaatttattaattttagattaacgagacccgctc aaaagaaaaataaaaagtgttctaacaaataaaaataaaaatcacgctaa cagtcagtatctggaaacatcgggacacatctttaggctcaaggattcaa atgaaaatcAGAAGTCTCTAGAAAaaccccaaaacactctttcttcactc cccctataaattctcatcacaatttctcaaaccatctcatctctgccaac

acactctctagaattctctcgtgattatcgatttcactctcttaaatttg

atcagaaa

SEQ ID No. 6 promoter sequence rice ( Oryza sativa LOC_Os05g38530 prmoter)

TTCACCG AGCAAAAGTT AAA ATGGAAGAACA ATGAT A ATTTTGA TGATGTTTTTTATAACTTAGGTAGCGTCCTTTTGTTATTGAGAATACAAT GTAGTAATAAACCAAACATAGCATGGTTTTGACAATTTTAAATTGCTTAA CATATAAACACATATATAATCACGCGAGAAATGTTAAGAGCATGTTCGCT TTATTGCTACTTGAAATTAAACATAATCTTACCAATATCATTTCATAAAA AAGGTACCTCCGAAACTTTTCTTTCATAAAAACACTACTAAATTTTAAAG AGGCACTAAACTAAGTAC^TTCAACGCCACCAATA'xTTGATAACCTTGTG

TCGGTGATATGGGCTCGGGGGTACTCACGGTAGAGGGAAATAACCTTCCC ATCTGGCCACGTGGCCGTGCGGCCTGCCTTTTCCCCACCCCCTTGGGGGG AGGTTAGGTAGTTATGAGATGGCCAGGGGGCCTCGGGGTGCCACGTCACA CCCCTCAGGCCCGTGAGGCATGCTGCCCCGAGGCCCTCACCCGACCACCA CGTGGCGGGGTGAGTGGGCGGAGTAGGAGGCGTTGTCCAGCGTCATAAAT GAGCGGCGCCCCAACCGTCCCTCGCCGCATTTAATGCAGTGTGGGTGGAC GCGTGGCGCCGCCTGATTGACGCATGTCAATCGACCTTTACCGAACTGCG ACCGGTCGCAGGCGGATAGGACGGGCGGCAGTGCCCCCACGTCCTACCCT ATGTCAGGCGGAGTGGGGGCAGGTATGCCCCGTCCCATCGGCACACTGCC AAGTGTGCCCCCTGTATATGATGAGTCCACCAAAGTCTCCATACATTTAA GAGGGAATGACAGGGATGTCCCCCGTGTCAGGTGGAGGACAGCGTTGGGC CCCACCTAGGGGCGGACAAGCACTTTGCTTCCAGTTGAAGGCACGGATAG TGATCTGACTCAGGCTATGCGGGGCCCCCCTCCCATGGAGGGGTAGGTAT GAACGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTACCCA C C G AG AAAAG GG AC GAC T C T T GA AG C T T G AGC T C G AG AG AAAGC AC AGC TAGGGTTTCCCAGGAGCTCAAGATCCCTTGTAAGAACTCCACCATAATTC CACACACAGGAGTAGGGTGTTACATCTCCCGGCAGCCCAAACCTGTATAA TCCCTCGTCTCTCACACAGATTCGCAAGCGATCAAGTAGCCAGACCCTAA GCGGAGATACGCTCTTGATCATCGCGCCTTATCCCCCGGCCGAACTCACA AAGGGGGGGTCTCACGACCTCCCGCTAGAGAGGATCACTCCTCGACACCT TGGTTTTGACAATAAGAAGCATGTTCACTTTATTACCATTTTCAACCCTA TCAAATTTTGATTAGGTAACAAACTAAATATGATTTGATCAATCGCATAC TATCAAAAATTGTTAGTTCCGGAATTTTCCTCTCATAAAAAGCTATCAAA TT AGAAAC AC A CAAAC T AAAA AT AAC AAT AT CAAAAT AGC AG C G CTAAAATTTATCAAATTTGATATTGTCAAAATCCAAGCATAAAACAGGCG AGAAAGCTACGGTGTACTGAACAATTCCATTGGACGAATCGATCTTGTGC ATCTGTGCAGCTGTTTTCGCGGTACAGGGTGCAACAAAAGCCCATGACGG CCCACACCTGCCTCTCTCCGCTCCAAACACCGAAACAAGGGGGTGGGTGC AATGGGCCGGCGCTCGAAGACCGCGAACTCTTTCCAACAGCCCAGCGCAT TAGCCCCTCCTCCTACTCTCTvJ IACCTTCTTTTTAACATGCGACTTTCTT TCTGTGGACGACGGCATCAACGACGGGAGCAGGAGCGGGGGCTGAAGCAC GGTGCGTGGGCTCCTGGAGTGGCGACGGCCTCTCCGGCGAGCTTCCTCTG GCGAACTCCCTCCGCTCCTCCTATGGCGAAATCCAAACAAGGGTCAGTTT CGACTCCAACCTTCTCCCACCACCACCTCCTGACCGTGCCACCACCCGGC CTTGTCGGCACTGAAAGGCGTCAACTTGTCAGCGCGGGCCTGCTCGGTCG GTCTCCTCCTCCCCTATTTCGTTTAGCTTTGCCCCCGCCACCAACACCGG CCCACGGCCCATGGCCGACCCCGCGGCTTT GCGCCGCCATCGCTATC C GCCGCTGTCCTTTTTTCATGACCTTCGGTGCCATCCCTCTAAATTCGATG CACCTCCCTGGCTCTATCTCCCTTTACCTCCGAAATCCTAACCCTACCCA TAATCTCTAGTGAGTCTTGTCTTTATTTATGGCCTCTTTGAATCGCAGGA TTGATAAAACGTAGGATTTTGATAGGAATGTAAGTGTAAAACACATGATT GTAAAATAGAGGAAAAACATAGGAATGGCCGTTTGATTGAACCGCAGAAA AAAC AC G G AT AGAT G AGAGAGA AG AC T C AAAGT AC AAG AGAT T G AAGCTTTTGCTAAATTTCCTCCAAAATCTCTATAGGATTGGCCATTCCAT AGAAAT T C AAAAG A T T AA AGG A C AA C C T G T T C AAAAAAC T CATAGAAAATTTTTCTATAGAATTAAAATCCTCTAAAATTCCTATGTTTT TTCTCCAAT TCAAAGGGGCCCTTAGGTTGGAATTTGGAAAGTGTTCGCGA GAAATCAAGCGGTCGCACGTTAGCGAATTAGGATTTCCGGAAACAAAGGA CCGACTCCGCCTATCCATCGTCACGAGCACAGTGTAGAACCTCCCAGACC TCAAGAGACCGTTCAAAAAGCGCGCGCCCAAGCGGGGCCCACCAACGCGT CCCCACCGTGTCGCCTCCTGATTGGTTGTCCCCTCTTCCTTTCACGCGAA CCGGCACCCTCCCGACCCTTCCAGAACCCCCAATCCGACGGCCAGGATCG CCCGCGCGCGAACGI CTAGACCCCCGCCACCTCCGCCACAAAACCTCTG CCCCTCCCCTCTCCCCCCGCTTCGTCTCGTTCGAGAAATCAGAAAGAGAG AGAAATTCCCACGCAGCAGCAAGCAATCCAATCCGAGAGCGCGCGTTTGC GATTATTCGCTTTCGATTCCGCGAGGTTTTTGGAGAGGGAGGAGAAGGAG GAGGAG

SEQ ID No. 7 promoter sequence Brachypodium distachyon HSP70 promoter .

Bradi2g23250.1

CTGCTGGACGGGGAGTCGTCGTCGTCCGCCGCCCTCGCTGCCGATGCCGC GGCGACGATGAACGTCTCCCCGTCGTTGTCGTCCAGCGACGACGACGACG AATGGATGGATCCCTCAAGCGAGTCCGAGGACGACGCCGCGGACGAGCAC TGGCTCCCGACCGAGTCCTCCTCCAAGAACACTAGCGCTACTACCGGCAG CGGCAAGAAACGCCGTCTTCCGCGGCAGCAGCAGCAGCAGAGCACCGCTG CTACGGGACAGAGGAAGCCGCAGCAAACGGAGCCGACCGCCGTCGTGGAA GGCGGCGGCGGCAACAAGCAGGGCGGGTACTGGTGCCGCGGCTGTTCCAA GGTGGAGACCC GCTGTGGCGCGCCGGGCCGGAGGGCCCCAAGACGCTGT GCAACGCGTGCGGGCTAAGGTACAAGAACTCGCTGGCGGCCATGGCGGCA CCGCAGACGACTACGACGACGGCCACGAAGCGCCTGGCGCTGCCGGCGAA GCCCCGCGGCAGAAGCTCCAAAAGCAACAAGAACCGCTCTGCGACGGTTG TCAGGAAGAAGCGTACGTAGCGTCGCAGTTCGCATAGACCGATTGAATTA ACCTGGACGGCGGCGCACGAAAGCGAGGGCGCAAATTATTTCTTCAGAAG TACTACTGCGTTTTCAGAGTTTCAGACAGTATTTGTAAAAAAAAAAATTT GCATTTTGGGATTATTTCTTCAGAAATATACAGAGTAGTATCTCGAAAGA TAACTAACCCAGTGAAAACCACTTGGTTCTCGGAACATCGGTAATTTAGA ATCGAATGTTAGTCAAATATTTCTGGAGAAGATATTGTTTACTAGGTCTG TGGGGGTCCGAACACAAGCTTTGCATTATGTATTCAACGCCATTGGAGGC GTCTCTTGGTCGCTAGCGTGGGTGGTGACTGTTTGGCATGAGCCTGTGTG ACCTTGCTCCTCTGCACGAG TGGGACCTGTCGGCGTTGGTAGGGAAAGT TGCGGTCGTCAACTCATGACGAGTTTGGTGTGACAACAATAACTTTTGCG TGGAATCTCGACGGTAATTTTTTGTTGACAGCGTGCGATCGTGCTGGAGT GAGTGGGGTGACAGCCAATGTGTCCTGAGTGCGGTCTTCTGGATTGCGTT GTGGACATTCGTTAGACCGATTTTCCGTTTAATATACCGGATATAACTTT AGTATGTAATGGATTAGTCTTTGAATTCCGATTTGGGGGCAACAGAAAGT TCAAAAGGCTCGCGGCACTCATCTGTGGGCTTGCTTTGTGGAAGTTCTGT AGGCTGCACTTTTCTCTCTCCTTCAAAAGTAGCCATGATCTTTTGTCATG AACCCCTAAGCTATAAATACCTCTCATGGAGGCATGTATCATTCACTCTC AAGTTGAATAAALTCAAGGAAAGAGAGCTA AGTGCTCCCTCTAAGGTTC GTTCTCGAGCGTCGCTTTCGACTAAAAGTCGACCGGCCTCGAGAAAGACT TCTAGAAAACTCTAGTTTCGAAGCTCCGAGCTAACCTTGGTTAGCACGGG CTTGTAGGAGAAGAGATTGGGTTAAAGTTCCGAGGGTATCCTGGCTGTGA CCACTTCCTTGCGCGGGCCGCATCACGTGGGACTTCCGCGCGACCTGAAG GACGCCATGGACATCGGCATACCGTACCCCGGGCCCCGGCATAACTGCTT GCACCCGCGAGCTGGCAGCGGCACGTCGCCTCCGGCGTCCCGCGCCCCTG GCTCTTCGCCTTCGTTTCTGACGGACTTCCGGGCCGTGTTGCTCAAGGAG TGCCAGGCCGCTGTGGGCCGCGTGCGGCACCATGCACTGCGTCGAAGGCC GGGGCTGCTCGTCCAGCAGACTCTTCATGCATGGGCGGGTGGGTCTGCCT CCAAACACGCGGGGACAGCTACACGCGGCACGCGGCGCTCGGTATTGGCA TGCATGGTGGCCGAC TCGTGCCGATGTTGTTCTGGCGGCAGACAACGTA CTTGCAGTATGAATTGGTACATGCCGGCTGACAACGGCCAAGACATGGAT AGCGGACAAGGTTCTTCCAACCTGGTCACATGTATTAATTGTACAGAAAC TTCCTATTTTGTATTAATCGCGTGACACATCGTCCCTTGATGTCATCTGC TCGGGATTCGATAGCCCCGCCGCGCGCCTGTGCTCCATGCGGACGAGATC GAAGACGACGGATCATCCGGGGCATCGGCGGTGGTCGAGGACGGAGCAAC GCCGACGCCGGCGGTGGTCGAAGGAGTGGTATGTGCATGTCCATTGACCC CACGATCTGTGCGTGCCTGCAACCTGACCGTGCCTGGCCTGCTGGCAGGC TGGCAGCCATCCCCGAGGCAGACGAGGAAGCGCGTGGGGGAGATGACACC GAGGTTGGCCTACGCCGCTGTGGCCAAGGATGGGCTCGGCAGTGGCATGA AGCACACAGGGGACGTCATGGTTAACGGCATAGAATATGTGGCGTGAAAC TACCAAAATCACCATGTAAACCGCTCTAACCGCTCTAGATGTGACACGTC AGTTCTAATACCGTCTTGGGTTGATTTATCTGGTATTACGGATTTCAGAT GTAAATCAGACAGTTTTGTACTTCAGAGGCTTATGCGTCTCGGGAGACAT TTATACGAACTTCTTTCGTTTTTTTTTTCAACCCAGCCAGGCCCATTTTC CTCCCGTAAGGCGGTAACTCGAGTCCCTCGCCAAGCTCTCGTGCACACTG TAGAACCTACCAGAGAGACCGTTCAAAAGCAGCCATGTGGGCCCGACGAC GCAGTCCGCCGTGTGTCGCCTCCTGGTTGTGGCCCGTCCTCCCCCACCGC CACCCCGCACACTCCCGACCCTTCCAGAACCACCCCGATCGGACGGTTCC GATAGCCCGCACCAGAACATTCCGGAACCCCCGTCGCCCCCCGTTAAAAC CCCTGCCGTCTCCTCCCCTCCCTCCCCACTTCGATTTCCAGAGCAAGATT TCCGGCTAATCGTACCAAGCAAAACAGCTCTTTCCACCGCAAACCGCAGC AAGCGAATCGTTCGTGCACGAGTAGCAGAGGAGGAGGAG

SEQ ID No. 8 primer

ACACCGTCTTCGATGCTAAGCGT

SEQ ID No. 9 primer

AGGCCAGTGACTCTTATCCGCT

SEQ ID No. 10 primer AGAACTCT" nCTGACTACAATATCCAG SEQ ID No. 11 primer ATAGTTTTCCCAGTCAACGTCTTAAC SEQ ID No. 12 primer CATATGctttgcaatgttacccttgtagtct SEQ ID No. 13 primer

GAATTCtattagagatcagaattgttcgccggaaag

SEQ ID No. 14 primer

GAATTCATGGTCACCGACGCCAAAAACATAAAG

SEQ ID No. 15 primer

GGATCCTTACACGGCGATCTTTCCGCCCTTCTT SEQ ID No. 16 primer BRACHYPODIUM

TCGCCATGAA CCCCACCAAC ACCGTC

SEQ ID No. 17 primer BRACHYPODIUM

CAGGGATGACCTTG ACGGCCACAGC

SEQ ID No. 18 primer WHEAT

TGCGCGCTACTTGATGGGTTCGCTGTC

SEQ ID No. 19 primer WHEAT

CGACTCCATCGAACGACTACTACTACT

SEQ ID No. 20 (gene sequence Arabidopsis HSP70 At3gl2580) gtgatgatattttagaatgatgtaaggctttttagtttatactagtattatctgtgtttcaa actgagaagagataataacagtctttgttgagatgataatgttttcaagatgttcctaatcc atttcacatcttctcaattttatatgcatgtgcatatatatgttccctccaattatgttgtt cgaatgtttgatgaaactttgaatttttttctttaagcaaaaaaaaatctcaaacaccaaag cgaggagtcat cctagttcagttttgag > cattctagttatttttacaaagttttgagtcaa attgggtaaattttttggttattttggtcataaaaataactagattatctcttatatcttat gagttaatttggtaaataaaccatttatttgggtcaaactatttttttccccatatatatat ccaatcaataataaattcataatatatttcattaacgcgattgaaatactagtaattaattg aggactaaagaaaaagtaatttcctttttatctttaaaatgtgcaaaaaaaacaaaaatgtt aattgggtgatgaaataacttgttttcaaaacgggagttactatttgacaatttaaaaaaga cccatctcgaaggagctagaagcgataacaaaataaaaaggaaacaatagtaattagatggc gcaaaaataagatccaacggctgagatctttactcgtgaacgttctcgaaagctctttgccg acccactcttcattcatatataaacaaacacctctctgccttctcttcctcacacaatcata aacacaacaacactcacaaattctcttaaagctcacagacgaattctttctatttttaatct ttccggcgaacaattctgatctctaataATGGCGGGTAAAGGTGAAGGTCCAGCTATCGGTA TCGATCTCG --TACAACCTACTCTTGC TCGGTGTTTGGCAACATGACCGCGTCGAAATCATC GCCAACGATCAAGGCAACCGCACCACTCCTTCCTACGTTGCTTTCACTGACAGCGAGCGTCT CATCGGGGATGCTGCCAAGAATCAAGTCGCCATGAACCCTACCAACACCGTCTTCGgtaaac atctcacttccttctcatcttacttactatatctgctttgcttcctgcatgtgattaagttt gtgtagatcggtccatagtgattttggtttatgaatcggttattcaattttggttatatcga aacagagccggtttagtgtgtcaagcagatagaaatctgttagagtttattagtgttctcta tgttgttgttaattaggaggaagtaagtattaaacttgttgttgtgttttttttgcagATGC TAAGCGTCTAATCGGAAGAAGATACAGTGATCCCTCTGTTCAAGCGGATAAGAGTCACTGGC CTTTTAAGGTTGTTTCCGGTCCAGGTGAGAAGCCTATGATTGTGGTTAACCACAAGGGAGAG GAGAAACAGTTCTCTGCTGAGGAAATCTCGTCGATGGTTCTTATTAAGATGCGGGAGATTGC AGAAGCTTTCCTTGGTTCTCCTGTTAAGAACGCTG^CGTTACAGTTCCTGCTTATTTCAACG ACTCTCAGCGTCAAGCGACTAAGGACGCTGGAGTTATCTCTGGTCTCAACGTGATGCGTATC ATCAATGAGCCAACTGCTGCTGCTATTGCTTACGGTCTTGACAAGAAGGCGTCGAGTGTTGG CGAGAAGAATGTTTTGATCTTTGATTTGGGAGGTGGTACTTTTGATGTGTCTTTGCTTACGA TTGAGGAAGGTATCTTTGAAGTCAAGGCAACTGCTGGTGACACGCATCTTGGTGGTGAGGAC TTCGACAACAGGATGGTTAATCATTTTGTTCAGGAGTTTAAGAGGAAGAACAAGAAGGATAT TACTGGGAACCCGAGAGCTTTGAGGAGGCTTAGGACAGCTTGTGAGCGGGCGAAGAGAACTC TTTCTTCGACTGCTCAGACGACTATAGAGATTGACTCTCTTTTTGAGGGTATTGATTTCTAC ACTACCATCACTCGTGCTAGGTTCGAGGAGCTCAACATGGATTTGTTTAGGAAGTGTATGGA GCCAGTGGAGAAGTGTTTGAGGGATGCTAAGATGGACAAGAGCAGTGTTCATGATGTTGTTC TTGTTGGTGGCTCTACAAGGATTCCC: AAGTGCAGCAGCTTTTGCAAGACTTCTTCAATGGG AAAGAGCTCTGTAAAAGCATTAACCCGGACGAGGCTGTTGCTTACGGAGCAGCTGTGCAAGC TGCAATCTTGAGCGGTGAAGGGAATGAGAAGGTCCAGGACTTGTTACTTCTTGATGTCACTC CTCTGTCCTTGGGTTTGGAAACTGCCGGTGGTGTTATGACTGTTTTGATTCCGAGGAACACC ACAATTCCGACCAAGAAAGAGCAGATATTCTCTACCTATTCAGACAACCAGCCCGGTGTACT GATCCAGGTCTACGAAGGAGAGAGGGCACGAACAAAGGACAACAACCTTTTGGGAAAGTTCG AGCTCAGTGGTATACCACCTGCTCCACGAGGTGTACCGCAGATTACTGTCTGTTTCGACATC GACGCCAATGGTATCCTGAATGTGTCGGCTGAGGACAAGACGACTGGTCAGAAGAACAAGAT CACAATCACAAACGACAAGGGAAGGTTATCAAAGGAAGAGATCGAGAAGATGGTACAAGAGG CAGAGAAGT^CAAGGCTGAGGATGAAGAACACAAGAAGAAGGTGGATGCAAAGAACGCTCTC GAGAACTATGCATACAACATGAGGAACACGATCAAGGACGAGAAGATCGCATCTAAGCTTGA CGCAGCTGACAAGAAGAAGATTGAGGATGCAATCGACCAAGCTATTGAATGGTTAGATGGGA ATCAACTGGCTGAGGCAGATGAGTTCGAGGATAAGATGAAGGAGCTCGAGTCTCTTTGCAAC CCTATTATTGCAAGAATGTACCAAGGAGCTGGGCCTGATATGGGTGGTGCAGGAGGAATGGA TGACGACACACCTGCTGG^GGTAGCGGCGGTGCTGGCCCAAAGATTGAAGAAGTTGATTAAg ccttttggcttttgtttactctgtttgcttgagattctagttggtttcttgttcttagtttt atctttctatgtcactctgaaactggtgtgtgatcattttgatgctttaagaatttagcttt accgtttttaaaactcgctctgacctatgaaagacgactgggcataatactctacacgaaat atagtagacaaagtgaaagaagttaagttcatggtttaaggaatatgatcttagcactttga ttttataattaaccatccaatatgaatccaagatctcttgttatacatattaaagaaaattt tcttcttat tcaatatagtttatctgaaaaaccgtacaaattgtagtgggattccatattc tatatatgagatgtaagatttcatttgttgttgtccaaaaaaaaaaatgatttcatttgtta aagagtcttccattgaatgttgtcacatattgcgtaacacaaattcaagcatatgaacaaat aaggaattaagaggttaaaagaacacaatgaaatggagtaaatatgattaaatatgaataat ccaatg tacatgaacaataaaattcttttaagaagttatccgctacaatc

SEQ ID No. 21 gene sequence Arabidopsis At3g24500 atcttcatcgtttctcaatttcaaaactcagattaataaaattttcgcgttgttcctttctc tcaattcatcgacgATGCCGAGCAGATACCCAGGAGCAGTAACACAAGACTGGGAACCAGTA GTTCTCCACAAATCAAAACAAAAGAGCCAAGACCTACGCGATCCGAAAGCGGTTAACGCAGC TCTGAGAAACGGTGTCGCGGTTCAAACGGTTAAGAAATTCGATGCCGGTTCGAACAAAAAGG GGAAATCTACGGCGGTTCCGGTGATTAACACGAAGAAGCTGGAAGAAGAAACAGAGCCTGCG GCGATGGATCGTGTGAAAGCAGAGGTGAGGTTGATGATACAGAAAGCGAGATTGGAGAAGAA GATGTCACAAGCGGATTTGGCGAAACAGATCAATGAGAGGACTCAGGTAGTTCAGGAATATG AGAATGGTAAAGCTGTTCCTAATCAGGCTGTGCTTGCGAAGATGGAGAAGGTTCTAGGTGTT AAACTTAGGGGTAAAATTGGGAAATGAttaaacgatgtcgtttatcttgtattttgttgacc aatgtaaaaagtaaaaaaaaagtcttgttgttttgtttgataa.tgaaaaaacaatatatat ctttcatttc

SEQ ID No. 22 gene sequence Arabidopsis AT5G52640 tctataaaatcactttgttttttcctctcttcttcataaatcaacaaaacaatcacaaatct ctcgaaacgctctcgaagttccaaattttctcttagcattctctttcgtttctcgtttgcgt tgaatcaaagttcgttgcgATGGCGGATGTTCAGATGGCTGATGCAGAGACTTTTGCTTTCC AAGCTGAGATTAACCAGCTTCTTAGCTTGATCATCAACACGTTCTACAGCAACAAAGAAATC TTCCTCCGTGAGCTCATCAGTAACTCTTCTGATgtaagtttcccttcaaatctctctctgct cggtgtgactcgtccgcttcctattttcttgcatgttgtttgttctttaattcctggattcg ttgatagcgttggattcgtaggtttagcgttgtgattgcttattcaaataaatcgtgatttg gcttgtgcatcacgttaagtttagaattcttagcttgtgctcgatcttcatgtgttgtagtt acatatatagaacggttcttgcttcgatgtagtctttgatttaccctagaggattgaggaaa gcttctgattatctttgtttatatgaatggttttgtagGCTCTTGACAAGATCCGATTTGAG AGCTTAACGGATAAGAGCAAGCTCGATGGACAGCCTGAACTCTTCATTAGATTGGTTCCTGA CAAGTCTAATAAGACGCTCTCAATTATTGACAGTGGTATTGGCATGACCAAAGCAGgtaacg aatcaatgcctaataatctctcgttggtgagatgttttagtgtatgtgctgtggttatgact ctctattattttttcagATTTGGTGAACAACTTGGGAACCATTGCGAGGTCTGGAACAAAAG AGTTTATGGAGGCGCTTCAAGCTGGAGCTGATGTAAGCATGATAGGACAATTTGGTGTTGGT TTCTACTCTGCTTATCTTGTTGCAGAGAAGGTTGTTGTCACTACAAAGCACAATGATGATGA ACAATACGTTTGGGAGTCTCAAGCTGGTGGTTCCTTCACTGTCACTAGGGATGTGGATGGGG AACCACTTGGTAGAGGJA CTAAGATCACCCTCTTCCTTAAGGACGATCAGg aaggaatcgt agctttgagtgttttggggattgtttcttttcttttggtgttttctgtgttcttacaagtgt gtttattcatgcagCTTGAATACTTGGAGGAGAGGAGACTCAAAGACTTGGTGAAGAAGCAC TCTGAGTTCATCAGTTACCCTATCTACCTTTGGACCGAGAAAACCACCGAGAAGGAGATCAG TGACGATGAGGATGAAGATGAACCAAAGAAAGAAAACGAAGGTGAGGTTGAAGAAGTTGATG AGGAGAAGGAGAAAGATGGTAAAAAGAAGAAGAAAATCAAGGAAGTCTCTCACGAGTGGGAA CTCATCAACAAGCAGAAACCGATCTGGTTGAGGAAGCCAGAAGAGATCACTAAGGAAGAGTA TGCTGCTTTCTACAAGAGCTTGACCAATGACTGGGAAGATCACTTAGCCGTGAAACACTTCT

CAGTGGAGGGTCAGCTAGAATTCAAGGCCATTCTCTTTGTACCAAAGAGAGCTCCGTTTGAT CTCTTTGACACGAGGAAGAAGTTGAACAACATCAAGCTTTATGTCAGGAGGGTGTTCATTAT GGACAACTGTGAAGAGCTAATCCCAGAGTACCTCAGCTTTGTGAAAGGTGTTGTTGACTCTG ATGACTTGCCACTCAACATCTCTCGTGAGACGCTTCAACAGAACAAGATCCTTAAGGTGATC AGGAAGAATCTAGTGAAGAAGTGCATTGAGATGTTCAACGAGATTGCTGAGAACAAAGAGGA CTACACCAAATTCTATGAG JTTTCTCCAAGAATCTCAAATTGGGTATCCATGAAGACAGTC AGAACAGGGGAAAGATTGCTGATCTTCTACGGTACCACTCCACAAAGAGTGGTGATGAAATG ACGAGCTTCAAAGATTACGTCACAAGGATGAAGGAAGGTCAAAAGGACATTTTCTACATCAC TGGTGAAAGCAAAAAGGCGGTGGAGAATTCTCCCTTCTTGGAGAGGCTGAAGAAGAGAGGAT ACGAGGTACTTTACATGGTGGATGCGATTGACGAATACGCTGTTGGACAATTGAAGGAGTAT GACGGTAAGAAACTTGTTTCTGCGACTAAAGAAGGCCTCAAACTTGAAGATGAGACCGAAGA AGAGAAGAAAAAGAGGGAAGAGAAGAAGAAGTCCTTCGAGAATCTGTGCAAGACGATTAAGG AAATTCTCGGGGACAAGGTTGAGAAGGTTGTGGTCTCAGACAGGATTGTGGACTCTCCCTGC TGTCTAGTAACTGGTGAATATGGATGGACTGCAAATATGGAGAGGATTATGAAGGCACAGGC GTTGAGAGATAGCAGCATGAGTGGTTACATGTCGAGCAAGAAAACAATGGAGATCAACCCCG ACAACGGTATAATGGAGGAGCTCAGGAAGAGAGCTGAAGCAGACAAGAATGACAAGTCTGTT AAAGATCTTGTCATGTTGCTGTATGAGACAGCTTTGTTGACGTCTGGATTCAGTCTTGATGA ACCGAACACTTTTGCTGCTAGGATTCACAGGATGTTGAAGTTGGGTCTGAGTATTGATGAGG ATGAGAACGTTGAGGAAGATGGTGATATGCCTGAGTTGGAGGAGGACGCTGCTGAAGAGAGC AAGATGGAGGAAGTCGACTAAgagatgaagaaattgctcttatggttctgaaaacttctaat atgtcgagttgttctgagttttaagattttccaaaatgtctttgtctttttttttatatctt tagagttacttgaacattgtgactacttctagggttgggtttgtgtcaggtctgttatatcg tgtggtgggtctgtctaatactgattcaagtttttgttattcagctaag

SEQ ID No. 23 gene sequence Arabidopsis AT4G12400 ctcgacatar-acaaaaaaattcgaaa tcgagaactctcttgtgccttcttcttcatcttr* ctctgtttttaaaaatgcaatcaagcagattctcacgatacctaaaccaaatccaattcaAT GGCGGAAGAAGCAAAATCCAAAGGAAACGCAGCTTTCTCTTCCGGCGATTACGCCACCGCAA TAACCCATTTCACAGAAGCAATCAACCTTTCACCAACCAATCACATCCTCTACTCAAACAGA TCCGCTTCTTACGCTTCTCTCCACCGTTACGAAGAAGCTTTATCAGACGCGAAGAAGACTAT AGAGCTTAAACCTGATTGGTCTAAAGGATATAGCCGATTAGGTGCTGCGTTTATTGGATTGT CCAAGTTTGATGAAGCGGTTGATTCGTATAAGAAAGGATTAGAGATTGATCCGAGTAATGAG ATGCTTAAATCGGGATTAGCTGATGCTTCGAGATCTAGGGTTTCGTCAAAGTCGAATCCTTT TGTTGATGCGTTTCAAGGGAAGGAGATGTGGGAGAAGTTGACGGCGGATCCGGGGACTAGGG TTTATTTGGAGCAGGATGATTTTGTTAAGACGATGAAGGAGATTCAGAGGAACCCTAATAAT TTAATTTGTATATGAAGGATAAGAGAGTTATGA? .'!GCTTTAGGGGTTTTGTTGAATGTGAA GTTTGGTGGATCTAGTGGTGAAGATACTGAGATGAAGGAGGCTGATGAGAGGAAAGAGCCTG AACCGGAGATGGAACCTATGGAGTTGACGGAGGAGGAGAGGCAGAAGAAGGAGAGAAAGGAG AAGGCTTTGAAGGAGAAAGGGGAAGGAAATGTTGCTTATAAGAAGAAGGATTTTGGGAGAGC TGTTGAACATTATACTAAGGCCATGGAGCTCGATGATGAGGATATTTCGTATTTGACGAATC GTGCTGCTGTTTATCTTGAGATGGGGAAGgtattaagtcttatacttggcttaaaagttaaa cctttaggtactttaagattaaggaggagatcttgggttcttgaagtagcttatctgtttag tatagcttgtcactagttagtacatttgtgatgaccttgatgggttttgataactttcatct gcttcttgttggagatttaagagttttgaacttaagttttcacttgtgctgaaagtagttag ctttagatgaggtagaaatttagggtttatggcttcatgatggagtttattcacttgttctg tagaagtggttatctttattattactggaatcaattaatcttcaagtatcctgagtggttca attccattggtctatgtgttcttgcattagtcttgtttaattaacagttggttcatctggat cttactgtatcttgtgtgatgttttacttcatttctcaaatgaaattatcagTACGAGGAGT GCATTGAAGACTGTGACAAGGCTGTTGAAAGAGGCAGAGAACTTCGTTCTGACTTCAAGATG ATAGCAAGAGGTCTGACTAGAAAAGGATCTGCTCTAGTGAAAAT GCGAGATGCTCGAAAGA CTTTGAGCCTGCGATTGAGACTTTCCAGAAAGCTCTTACAGAGCATCGTAATCCAGATACAT TGAAGAAACTGAACGATGCTGAGAAAGTCAAGAAAGAGCTGGAGCAACAGGAGTACTTTGAT CCTACGATAGCCGAGGAGGAGCGAGAGAAAGgtatatatactgatcctcagttacacttact atcttgaaacgtgatttgattttaggattaagcatttgacacttcttcattgatgcagGTAA TGGATTCTTTAAAGAACAAAAGTATCCAGAGGCAGTGAAGCATTATTCAGAAGCAATCAAAA GAAACCCGAACGACGTGAGGGCATATAGCAACAGAGCTGCTTGTTACACAAAGTTAGGAGCA TTACCAGAGGGATTGAAAGATGCTGAAAAATGCATTGAGCTGGACCCAAGTTTCACGAAAGG ATACAGTAGAAAAGGAGCTATTCAATTTTTCATGAAGGAATACGATAAAGCTATGGAAACGT ATCAAGAAGGGCTAAAACATGATCCTAAGAACCAGGAGTTCCTTGATGGTGTTAGAAGgttt gcaaattttggcatt ctctctttgttgtttaaccttgcaaagatcggtctagtgaaagtgtt gttgttttcagATGTGTGGAACAGATAAACAAAGCGAGCCGTGGTGATCTGACTCCAGAAGA ATTGAAGGAGAGACAAGCAAAGGCAATGCAAGATCCTGAAGTTCAGAACATATTATCGGATC CAGTGATGAGACAGgtaaaagcagtggcaagcattgtgttctaactcgtaagctgtctgtga gacttgtgtgatgatgtctattgtagGTACTAGTGGACTTTCAAGAGAATCCGAAAGCTGCA CAAGAGCATATGAAGAACCCAATGGTAATGAACAAGATTCAGAAGCTGGTTAGTGCCGGAAT TGTTCAGGTCCGGTAAattggttatgctaaaccggagtggtatattgaatcaaaccgaagat gtttccaaattttcactgcgttcttttgggcttttgttaaactgatgaaactctgatttggt ttgggtcatgtttgaggagttgttgtagaatgaatcaagtctgtgttctcctagttttatat gctacttcttcgaattttctcaaaagaatcttcaaac

SEQ ID No. 24 gene sequence Arabidopsis AT5G48570 tcgggacacatctttaggctcaaggattcaaatgaaaatcagaagtctctagaaaaacccca aaacactctttcttcactccccctataaattctcatcacaatttctcaaaccatctcatctc tgccaacacactctctagaattctctcgtgattatcgatttcactctcttaaatttgatcag aaaATGGAAGACGATTTCGACACGCAGAACCAGTTTCCGGAAGAGGAGCCAGAGGAGATGGA TATGGATCTCCCCGACAATGACGAAGCTGACTCTGCTCCTTATCTGAAAATCGGCGAGGAAA TGGAGATCGGAAAATCAGGATTGAAGAAGAAACTTGTTAAGGAATGTGAAAAATGGGACACG CCTGAGAACGGTGACGAAGTTGAAGgtaatttgaaattgctgaagtctgatctgatgataat atatgtgtgaatcaggttctcagattgtgttttcttttgcagTGCATTACACTGGAACTTTG TTAGATGGTACCAAGTTTGATTCGAGCCGTGACAGAGGAACTCCTTTCAAATTTACTCTTGG CCAAGgtacttttctattttgcaacaatatttgtgaggcctatgtattcggatttggatcgg attttttcggattcggataatattataggatcatattaaggctgttgtcttctttgaggccg gtttgtgagagaagttttggttgagagtttgttttgatcgatagttactatttaattacggt gtctttcgagttctgaattttgttttggtttggaatggtcagGACATGTCATTAAAGGATGG GACTTGGGGATCAAGACAATGAAGAAAGGTGAAAATGCTATTTTCACCATTCCTCCTGAGCT GGCATATGGTGAAACCGGTTCACCGCCGACTATACCTCCGAACGCTACTCTTCAGTTTGATG TGGAGTTGATAGCATGGAGGAGTGTTAAGGATATATGTGGTGATGGTGGTGTGTCTAAGAAA ATAATTGTGGAAGGAGAAAAATGGGAGAAGCCAAAAGACCTTGATGAAGTTTACGgtgcgtg tttttcgtcttcctatgattttggtttgattctttgtgctggaatatagtcttgtcgatgtt gttggttctgatttgttttatggtttggtaccgtggcagTCAAGTATGAAGCTCGGCTTGAG GATGGCACCATTGTTGGAAAGTCTGATGGTGTAGAGTTTACTGTCAAGGAGGgttagtattt ttttttctca accggatattattagctattcgaggatctaaatacttctcgtgtaatagGCCATTTCTGTCC TGCGCTT'ICTAAGGCTGTCAAAACcATGAAAAGAGGGGAGAAGGTTCTCCTGACTGTGA^GC CACAATgtgagtattttatttggtgtttgtccttatttagcgatgaatcagtgaatttagat tgatgtgtgacactctgacttgtacagATGGATTTGGGGAATTTGGAAGACCAGCTTCTGAT GGTCTTCAAGCTGCAATCCCACCAAATGCAACCCTTCAGATTGACCTTGAGTTGGTTTCTTG GAAGACTGTGGTGGAAGTAACTGATGACAGGAAGGTTATTAAGAAAATACTCAAGGAAGGAG AAGGATATGAGCGTCCCAATGAAGGAGCGATTGTCAAATgttagcatctatctttaagggtc ttatctgaagacctcctctacgctatggttaagctatgtgatctgacaacgagttttttgtt gcagTGAAGTTGATTGGTAAACTTCAAGATGGAACAACCGTGTTTGTGAAGAAAGGTCATGA AGAAGATGAGGAGCCGTTCGAGTTCAAGATTGATGAAGgtataatattcatatatacagaac ttggaatattgtttcctttttgtatttgacatttcacggctatgatattaaatgacagagga ttggtgatctgtgcagAACAAGTGATAGAAGGGCTTGAAAAAGCTGTGATGGGCATGAAGAA GGGTGAGGTAGCACTCATCACAATTTCACCGGAATATGCTTTTGGTTCCTCTGAATCAAAAC AGGAGCTGGCTGTAATACCGCCAAACTCGACTGTATACTATGAGGTCGAGTTGGTATCTTTC ATCAAGgtga^aggattcactttctga^tgttgtttctttctttd cgaagaaacttaagtgt gctaatgatatcgtctctcttgatgcagGAGAAAGAGTCTTGGGATATGAACACACAGGAAA GGATAGAAGCTGCAGGCAAGAAGAAAGAAGAAGGCAATGTGTTGTTCAAAGCTGGAAAATAC GCAAGAGCTTCAAAGAGATACGAGAGGgtttgggatttggtcctagtatttgctaaagaaac ttatgtttttgtttagattttaacatcaagttttgattgcagGGTGTCAAATATATAGAATA TGACTCAACTTTCGACGAAGAGGAGAAAAAGAAATCAAAAGATCTCAAGATTGCCTG AACC TGAATGATGCAGCTTGCAAGCTGAAACTGAAAGATTACAAGGAAGCAGCAAAATTGTCCACA AAGgtaaaaacaaaacatttcagtttcagtaattttggatattacaattggagatgaacgac taagtagtgaatgaaacgaatgtgaatagGTGTTGGAGATGGATAGTAGGAACGTGAAGGCA ATGTATAGGAGAGCACATGCCTACTTGGAGACGGCGGATCTTGATCTGGCTGAGCTTGATAT CAAGAAAGCTCTCGAAATCGATCCAGACAACAAgtgagtaattttctattggtcctttgttt ttttcgttgcgatgtattctaatttccaacatgggtatgcacagGGAGGTGAAGATAGAATA TAAGAAGTTGAAGGAGAAGGTGAAAGAGTATAACAAGAAAGATGCTAAGTTTTACAGCAACA TGTTGTCGAAAATGCTTGAGCCACACgtaagtagtttcttaaaaaggagagtttcaatgggt aaaaatagggaaagctttattgagctgataatattctggtttgtatgaactgtgattgtgca gAAAGGAACTCAGAAGGAAGCACAAGCGATGAGTATTGACACCAAGGCATGAgtctttgaat cactttagagagtcgcattgattccaaaaactaaatgtgaaaagtctacaaatttctgtttt tactctttgtaatcaatcttggtgtgtgttactgtttcagagttgttataaaacagacttgt aataaacgaggatctactccaagttaatgaccccaatagcttgatatatcatatctagtagt tatgttct

SEQ ID No. 25 gene sequence wheat HSP70: TA62920_4565 DnaK protein, putative [Oryza sativa ( japonica cultiv^r-group) ]

ACGAAATCGAAATCAGAGAGGGGCAAAGCAAATCGCACCAGGCAAACTCAGAGGGTCTTC CGGCG75 ACCCCAAAGCGAGAGAG^GAGCGAGCGATTCCCAGGAGAGGAGAGGAGGCGGAG ATGGCCAAGGGCGAGGGGCCGGCGATCGGCATCGACCTCGGGACGACCTACTCGTGCGTC GGCGTCTGGCAGCATGACCGGGTCGAGATCATCGCCAACGACCAGGGCAACCGCACCACG CCCTCCTACGTCGCCTTCACCGACACCGAGCGCCTCATCGGCGACGCCGCCAAGAACCAG GTCGCCATGAACCCCACCAACACCGTCTTCGATGCGAAGCGGCTGATTGGCAGGAGGTTC TCTGACCCCTCCGTGCAGAGTGACATGAAGCTGTGGCCCTTCAAGGTCATCCCTGGCCCT GCAGACAAGCCCATGATCGTCGTCAACTACAAGGGTGAGGAGAAGCAGTTCGCAGCGGAG GAGATCTCCTCCATGGTGCTTATCAAGATGAGGGAGATCGCTGAGGCCTTCCTCGGCAAC TCTGTCAAGAACGCCGTGGTCACCGTTCCGGCCTACTTCAACGACTCCCAGCGCCAGGCC ACTAAGGACGCCGGCGCCATCGCCGGGCTGAACGTGCTGCGCATCATCAACGAGCCCACT GCTGCTGCCATCGCCTACGGCCTTGACAAGAAGGCGACCAGCACCGGTGAGAAGAACGTC CTCATCTTCGACCTTGGCGGTGGCACTTTCGATGTGTCGCTGCTGACCATCGAGGAGGGC ATCTTCGAGGTGAAGGCCACCGCCGGTGACACTCACCTGGGTGGGGAGGACTTCGACAAC CGCATGGTGAACCACTTCGTCCAGGAGTTCAAGCGCAAGCACAAGAAGGACATCACCGGC AACCCCCGCGCTCTTCGTCGTCTCCGCACGGCGTGCGAGCGTGCCAAGCGCACGCTGTCG TCGACGGCCCAAACCACCATCGAGATCGACTCGCTGTACGAGGGTGTGGACTTCTACACT ACCATCACACGGGCTCGCTTTGAGGAGCTCAACATGGACCTCTTCCGCAAGTGCATGGAG CCGGTGGAGAAGTGCCTCCGCGACGCCAAGATGGACAAGAGCACGGTGCACGACGTGGTG CTGGTCGGTGGCTCCACCCGTATCCCCAAGGTGCAGCAGTTGCTCCAGGACTTCTTCAAC GGCAAGGAGCTGTGCAAGAGCATCAACCCCGACGAGGCAGTGGCGTATGGCGCCTCCGTC CAGGCTGCCATCCTGAGCGGAGAGGGCAACGAGAAGGTGCAGGACCTGCTGCTGCTCGAC GTGACGCCTCTCTCCCTGGGTCTGGAGACCGCGGGCGGCGTCATGACGACGCTCATCCCG AGGAACACCACCATCCCCACCAAGAAGGAGCAGGTCTTCTCCACCTACTCGGACAACCAG CCGGGCGTCCTGATCCAGGTGTACGAGGGCGAGCGCGCCAGGACCAAGGACAACAACCTC CTGGGCAAGTTCGAGCTCTCCGGCATCCCGCCGGCGCCCCGCGGTGTGCCCCAGATCACG GTGTGCTTCGACATCGACGCCAACGGCATCCTGAACGTGTCTGCGGAGGACAAGACGACG GGGCAGAAGAACAAGATCACCATCACCAACGACAAGGGGCGGCTGAGCAAGGAGGAGATT GAGAAGATGGTGCAGGAGGCGGAGAGGTACAAGGCGGAGGACGAGGAGCACAAGAAGAAG GTGGACGCCAAGAACGCGCTGGAGAACTACGCCTACAACATGCGCAACACGGTCAAGGAC GACAAGATCGCCTCCAAGCTCGGCGCGGACGACAAGAAGAAGGTGGAGGAGGCGATCGAG GGCACCATCAGCTGGCTGGACGCCAACCAGCTCGCCGAGGCCGACGAGTTCGAGGACAAG ATGAAGGA^CTGGAGGGCATCTGCAACCCCATCATCGCCAAGATGTACCAGGGCGCCGCG CCGGACATGGGCGGCGGCATGGGCATGGACGAGGACATGCCGGCCGGCGGCGGCGGCGCT GGCCCCAAGATCGAGGAGGTGGACTAATTTGTTGGTCCGTGCCCGTGGTGGTCTCCGGTC TGCGCGCTACTTGATGGGTTCGCTGTCTCGGTG CCGTCCTTTGGATGCCGCTCGGTGGT GTCAGTCGTCTGTCGTTGTGTCATCTAGCTGGAAGTAGTAGTAGTCGTTCGATGGAGTCG TTGGTCTGAAGGACATGATGGATCATGATGTTTGCTTTGGTTTGGAACCCTTGAAGCTTA GAGCTTCTCGTTTTTAAGTTTGAATTTGGTGCTTCCCTACTTTTGATCTTTTCTGGCTCT GTTTTATTTTTGTTCATGTGTGGTTCTGTTT

SEQ ID No. 26 gene sequence Brachypodium distachyon HSP70 promoter .

Bradi2g23250.1

CCGGCTAAT CGTACCAAGC AAAACAGCTC TTTCCACCGC AAACCGCAGC AAGCGAATCG TTCGTGCACG AGTAGCAGAG GAGGAGGAGA TGGCGAAGGG AGAGGGGCCT iCGATCGGGA TCGACCL'GGG GACGACCTAC 1XTGCGTCG

GGGTGTGGCA GCATGACCGG GTGGAGATCA TCGCCAACGA CCAGGGCAAC CGGACCACGC CCTCCTACGT CGCCTTCACC GACACCGAGC GCCTCATCGG CGACGCCGCC AAGAACCAGG TCGCCATGAA CCCCACCAAC ACCGTCTTCG GTACGTGCCC TGTCCATCCC TCCTTGCTTA CACGCTTCGC CACCCTTCGT GCATGCGTGC CTGTGATTAT GACGTGGATT TCCGTGGGTT CTATGCAAGT ATCTGTCTCT TGAGAAAATT TGCTTTATGT AAACTGCTGT GCCATCTGTC TGTTGTGGTA TCTGTCCTGT TAGATTTATC AATTGTTAAG AGCAGGATTG CTGTTTTTCT TCACCCAATT GAGAAAAGGT TCAGAATACA CTAGTGTCTC TGTTGTAATC TTGAGATTGG TTCTGATAGT GCTTATGGCA TGTTCGATTA GATTGGTTAT GTAGAACTCC CTCCGTCCCA TTATATGGGG CACGCACGCC CTCCAAGATC ATTAATTTAA CCATCAAAAT ATAAGTTATA TGACATAAAA AATATATCAT TAAAAAGTTC ATTCGATTAC GAATCTAATG ATATATTTTT TATGCAGCAT AATTTATGAT TTGCTAGTTA AATTTGTGAT CTTGGGACAC GTGTGTGCCT CTTAAAATGG GACGGATGTA GTATTCTGAG ACAAACTAGG TGGTGATTTG TCCTGCCGTG TAATTCTGAA ATTAGAAAGC ATTGCTAGAA ATTATGTCTG TGGTATTCTG AAACTAGGTG GTGATTTCAT TCTGAAGCCA GGTAAAGATT TGTTCTGCTC TATGATTCTC AAGTTAGACA GCATGGCTAG AAATTATGCT TAAGACTGAC ATTTTCAAAT TTTGTGTGTT GAGACTGGAC TCAGATCCAT CATATCTGTA ATTTGAAATT AGCTGGTAAT TAGTTCTGCC GTACTGTTCT AATCTTGAGA TTGGTTCTGA TGTTAGTTAT GGCATGTTTG ATTAGATTGG TTCTGTTGTA TGCTGATGCT AGCTGGTAAT TAGTTCTGCC GTACTGTTCT AATCTTTAGA TTTGTTCTCA CGTTAGTTAT AGCATGTTCG ATTAGATTAG ATTTGTTCTG TTGTATGCTG ATGCTAGCTG GTAATTAGTT CTGCCGTATG ACTCTAAAAT TAGACAGCAT GGCCGAATTA CGAGTATGTC TGTAGTACTC TGAAATTACG AGTTCTGCTG TATGGTTCTC AAATTAGACA CGCATGGATA GACGCATGGA TAGTAATTTT GCTCTGGACT GAAATTAGTT TGTTAATTGT CTGTAGACAG CATGGCTAGA AATTTTGCTC AGGACTGAAA TTAGTGTGCT AATTTTGTGT CGTTACCTTA CGAAATGCGT CTCAATTGAA TCTGAATGCT CTGCTTTGAT TGCAGCGGTG AACAATCCCA ACTCAATGCA TTTGCTCTGT TTGTGTGTGC AGATGCGAAG AGGTTGATTG GTCGGAGGTT CTCTGACCCG TCCGTGC^GA GCGACATGAA GCTGTGGCCG TTCAAGGTCA TCCCTGGACC TGGCGACAAG CCCATGATTG TCGTCCAGCA CAAGGGCGAG GAGAAGCAGT TCGCGGCAGA GGAGATCTCC TCCATGGTGC TGATCAAGAT GAGGGAGATC GCCGAGGCCT ACCTGGGCAA CTCCATCAAG AACGCCGTGG TCACCGTCCC GGCCTACTTC AACGACTCCC AGCGGCAGGC CACCAAGGAC GCCGGCGTCA TCGCTGGGCT CAACGTGATG CGCATCATCA ACGAGCCAAC CGCTGCTGCC ATCGCCTACG GCCTGGACAA GAAGGCAACC AGCACCGGCG AGAAGAACGT GCTCATCTTT GACCTCGGTG GCGGCACCTT CGATGTGTCG CTCCTCACCA TCGAGGAGGG CATCTTCGAG GTGAAGGCCA CTGCCGGAGA CACTCATCTC GGAGGAGAGG ACTTCGACAA CCGCATGGTG AACCACTTCG TCCAGGAGTT CAAGCGCAAG CACAAGAAGG ACATCAGCGG CAATCCCCGT GCACTCCGCC GGCTCCGCAC GGCCTGCGAG CGCGCCAAGC GCACGCTGTC GTCGACCGCC CAGACCACCA TCGAGATTGA TTCTCTGTAC GAGGGCGTGG ACTTCTACAC CACCATCACC AGGGCTCGCT TCGAGGAGCT CAACATGGAC CTCTTCCGCA AGTGCATGGA GCCCGTGGAG AAGTGCCTCC GCGACGCCAA GATGGACAA'- AGCAGCGTTC ACGACGTGGT CCTCGTCGGC ,GCTCCACCC GTATCCCCAA GGTGCAGCAG CTCCTCCAGG ACTTCTTCAA CGGCAAGGAG CTCTGCAAGA GCATCAACCC CGATGAGGCG GTGGCGTACG GCGCCGCCGT CCAGGCCGCC ATCCTGAGCG GCGAGGGCAA CGAGAAGGTG CAGGACCTGC TGCTGCTCGA CGTCACCCCG CTGTCCCTGG GGCTGGAGAC CGCCGGCGGC GTCATGACCA CGCTCATCCC GAGGAACACC ACCAT CCCA CCAAGAAGGA GCAGGTCTTC TCCACCTACT CCGACAACCA GCCCGGCGTC CTGATCCAGG TGTACGAGGG CGAGCGCGCG AGGACCAAGG ACAACAACCT CCTCGGCAAG TTCGAGCTCT CCGGCATCCC CCCGGCGCCC CGCGGCGTGC CCCAGATCAC CGTCTGCTTT GACATCGACG CCAATGGCAT CCTCAACGTC TCTGCGGAGG ACAAGACGAC GGGCCAGAAG AACAAGATCA CCATCACCAA CGACAAGGGT CGGCTGAGCA AGGAGGAGAT CGAGAAGATG GTGCAGGAGG CGGAGAAGTA CAAGGCCGAG GACGAGGAGC ACAAGAAGAA GGTGGACGCC AAGAACGCGC TGGAGAACTA CGCCTACAAC ATGCGCAACA CCATCAAGGA CGAGAAGATC GCATCCAAGC TCGGGGCGGA CGACAAGAAG AAGGTGGAGG ACGCCATTGA CGGCGCCATC AGCTGGCTGG ACACCAACCA GCTCGCCGAG GCCGACGAGT TCGAGGACAA GATGAAGGAG CTGGAGGGCA TCTGCAACCC CATCATCGCC AAGATGTACC AGGGCGCCGC ACCCGACATG GGCGGAGGCA TGGGCATGGA CGAGGACGCG CCGGCGGGTG GCAGCAGCGG CGCCGGCCCC AAGATCGAGG AGGTTGACTA GGCTGTTTGG AGGTTCTTTG GTTCTTTAGT GTCGTTTCGT GGTACTCTAT CGTGTCAGTT GTTGGTCGTC GTCATATGGC GACCGTCGTA GTAGTTCGAT GAGGTTA T TTGGGAAAGA CAT'-AATGGT TTGGAACCG GTAGGAGCTT TTGTTAAATT TAATGGTGTG CCTCTTCTAT TCTGCTA

SEQ ID No. 27 gene sequence At4gl2480

gggatatcaattacacatacgacgcacacagtttactctttaaaataatc acagtttgaataattgcatgcatgtatgcaagttaagggttcaatgtttc aatcttttgtttaagtgtgaggcgttatctttttccgcgcatatatgttt ttgttgtaacttttattgtttaaatgaaagacgtttcatagtccatttta tttgttgtcaaaaaaagaaaaaaaaagcgtctagtattcaaatatttcat gtaattttctgtatacaaatattttcctttataattttggatgagaatat ttcgtgtatatttaagccaaattgacaaaatgaggttctgagtagaatcc aaaactaaaatctagtcaaactacgatatttatgacagttctatagccag ctgcagctttttgttgtactagttactataccttccaatcaatgaaatca agattgtatgatttgatatttctccaaaactgtagtgtagttgaacatac caatgattaattctttgttcagcctttgataatcaaaatttaaacttgat tggagatattgaaatttccgaagaagatagtatgctacatttactactta taggcctacgactttggaccgaacggttctggttcaatttggatagtcgg tttttgagtaattcggttaggaggtaaggttatttaataaaacggaatna aaatttggttcggttatcggttaatttcatacggttatttatctaagatc cataagaatttaggttcggtttggtttgaaaaaattttaagaaaagtttg tacaattt i.gtaaaatctggtttaa : cagtaatattggttagaaaaatta gagaaaataactcaaaccctcaaattctggtttggttcggaaaacccaat ttggtttgtaacagtaaatcgttttacttggagacgtcttctagttggag agcgcaattcaaaagagtggtaattgcaaattaaggccttgaatggatgc agtttttaggatagtttttagattttgattttgcaaaaactaaatattta tcaattcatgattttaaaaaaagtagatttttagaaaatagggaaaccag attttagaagattttgcttatttcttcaaaaaatccaaaaaccaaatttt gtaggttttaaaaaacatttacgtgacatttttttttcaattttgtttat tattttaaatgttacttttaccatttatcaaattattcaaaactaaaaac gtttgaaaaataataattatgtcaaaaacctaaaaactaaacaaattact attcaatattttgcaaaaactaaaatctatatcaaaaatcaaaaactaca aaaatcagaaaccaaaaactacaaaccaaaaactaaaaacccataaaaaa ctataaaacatttatggcctaatttttggcgtagcattttgttttaataa gcagtttcatagttgatcatgcaaatatttatagttatgaaatgaattgg cgttaaagcatgttgaataatagttactgtgaaggtataaaatagatata tgcacagtaaaaccttatatatatatcactgttttatttttttcttgtta ttggtttctttttaagaagttccaaatgttattttaattgagttttatat atttttgtcctaacattgctaaaaaaaaaaagatattttctttcaggaca aaatttattattgacttttataaacattatatccagccttttccggaaaa tcaaatgattctgct ctctaaaatattcatatgttcacatcttagtttc attcatgtttaattttggttataatacccataatttagattcctttgttt ttttatatgtgaacatattttctcaaagttagttctacatctaaatggaa cagaaaataacattggattgattttaaataacagcagtttatcaaattag gaaactaaactaactatcgtgtaaaccttcttagaattattaagtaaatc gccggatcactctattctctcgtggatgtcatctcacgggttgttttagc caaccgcaaacctcttcttcatcgaactttgtaatttcaaatctcaaatg caagaaataaatcaatacaaattgttctaaccaacattggaaaaaaaaat tgagatgttcttgtctaaattctcttgcaagttgggattagtcatatata atccatatgagatctaatttgtattcatactgtttgctttacgtcacaaa tgacacaaccatgcatatagacaaacctgattcatccagggctttgatgt c . tcttatttatgcataa ggatccaaaattttg > ^aacattcacattg aacatttttttccgaggaagttcgagaattttgttagcatgtcttcctct tctgggaccagtttgtgataaaacacatcctctcggaaaagagtgtagag cacaacttcctctcgaatgtactaagaccactagactaacgtatagaagc tctcaagtaaaatggctacgatccaaagagaatctgaaggtatgtgcaat gaggtcatgaaccatcatgatggtggtgataataacagattaacagcatt gacaatttgaaaataatagtaatatgaacgcacaaatcatatttatttct taaatagaaatgttttacaaaaacgattaatgtctaaattaattcaaggt tctacgaatctacataaaggaaagtagaaaggtcagaatttgtatatgta gataagggcaaataaataaataaacagatattttgtagaattgcaaatat atgtgaataatcaaatataatagaacaagttggtcctcttcacatccttc taaaaccctataagtacccacaccctctcttcatatatcttcatctctca ctctctcaaagacactgaataaatccttaaaacaaacttttgaaagaaaa aaATGGCTTCAAAGAACTCAGCCTCTATTGCTCTTTTCTTCGCCCTTAAC ATCATATTCTTCACCTTAACCGCTGCAACAGATTGTGGTTGCAACCCAAG TCCTAAGCACAAGCCTGTCCCAAGTCCTAAACCCAAGCCGGTCCCAAGTC CCAAACCCAAGCCGGTCCCAAGTCCTTCAGTACCAAGTCCTTCGGTCCCA AGTCCTAACCCTAGGCCGGTCACGCCTCCGAGAACCCCTGGCTCATCTGG AAACTGTCCTATCGATGCTCTCAGACTCGGTGTATGTGCGAACGTTTTAA GCAGTCTACTCAACATTCAATTGGGTCAGCCATCAGCTCAACCATGTTGC TCGCTCATCCAAGGTTTGGTTGACCTCGACGCTGCCATTTGTCTTTGCAC TGCGCTTAGGGCTAACGTTCTTGGTATCAACCTTAACGTCCCGATATCTC TCAGTGTTCTTCTCAACGTTTGTAACAGAAAGGTTCCGTCTGGCTTCCAA TGTGCTTGAaggatatcagctatgcatacgatgtgatgcccgtgcacaaa tatcttcttcgaaattgttacagtatgaataaatgcatgtaagctataga gtttatgttttaaattttgaatttgttaaagtgaaataaccaatgtgtga gagtgagactttcttagttttttttttccgtcaacgttcctgtattccgg tcttgtatgcttt gtagcaatctattact..tttcaacccgtttaa†" "\a aagagattttgtactcattttcaaa

SEQ ID No. 28 gene sequence At4gl2470

aggatatcagctatgcatacgatgtgatgcccgtgcacaaatatcttctt cgaaattgttacagtatgaataaatgcatgtaagctatagagtttatgtt ttaaattttgaatttgttaaagtgaaataaccaatgtgtgagagtgagac tttcttagttttttttttccgtcaacgttcctgtattccggtcttgtatg cttttgtagcaatctattactattttcaacccgtttaataaaagagattt tgtactcattttcaaattcttgcgttacaaattataatttaaatctttaa attgacatattcattctgtagaatacgtttttttttgtttacgaaatagt tgatttctgcttaagaaaaaactattgatcattgtacgtgatattaacct aacgat acatatctcgagcttagtttgaattttccctttaaaccatgat cttccgtaatctaaaactgtatttaaaacattaaattatgagtggaccat tatcaaccaaacataagttgatttgttcttcctttttttttccgggtgaa atacggtttgagtgatcatgtttatgtggtttcattaaatcattagccca agaccgagagatcttgaaaaataatatggatggccatgaacccattttta gctaaaactttgaaccggaaatcaagtctttgcctaatctattttatcca tgaatgagcggtactgttgaagaagtgattcgtttagaactccggttaac tcggtttagattaaaacataaccagaaaacgggagactggttaatgcggt atcgagggttaagagagagcctcttattcggatgaagggtttactattat aagaattggatataagagcttgtaactctgcttcttcttcctctgttttg aaactccatcatcacgagttcaagaacttgtagagtaaagctacgcatgt tgtatattcttgatagtgaattaactgaactcgatcaacacatgaggtga ttactgattagtaaattttcaacaactttttatgaacgttaaatatatct gtcaatatcatctagaattacttgatggaaatttaaagaaaatgtttttt gttttgttttgttatcatcagttttaacattcataccaatagaagttcat gttcggggttttatgacccgtgatgatgtgaatgtgagttacatacatta agctcaatgacagacgcaaatggatgtatgtggggacactggaaaatttg gagtcttgcaaaagatattttacaaatatagtcgcaaagaatgaatcata gaacggaacaagatggtttacagt ^taatataatctagtactgtaaatt gaatgacaattagttttattactcggaaatgttaagagaaaaacgtacca aaatatgagcataataacttactaattcgaaaaatttaaagtttcgtaat t ictaatcgtataccata .aataaatctaacaacai;tgagaaataacttt taaaaacgttatctatgtatagtagttattttcttaaatacaactactaa aacaaaatatcattatatgctatatatctagctcttatataatactagat aaggcccgtctaaataggcgggtgtaagatgtaactgtaattttttatcg ataatatttaaattttgaatagtaaaataataatctatacattgttcttg atatataattttgaatagtaaaatagtagtcttatgcattttattttatt atacccattcaatcttattgatgatatttgaagtctaaatagtaacctac acactttttctttattataatttagtatttagaagaaaaaaacaaatttt tatcttacatattcaattttgtatacaatttaactatctatttcataaaa aactcgattttaattctacacacttcatcttacttgataatgatttcatg tcaaaataatatatatatgagatcaaatctatatcttagttaatattaaa aattattaacaattaacaaaccataaataataataataaattttttttta ataccatacatattaaaaatttgaccaataacatatataaatatttttgg ttaatttttcttttggttaagaaaaacaaaatgtaatattttttagatat agtcatatagacatataaattagtatatgttaataatgatttatttttta gttttctatttctttaagaagaaaaaagttaattgatttcttttttagta tttctatttctttaagaagaaaaaagttaattattttcttacacgtgtca acatctgatcgatagacttgacacatggcataatcttatgagttagtaat tttaaaaaccatactttatataataagatatatgaaacttttaaggtacc tttagattcactgaagatttgtttcaagaaaataattatttttttcttaa accaaattgatgtttttgtatataaaaacgaaaattactacagatagttc tgtttttatttctctatcataaacgtagttattgttgatcttcaatgtac actacatcaaacttaaccctaaaagtaaaaactatactgcaaatcctaaa cattaaatttgaagctacaaatcctaaaccctaactccaaaagctaaaac ttgaaacacacaaagtttctttacgtacatctattagatatcgataggac ttgacagtgacaagttcatgtatacatgcactatcatatagttataactt ctaaggtactatatcgcaatttgcttgtagtttgacaaaacatgcaaaca atctcttctttttga<~ ^aacgtcgtgaaaaaatgtttttttttgttctt tatgatgaggaggattcaacgaattcttacaaaaaaacgaaaatgagcga ttaggattaatcagtcgtcatcgggttgactttatttggaaccactaata tttttgcttatatttggacctcacagag cacagcgtcaattcct gta aactcgaaacatatttagaaattataatcgtcaacatctaacataagacg attcttatggatgaataatgttgagtagaaatataaaatatctagtctta gccgacaacaaacacgtctttgagctcagccaaaaataaaaatatgaatt taaattattgtattaatgttacttactgagaccaatatacatacacgaag ggttcaaaccgtacaatagatatataggattttgatagttacatattaaa cgtttacataatgaattgcttaatacacattattgattattgtgtggcct caatacacgcaatcgcctcattgagcagcataccaaaaccgtctcggcct tttttcccagtagatcatatatgaagttatatacatatgcatatgaccat gaagttatttaaggcatgcaagacatatatagttgtttcggtgtatacaa gactcataaatggatgtatctaggtgaaaaccacttggtggggattcaat caagaatcaaagatgaaatgttcttttgggacgaatagtttttattgatt ttgagaaacagtaaaccagctcaacgacagaagcaaatggatgtatgtgg ggacactaccaagaatcaaaatgttaaaatgttaaaatttcgtagttctt tatatataattaaacatatttgttctcaaaccatggtttgatttaaataa ttaaatcatgaaactaacctaactatttagtaaaccatgttaaaaaaaaa taacaaaaaaaaacaatcaaaattgatgagttgcggtttccatgatattg tcctagttaattgctcgaccgctctgttttaaccttttgcatagagaaca aatttgtgggttcttgatacacacccctaaaaaccgaatcatgtaggagg attttaatgtcttcataatttatgcattaaagaatcttaattaaattcat aaacattacatatatattaatcatatattatatacatatcacaaattttc gagtaagtttctaaatactttgggtgtgtctccatggccgggctcagctt gattataactacactaggaatttattatattactcgacctgacgtataga agccgtcaagtaaaagagctacgaaccaagataaatctgaatatcttgtg catccacgaactcatgatggtgttgataataacagcattgacaacttgac attaatacttatatgaatgcacgtatatataaagtattttcttaatttta aaatggtttacaaaaaacaaaatccaaataatttcaaggttctacgtacc tagct "icatgcatataggaaaaatggtcagaatttatat tatatatata tatatatacaaataattacaaatatctataaataaattttaaactaaatc aagttggtcctcttcccatccttctaaaatcctataaataccaacatctt ctcttcatatctatttattcaataacccttacaacaccgaatataacttt gaaaaaaaaaacaaATGGCTTCAAAGAACTCAGCCTCTCTTGCTCTTTTC TTTGCGCTCAACATCCTCTTTTTCACCTTAACCGTTGCAACAAATTGCAA CTGCAAGCCAAGTCCTAAACCAAAGCCAGTCCCAAGTCCTAAGCCCAAGC CGGTCCAATGTCCTCCTCCACCCCGTCCTTCAGTCCCAAGTCCTAATCCT AGGCCGGTCACACCTCCACGCA cCCTGGTTCATCCGGAAACAGCTGTCC TATTGATGCTCTCAAGCTCGGTGTATGTGCAAATGTCTTAAGCAGTCTAC TCAACATCCAGTTGGGACAGCCATCCTCTCAACAATGTTGCTCGCTCATC CAAGGTTTGGTTGACGTCGACGCTGCGATTTGTCTATGCACTGCTCTGAG GGCTAACGTTCTTGGTATCAACCTTAACGTTCCGATATCTCTCAGCGTTC TTCTCAACGTTTGTAACAGAAAGCTTCCATCTGGTTTCCAATGTGCTTGA

gcaatatccattatgcatacgatgcgatgccagtgcacaatatcgtcttc gaaatttattatagtttgaataaatgcatgtaaggtatagtttatgtatc aatcttaatttgttaaagagaaaaaataaatgtgtgagatttttatagtt tttcattttgtttgtaaacgttgtcccccgccttccaagctttgtatgct tctgtagcaatctatttctatttctatttcaacgaaattttaatgaaaga aatttcgtaagc

SEQ ID No. 29 gene sequence AT4G34950

cgtcgtagatgattcgtgttttgttttgtgatatgataacgggcctaaat aacggctaatgggccattatcttatgctgttttcaattactattgaatca aatatgggcttttaatcactgtttctaaatttacgcaattttgtttagtt atatatttttgcgttccttagtaggctttgatctgaagaaacagatatct gatattcattactactttcttagttttcctattttgtcggcaaaatcatt attttggtagttcaaacttttaggtctctggttcaaatgtaaactaaatt gacactcgtgtggctggtaggtgagatattttgttagaacattgattatg ttatttcattacttactgcgaaacaaatcttgagacataaaattgcactt tgcaaaattacaaat'gatgcgagtggcaaatggcaatttttagacaact taaatgctgtcacttaactatgattccttcggacatttaaattttaactt atgttttttaatcacgaagtagtaggtcgtttatcttaatatctcatgtt caggaatgaattcgagtatcaagaatattgcatatacgcacccaacgtgt tttttattaaccatcgccaataaagttaccacaagcttagataaatagaa acacaaatcaatatatatatatacattcggatccattccaaaaactcgtt aagaaaataattaaagagtgaatttcaaagttatctttacaataagaaaa ttcaaatcaataagaatatttcaatagtctagagacatgtttagtcccac ttttaattaaagcgatagttactcatttcttttatgttgtttgctactag tacatgctattatcttttttattttattaaatatttttgtccttcattct caaccgttgccacattttctttgttaatgatcattatattattattatga agtcgtttttggaatcctacaacattaacatacacaaatgtctttttgtg ataccatacaaataatttgtttttctaaaacaaacaaaaaaatatctttt gtgataagcaaattgtgaatctgtgataacctcgcccacaaatcatatca cttattcgacaatttgtgataatttagcccacaatatttatgcactagct gatagaaagaaacatatccttatcactcacttactgtataaaatcccgga ttggccccatcaaatatacatcgctcttatcattaaccacatctggcaag tggtttaagctgtcaaatacaacacgactttgttgaacatatttttgttt ctcaatctgtaatccaccgacgttcattttttggttaatcttttgtctgc tgatctgatcatgtaaacctgacggaatcgaataacatatataactcaat ctaattatgcaatgcaaaacaattatttgtgaataactcatttttaaccc gttgaaagaaatgatggttttttaaagatacatgcaacctttaatctcct ttattcatgcgtgtctgaatttgtatcacaggatagagtaacttacgaat tttcttggattagattattagaacttcattttgccaaagaaaatattgct tacataataataaggaggcggctaaggataacatgaattacaatcgctat acaacacat aattattacactttttgttcttcttaaaaataaatgttatc cagctatattttcatccagcaaagccgtcaggcgttgtcgataagcttca aaaaaagaactgatgaaattccgaaattcctcctccatattagcgtacgt tacgttttatttaatttattttgcaaatgatattttcttcacttccagtt atttttttatttttttaatt - ":tagagtaaaaaaagatttattggcactc taatttttgacggttaacacacatatactgcaattatgtttaacaaaact aaaccgatcgatgaaatattctttacttggtcgatgaaaatagttgtctc atccgatgatccgaatgactctttccaagttggtaccttaaattgtggta tctgctgta tccatacgaaagtaaaccgcggaataactaaattcttaaa ccatctttatcagaacaaagcaactaatctgcaaaattgtcagtgttgca agctataaatgttccgtacaagctacaaataaagaaatacaaggcttagc cgatgtgaaacgtacgttagagttgtacacgatatgttttgtgtgaattt gataaattcaaaaaaaaaattgttgtacaccttgatcctagtcatgctgg ttggtgtatattaatatattatatcagaaagtgactgtcattctatttta atgtgatat ttacggtcaaagacatgttgcatgtaattgcgcgcgcaatg tatacgaccattttttgatgaagtaactcagcgggtaaacattctatcac tttccattt cattggtaagtacaatattggattttcttttgtggtatgca ctagtcggtatcagtcccgagatgtaattagagaaatatttgtaactaga acttttttccaactctttcgaatttttttttttttttttttttgccgtag atttggaat atgattctaacagaatatcaatacaatatagcaactttggc tcactggtcactgcttcataacatgataacaaaactctcaagcaactact ttcatctgaccctttttatgtcaaaaaaggtctttcgtctgaaccgaaaa tcaaaccgagttggaagcttctagcaaagataatgagccgtactagtcac aactcacaagtcacactttcgaatttcaaacttcaattgaagatccgaat atccactgccgtagtttgtacgatactttcactcatttcatgttgtcatg tgtcgtacaacagtttccagtttcccattattatttaatgtttatttatt aatatttggactttaattacggcaggttatactatatggtatgatagaat attttcttcattccactggattttgctaattatatatatttattccaaat cacaattttgatttatcgtcattacaaaaactaaaaagtaatgaccaaaa taaaagatatgtaatttcagatattccgttctaactattctattctcttc ctgattccattaccaaacactgagagacaaataagctactggccgctaat tggctatcgctctctttacatcttcgaacataagcaatagttgaaaaata taactttactaaaaaaatacatatttttcgttaaaaaaaaccttgtggtc gtctatatactattctaataagtaaaaaaaaaaaaaaaaagtaacggaag catgaactttcatgcctggaagaaactactggccaaaaccatccactaaa tacaactaatgaagtaatcatcctagttgagcatattgtaatcatcacat tcaagaaaaatatcccatggagaacaattttgcattatataaaaagttaa ttccttgtcgacttttatataacaca ..acaagaaggagcacat gtaaat tcatcaccgcttctacaccttcaccgtacgtgtctctttcgtactttctc actatttgtcattctaattataaagtacaaaaaaatcaatagtttaatta ttaaattaatattaaaaataaatactttctactaaaagtctaaaatatta taacatcgaagttgcgaaaaataaaataaaataaacgtaacatttcacct ttaaaaccgtacgc 'agtgctcaacgaacccaaacacactctaaaaata tcttctttctccttcttcttcattcttctcaatatctcctaATGGGTTTT GGTACATCTTCTTCTTCATCTTCTTCCTCAGCTCTGAAATGGCTAGGTTT CGTTACTGCCGTTTGGGTCCAATCCATCTCCGGCAACAATTACACCTTCT CAAATTACTCCGGCGCACTCAAATCCTTAATGAACCTCACTCAGTTAGAA CTCAACAGTCTCTCCGTCGCTAAAGACGTCGGAAAAGCATTCGGAATCCT CGCCGGACTTGCTTCCGACCGTCTTTCAACTCCGGTGATCCTCCTCATCG GTTCTTTCGAAGGTCTTCTTGGTTATGGTGTACAATGGCTTGTCGTTAGC CGCACGATTCAACCTATACCTTATTGGCAGgtacttaatcaaaccctaat ttctaaattgaaaaccctaatttgcctcaattttgacggtcactgtttct tgtgtgtagATGTGTGTGTTTCTCTGTATGGGAGGAAACAGTACGACGTG GATGAACACGGCGGTTCTGGTTACTTGTATAAGAAACTTCCGGCGAAATC GTGGTCCTGTTTCAGGGATTCTTAAAGGATACGTTGGTTTAAGTACTGCG ATTTTCACGGATCTATGTAATGCTCTGTTTTCCTCTGACCCAGCTTCGTT TCTTGTCCTCCTCTCCGTCGTGCCTTTTGC GTTTGTCTCACGGCGGTTT TCTTCCTCCGTGAAATCCCTCCGTCTACTACCTTCGCCGAGGATAACGAA GAGTCTAAATACTTTGCTGTGT TAACATCGTTGCGGTTGTTGTTGCTGT GTACCTTCAGTCTTACGACATCATCGGAATCAAAACAGGAGCTTTCTCAA TCGCATTCGCTTCCATACTTCTCATACTCTTAGCCTCTCCTGTCGCTGTA CCTTTCCACGCTTTTATCCGTAGCAAAGTTCATGATGAGCAAGACGTAGA AGGACGAA AGATGAACCTTTACTAAGATCAGGATCTGAGATTGAAGTGG AGGAAACAATCGTAGGTGCTGCAGCGGCGGCGGATAACGAATTGCCACCG TCTCTTAAGCCGTTAAGTAACGAGGAGGAAGAGAATCAr'GGAACTATAGT GACGACGGAGAAGAAAAGACCGGTTCTTGGAGAAGAACACACCATAATGG AAGCTATGTTGACCGTTGACTTTTGGGTGTTGTTCGTGTCGTTCTTGTGT GGAGTAGGAACTGGTTTAGCAGTTATGAACAATATGGGTCAGATCGGGCT TGCGCTTGGTTACACTGATGTCTCCATTTTTGTCTCCATGACTAGCATTT GGGGATTCTTTGGTCGGATTCTCTCCGGTACTATCTCCGAGCACTTCATC AAgtaagtcactttactaacatagatcatcgtgacttggaatattcttat tgatcactttacgcacacgcattcaaatgcaaatttattctgtgaatggt gatgtcagtttcctctgtttcacctttgctttgtcgctaaggcagagtat attactttcctcttccgttacttagaattgaatattttccatttacatga tatttcttttaacgatttttcaattaaagcttgacatgttagtttccata tggagaaatttccttgtctaacactagaccggtccaatagcttgtgcggg ggaccataacatactttttgcgctaaaatatctttttagattttctttcg tctttatttgaaaactaaagatcgtgggaccttgaataatatttgctatt gagactaatcttgaatatttgttttaactttatagGAAAGCTGGAACACC AAGACCATTATGGAATGCAGCAGCTCAAATCATTATGGCCGTGGGATATC TACTGATGGCTTTAGCCTTGCCCGGTTCACTCTATATTGGTTCAATGGTG GTTGGGGTATGCTATGGAGTTCGGTTAGCGATAACCGTACCAACAGCATC AGAACTCTTCGGTCTCAAATACTATGGACTCATCTACAACATCCTTATAC TTAATATGCCTCTAGGATCGTTCCTCTTCTCGGGTCTACTCGCGGGTTTA CTCTACGATGCTGAAGCCACACCTACTCCTGGTGGAGGCAATACGTGTGT AGGAGCTCATTGTTTCCGTATCGTCTTCATTGTAATGGCGTTTGCTTCTA TCATTGGGGTCGGTCTTGACCTTTTGCTTGCGTATAGAACCAAGGGGATC TATGCGAAGATTCATGCGAGCAAGAAGACTAAGAAATCTGGTGGTAATCT TCGATGAgagtggattttgcttttggtgaaaatcattttttgggtatctt tagttctatagtaatatgtagatttcttgtgtctattttcgaaagaattt ctatgttccatatcaaaggaagggatgattgtatgtactacacttatgct tactattgttaaagccggttggttaagtgtgcttaaccagctagtatggc ttaaagttcagaaaatgggatgtcaataatctaca

SEQ ID No. 30 Atl2480 promoter sequence gggatatcaattacacatacgacgcacacagtttactctttaciaataatc acagtttgaataattgcatgcatgtatgcaagttaagggttcaatgtttc aatcttttgtttaagtgtgaggcgttatctttttccgcgcatatatgttt ttgttgtaacttttattgtttaaatgaaagacgtttcatagtccatttta tttgttgtcaaaaaaagaaaaaaaaagcgtctagtattcaaatatttcat gtaattttctgtatacaaatattttcctttataattttggatgagaatat ttcgtgtatatttaagccaaattgacaaaatgaggttctgagtagaatcc aaaactaaaatctagtcaaactacgatatttatgacagttctatagccag ctgcagctttttgttgtactagttactataccttccaatcaatgaaatca agattgtatgatttgatatttctccaaaactgtagtgtag tgaacatac caatgattaattctttgttcagcctttgataatcaaaatttaaacttgat tggagatattgaaatttccgaagaagatagtatgctacatttactactta taggcctacgactttggaccgaacggttctggttcaatttggatagtcgg tttttgagtaattcggttaggaggtaaggttatttaataaaacggaatca aaatttggttcggttatcggttaatttcatacggttatttatctaagatc cataagaatttaggttcggtttggtttgaaaaaattttaagaaaagtttg tacaattttgtaaaatctggtttaatcagtaatattggttagaaaaatta gagaaaataactcaaaccctcaaattctggtttggttcggaaaacccaat ttggtttgtaacagtaaatcgttttacttggagacgtcttctagttggag agcgcaattcaaaagagtggtaattgcaaattaaggccttgaatggatgc agtt tttaggatagtttttagattttgattttgcaaaaactaaatattta tcaattcatgattttaaaaaaagtagatttttagaaaatagggaaaccag attttagaagattttgcttatttcttcaaaaaatccaaaaaccaaatttt gtaggttttaaaaaacatttacgtgacatttttttttcaattttgtttat tattttaaatgttacttttaccatttatcaaattattcaaaactaaaaac gtttgaaaaataataattatgtcaaaaacctaaaaactaaacaaattact attcaatattttgcaaaaac†"•laaatctatatcaaaaatcaaaaactaca aaaatcagaaaccaaaaactacaaaccaaaaactaaaaacccataaaaaa ctataaaacatttatggcctaatttttggcgtagcattttgttttaataa gcagtttcatagttgatcatgcaaatatttatagttatgaaatgaattgg cgttaaagcatgttgaataatagttactgtgaaggtataaaatagatata tgcacagtaaaaccttatatatatatcactgttttatttttttcttgtta ttggtttctttttaagaagttccaaatgttattttaattgagttttatat atttttgtcctaacattgctaaaaaaaaaaagatattttctttcaggaca aaatttattattgacttttataaacattatatccagccttttccggaaaa tcaaatgattctgctactctaaaatattcatatgttcacatcttagtttc attcatgtttaattttggttataatacccataatttagattcctttgttt ttttatatgtgaacatattttctcaaagttagttctacatctaaatggaa cagaaaataacattggattgattttaaataacagcagtttatcaaattag gaaactaaactaactatcgtgtaaaccttcttagaattattaagtaaatc gccggatcactctattctctcgtggatgtcatctcacgggttgttttagc caaccgcaaacctcttcttcatcgaactttgtaatttcaaatctcaaatg caagaaataaatcaatacaaattgttctaaccaacattggaaaaaaaaat tgagatgttcttgtctaaattctcttgcaagttgggattagtcatatata atccatatgagatctaatttgtattcatactgtttgctttacgtcacaaa tgacacaaccatgcatatagacaaacctgattcatccagggctttgatgt cctcttatttatgcataagaggatccaaaattttgaaaacattcacattg aacatttttttccgaggaagttcgagaattttgttagcatgtcttcctct tctgggaccagtttgtgataaaacacatcctctcggaaaagagtgtagag cacaacttcctctcgaatgtactaagaccactagactaacgtatagaagc tctcaagtaaaatggctacgatccaaagagaatctgaaggtatgtgcaat gaggtcatgaaccateatgatggtggtgataataacagattaacagcatt gacaatttgaaaataatagtaatatgaacgcacaaatcatatttatttct taaatagaaatgttttacaaaaacgattaatgtctaaattaattcaaggt tctacgaatctacataaaggaaagtagaaaggtcagaatttgtatatgta gataagggcaaataaataaataaacagatattttgtagaattgeaaatat atgtgaataatcaaatataatagaacaagtf -gtcctcttcacatcct "".c taaaaccctataagtacccacaccctctcttcatatatcttcatctctca ctctctcaaagacactgaataaatccttaaaacaaacttttgaaagaaaa aa

SEQ ID No. 31 Atl2470 promoter sequence aggatatcagctatgcatacgatgtgatgcccgtgcacaaatatcttctt ' cgaaattgttacagtatgaataaatgcatgtaagctatagagtttatgtt ttaaattttgaatttgttaaagtgaaataaccaatgtgtgagagtgagac tttcttagttttttttttccgtcaacgttcctgtattccggtcttgtatg cttttgtagcaatctattactattttcaacccgtttaataaaagagattt tgtactcattttcaaattcttgcqttacaaattataatttaaatctttaa attgacatattcattctgtagaatacgtttttttttgtttacgaaatagt tgatttctgcttaagaaaaaactattgatcattgtacgtgatattaacct aacgattacatatctcgagcttagtttgaattttccctttaaaccatgat cttccgtaatctaaaactgtatttaaaacattaaattatgagtggaccat tatcaaccaaacataagttgatttgttcttcctttttttttccgggtgaa atacggtttgagtgatcatgtttatgtggtttcattaaatcattagccca agaccgagagatcttgaaaaataatatggatggccatgaacccattttta gctaaaactttgaaccggaaatcaagtctttgcctaatctattttatcca tgaatgagcggtactgttgaagaagtgattcgtttagaactccggttaac tcggtttagattaaaacataaccagaaaacgggagactggttaatgcggt atcgagggttaagagagagcctcttattcggatgaagggtttactattat aagaattggatataagagcttgtaactctgcttcttcttcctctgttttg aaactccatcatcacgagttcaagaacttgtagagtaaagctacgcatgt tgtatattcttgatagtgaattaactgaactcgatcaacacatgaggtga ttactgattagtaaattttcaacaactttttatgaacgttaaatatatct gtcaatatcatctagaattacttgatggaaatttaaagaaaatgtttttt gttttgttttgttatcatcagttttaacattcataccaatagaagttcat gttcggggttttatgacccgtgatgatgtgaatgtgagttacatacatta agctcaatgacagacgcaaatggatgtatgtggggacactggaaaatttg gagtcttgcaaaagatattttacaaatatagtcgcaaagaatgaatcat gaacggaacaagatggtttacagtactaatataatctagtactgtaaatt gaatgacaattagttttattactcggaaatgttaagagaaaaacgtacca aaatatgagcataataacttactaattcgaaaaatttaaagtttcgtaat tactaatcgtataccataaaataaatctaacaacattgagaaataacttt taaaaacgttatctatgtatagtagttattttcttaaatacaactactaa aacaaaatatcattatatgctatatatctagctcttatataatactagat aaggcccgtctaaataggcgggtgtaagatgtaactgtaattttttatcg ataatatttaaattttgaatagtaaaataataatctatacattgttcttg atatataattttgaatagtaaaatagtagtcttatgcattttattttatt atacccattcaatcttattgatgatatttgaagtctaaatagtaacctac acactttttctttattataatttagtatttagaagaaaaaaacaaatttt tatcttacatattcaattttgtatacaatttaactatctatttcataaaa aactcgattttaattctacacacttcatcttacttgataatgatttcatg tcaaaataatatatatatgagatcaaatctatatcttagttaatattaaa aattattaacaattaacaaaccataaataataataataaattttttttta ataccatacatattaaaaatttgaccaataacatatataaatatttttgg ttaatttttcttttggttaagaaaaacaaaatgtaatattttttagatat agtcatatagacatataaattagtatatgttaataatgatttatttttta gttttctatttctttaagaagaaaaaagttaattgatttcttttttagta tttctatttctttaagaagaaaaaagttaattattttcttacacgtgtca acatctgatcgatagacttgacacatggcataatcttatgagttagtaat tttaaaaaccatactttatataataagatatatgaaacttttaaggtacc tttagattcactgaagatttgtttcaagaaaataattatttttttcttaa accaaattgatgtttttgtatataaaaacgaaaattactacagatagttc tgtttttatttctctatcataaacgtagttattgttgatcttcaatgtac actacatcaaacttaaccctaaaagtaaaaactatactgcaaatcctaaa cattaaatttgaagctacaaatcctaaaccc aactccaaaagctaaaac ttgaaacacacaaagtttctttacgtacatctattagatatcgataggac ttgacagtgacaagttcatgtatacatgcactatcatatagttataactt ctaaggts-. tatatcgcaatttgct '; jtagtttgacaaaacatgcaaaca catctcttctttttgacaaacgtcgtgaaaaaatgtttttttttgttctt tatgatgaggaggattcaacgaattcttacaaaaaaacgaaaatgagcga ttaggattaatcagtcgtcatcgggttgactttatttggaaccactaata tttttgcttatatttggacctcacagagtcacagcgtcaattcctacgta aactcgaaacatatttagaaattataatcgtcaacatctaacataagacg attcttatggatgaataatgttgagtagaaatataaaatatctagtctta gccgacaacaaacacgtctttgagctcagccaaaaataaaaatatgaatt taaattattgtattaatgttacttactgagaccaatatacatacacgaag ggttcaaaccgtacaatagatatataggattttgatagttacatattaaa cgtttacataatgaattgcttaatacacattattgattattgtgtggcct caatacacgcaatcgcctcattgagcagcataccaaaaccgtctcggcct tttttcccagtagatcatatatgaagttatatacatatgcatatgaccat gaagttatttaaggcatgcaagacatatatagttgtttcggtgtatacaa gactcataaatggatgtatctaggtgaaaaccacttggtggggattcaat caagaatcaaagatgaaatgttcttttgggacgaatagtttttattgatt ttgagaaacagtaaaccagctcaacgacagaagcaaatggatgtatgtgg ggacactaccaagaatcaaaatgttaaaatgttaaaatttcgtagttctt tatatataattaaacatatttgttctcaaaccatggtttgatttaaataa ttaaatcatgaaactaacctaactatttagtaaaccatgttaaaaaaaaa taacaaaaaaaaacaatcaaaattgatgagttgcggtttccatgatattg tcctagttaattgctcgaccgctctgttttaaccttttgcatagagaaca aatttgtgggttcttgatacacacccctaaaaaccgaatcatgtaggagg attttaatgtcttcataatttatgcattaaagaatcttaattaaattcat aaacattacatatatattaatcatatattatatacatatcacaaattttc gagtaagtttctaaatactttgggtgtgtctccatggccgggctcagctt gattataactacactaggaatttattatattactcgacctgacgtataga agccgtcaagtaaaagagctacgaaccaagataaatc'-gaatatcttgtg catccacgaactcatgatggtgttgataataacagcattgacaacttgac attaatacttatatgaatgcacgtatatataaagtattttcttaatttta aaatggtttacaaaaaacaaaatccaaataat ,:tcaaggttctacgtac · ; tagctacatgcatataggaaaaatggtcagaatttatatatatatatata tatatatacaaataattacaaatatctataaataaattttaaactaaatc aagttggtcctcttcccatccttctaaaatcctataaataccaacatctt ctcttcatatctatttattcaataacccttacaacaccgaatataacttt gaaaaaaaaaacaa

SEQ ID No. 32 promoter sequence AT4G34950 cgtcgtagatgattcgtgttttgttttgtgatatgataacgggcctaaat aacggctaatgggccattatcttatgctgttttcaattactattgaatca aatatgggcttttaatcactgtttctaaatttacgcaattttgtttagtt atatatttttgcgttccttagtaggctttgatctgaagaaacagatatct gatattcattactactttcttagttttcctattttgtcggcaaaatcatt attttggtagttcaaacttttaggtctctggttcaaatgtaaactaaatt gacactcgtgtggctggtaggtgagatattttgttagaacattgattatg ttatttcattacttactgcgaaacaaatcttgagacataaaattgcactt tgcaaaattacaaattgatgcgagtggcaaatggcaatttttagacaact taaatgctgtcacttaactatgattccttcggacatttaaattttaactt atgttttttaatcacgaagtagtaggtcgtttatcttaatatctcatgtt caggaatgaattcgagtatcaagaatattgcatatacgcacccaacgtgt tttttattaaccatcgccaataaagttaccacaagcttagataaatagaa acacaaatcaatatatatatatacattcggatccattccaaaaactcgtt aagaaaataattaaagagtgaatttcaaagttatctttacaataagaaaa ttcaaatcaataagaatatttcaatagtctagagacatgtttagtcccac ttttaattaaagcgatagttactcatttcttttatgttgtttgctactag tacatgctattatcttttttattttattaaatatttttgtccttcattct caaccgttgccrcattttctttgttaatgatcattatattattattatga agtcgtttttggaatcctacaacattaacatacacaaatgtctttttgtg ataccatacaaataatttgtttttctaaaacaaacaaaaaaatatctttt gtgataagcaaattgtgaatctgtgataacctcgcccacaaatcatatca cttattcgacaatttgtgataatttagcccacaatatttatgcactagct gatagaaagaaacatatccttatcactcacttactgtataaaatcccgga ttggccccatcaaatatacatcgctcttatcattaaccacatctggcaag tggtttaagctgtcaaatacaacacgactttgttgaacatatttttgttt ctcaatctgtaatccaccgacgttcattttttggttaatcttttgtctgc tgatctgatcatgtaaacctgacggaatcgaataacatatataactcaat ctaattatgcaatgcaaaacaattatttgtgaataactcatttttaaccc gttgaaagaaatgatggttttttaaagatacatgcaacctttaatctcct ttat^catgcgtgtctgaatttgtatcacaggatagagtaacttacgaat tttcttggattagattattagaacttcattttgccaaagaaaatattgct tacataataataaggaggcggctaaggataacatgaattacaatcgctat acaacacataattattacactttttgttcttcttaaaaataaatgttatc cagctatattttcatccagcaaagccgtcaggcgttgtcgataagcttca aaaaaagaactgatgaaattccgaaattcctcctccatattagcgtacgt tacgttttatttaatttattttgcaaatgatattttcttcacttccagtt atttttttatttttttaattggtagagtaaaaaaagatttattggcactc taatttttgacggttaacacacatatactgcaattatgtttaacaaaact aaaccgatcgatgaaatattctttacttggtcgatgaaaatagttgtctc atccgatgatccgaatgactctttccaagttggtaccttaaattgtggta tctgctgtattccatacgaaagtaaaccgcggaataactaaattcttaaa ccatctttatcagaacaaagcaactaatctgcaaaattgtcagtgttgca agctataaatgttccgtacaagctacaaataaagaaatacaaggcttagc cgatgtgaaacgtacgttagagttgtacacgatatgttttgtgtgaattt gataaattcaaaaaaaaaattgttgtacaccttgatcctagtcatgctgg ttggtgtatattaatatattatatcagaaagtgactgtcattctatttta atgtgatatttacggtcaaagacatgttgcatgtaattgcgcgcgcaatg tatacgaccattttttga+~gaagtaactcagcgggtaaacattctatcac tttccatttcattggtaagtacaatattggattttcttttgtggtatgca ctagtcggtatcagtcccgagatgtaattagagaaatatttgtaactaga acttttttccaa^ ctttcgaatttttttttttttttttttttgccc, "ag atttggaatatgattctaacagaatatcaatacaatatagcaactttggc tcactggtcactgcttcataacatgataacaaaactctcaagcaactact ttcatctgaccctttttatgtcaaaaaaggtctttcgtctgaaccgaaaa tcaaaccgagttggaagcttctagcaaagataatgagccgtactagtcac aactcacaagtcacactttcgaatttcaaacttcaattgaagatccgaat atccactgccgtagtttgtacgatactttcactcatttcatgttgtcatg tgtcgtacaacagtttccagtttcccattattatttaatgtttatttatt aatatttggactttaattacggcaggttatactatatggtatgatagaat attttcttcattccactggattttgctaattatatatatttattccaaat cacaattttgatttatcgtcattacaaaaactaaaaagtaatgaccaaaa taaaagata gtaatttcagatattccgttctaactattctattctcttc ctgattccattaccaaacactgagagacaaataagctactggccgctaat tggctatcgctctctttacatcttcgaacataagcaatagttgaaaaata taactttactaaaaaaatacatatttttcgttaaaaaaaaccttgtggtc gtctatatactattctaataagtaaaaaaaaaaaaaaaaagtaacggaag

catgaactttcatgcctggaagaaactactggccaaaaccatccactaaa

tacaactaatgaagtaatcatcctagttgagcatattgtaatcatcacat

tcaagaaaaatatcccatggagaacaattttgcattatataaaaagttaa

ttccttgtcgacttttatataacacaaacaagaaggagcacatcgtaaat

tcatcaccgcttctacaccttcaccgtacgtgtctctttcgtactttctc

actatttgtcattctaattataaagtacaaaaaaatcaatagtttaatta

ttaaattaatattaaaaataaatactttctactaaaagtctaaaatatta

taacatcgaagttgcgaaaaataaaataaaataaacgtaacatttcacct

ttaaaaccgtacgcagagtgctcaacgaacccaaacacactctaaaaata

tcttctttctccttcttcttcattcttctcaatatctccta

REFERENCES :

Balasubramanian, S., Sureshkumar, S., Lempe, J., and Weigel, D. (2006) . Potent induction of Arabidopsis thaliana flowering by elevated growth temperature. PLoS Genet 2, el06.

Choi, K. , Kim, S., Kim, S.Y., Kim, M . , Hyun, Y., Lee, H., Choe, S., Kim, S.G., Michaels, S., and Lee, I. (2005). SUPPRESSOR OF FRIGIDA3 encodes a nuclear ACTI -RELATED PROTEIN6 required for floral repression in Arabidopsis. Plant Cell 27, 2647-2660.

Deal, R.B., Kandasamy, M.K., McKinney, E.C., and Meagher, R.B. (2005) . The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis. Plant Cell 17, 2633-2646.

Fitter, A.H., and Fitter, R.S. (2002). Rapid changes in flowering time in British plants. Science 296, 1689-1691.

Gendrel, A.V., Lippman, Z., Yordan, C, Colot, V., and Martienssen, R.A. (2002). Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1. Science 257, 1871-1873. Gray, W.M. , Ostin, A., Sandberg, G., Romano, CP., and Estelle, M. (1998). High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc Natl Acad Sci U S A 95, 7197-7202.

Halliday, K J., Salter, M.G.. Thingnaes, E., and Whitelam, G.C. (2003). Phytochrome control of flowering is temperature sensitive and correlates with expression of the floral integrator FT. Plant J 33, 875-885.

Heggie, L., and Halliday, K.J. (2005). The highs and lows of plant life: temperature and light interactions in development. Int J Dev Biol 49, 675-687.

Kelly, A.E., and Goulden, M.L. (2008). Rapid shifts in plant distribution with recent climate change. Proc Natl Acad Sci U S A 105, 11823-11826.

Koini, M.A., Alvey, L., Allen, T., Tilley, C.A., larberd, N.P., Whitelam, G.C, and Franklin, K.A. (2009). High temperature-mediated adaptations in plant architecture require the bHLH transcription factor PIF1. Curr Biol 19, 408-413.

Larkindale, J., and Vierling, E. (2008). Core genome responses involved in acclimation to high temperature. Plant Physiol 146, 748-761.

Lenoir, J., Gegout, J.C, Marquet, P. A., de Ruffray, P., and Brisse, H. (2008). A significant upward shift in plant species optimum elevation during the 20th century. Science 320, 1768- 1771.

Li, M., Singh, R. , Bazanova, . , Milligan, A.S., Shirley, N., Langridge, P., and Lopato, S. (2008). Spatial and temporal expression of endosperm transfer cell-specific promoters in transgenic ri -e and barley. Plrnt Biotechnol J r. 465-476.

Martin-Trillo, M. , Lazaro, A., Poethig, R.S., Gomez-Mena, C, Pineiro, M.A. , Martinez-Zapater, J.M., and Jarillo, J. . (2006) . EARLY IN SHORT DAYS 1 (ESDI) encodes ACTIN-RELATED PROTEIN 6 (AtARP6) , a putative component of chromatin remodelling complexes that positively regulates FLC accumulation in Arabidopsis. Development 133, 1241-1252.

ittler, R. (2006) . Abiotic stress, the field environment and stress combination. Trends Plant Sci 11, 15-19.

Salome, P.A., and McClung, C.R (2005). PSEUDO-RESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock. Plant Cell 17, 791-803.

Samach, A., and Wigge, P. A. (2005). Ambient temperature perception in plants. Curr Opin Plant Biol 8, 483-486.

Segal, E., and Widom, J. (2009). From DNA sequence to transcriptional behaviour: a quantitative approach. NatRev Genet 10, 443-456.

Sung, D.Y., Vierling, E., and Guy, C.L. (2001). Comprehensive expression profile analy? '.s of the Arabidopsis Hsp70 gene family. Plant Physiol 126, 789-800.

Sung, S., and Amasino, R.M. (2005). Remembering winter: toward a molecular understanding of vernalization. Annu Rev Plant Biol 56, 491-508.

ilczek, A.M., Roe, J.L., Knapp, M.C., Cooper, M.D., Lopez- Gallego, C, Martin, L.J., Muir, CD., Sim, S., Walker, A., Anderson, J., et al. (2009). Effects of Genetic Perturbation on Seasonal Life History Plasticity. Science 323, 930-934.

Willis, C.G., Ruhfel, B., Primack, R.B., Miller-Rushing, A.J., and Davis, C.C. (2008). Phylogenetic patterns of species loss in Thoreau's woods are driven by climate change. Proc Natl Acad Sci U S A 105, 17029-17033.

WHAT IS CLAIMED

1. A method for identifying a compound that regulates temperature perception in a plant comprising

expressing a nucleic ac d construct con-prising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of the reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

2 The method according to claim 1 wherein expression is compared to expression in a control plant or plant cell.

3. The method according to claim 2 wherein the promoter is derived from a monocot or dicot plant.

4. The method according to claim 3 wherein the promoter is derived from Arabidopsis.

5. The method according to a preceding claim wherein expression is increased.

6. The method according to claim 6 wherein the promoter comprises a HSE motif wherein said motif consists of either GAANNTTC or TTCNNGAA or both, where N is any base.

7. The method according to a preceding claim wherein said promoter is a HSP70 promoter.

8. The method according to claim 7 wherein said promoter comprises or consists of SEQ ID NO. 1 or a functional variant thereof .

°. The method according to clajn 7 wherein saj Ί promoter comprises or consists of SEQ ID NO. 1.

10. The method according to claim 4 wherein said promoter comprises or consists of SEQ ID NO. 2.

11. The method according to claim 4 wherein said promoter comprises or consists of SEQ ID NO. 3.

12. The method according to claim 4 wherein said promoter comprise,' or consists of S7Q ID NO. 4.

13. The method according to claim 4 wherein said promoter comprises or consists of SEQ ID NO. 5.

14. The method according to claim 3 wherein said promoter comprises or consists of SEQ ID NO. 6.

15. The method according to claim 3 wherein said promoter comprises or consists of SEQ ID NO. 7.

16. The method according to a preceding claim wherein expression is decreased.

17. The method according to claim 16 wherein said promoter is selected from SEQ ID NO. 30 to 32.

18. The method according to a preceding claim- wherein said nucleic acid construct is expressed in a plant.

19. The method according to any of claims 1 to 17 wherein said nucleic act i construct is expressed in a plant cell in cell culture .

20. The method according to a preceding claim wherein said reporter nucleic acid sequence is selected from luciferase or a nucleic acid encoding green fluorescent protein.

21. The method according to a preceding claim wherein expression is monitored at at least two different temperatures at a temperature range of about 12 °C to about 27 °C.

22. The method according to a preceding claim wherein expression is monitored at 12, 17, 22 and 27°C.

23. A compound identified or identifiable by any of the methods of claims 1 to 22.

24. A compound that modifies temperature perception of a plant .

25. A method for identifying a mutant plant defective in the temperature signalling pathway comprising

monitoring expression of a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12 °C to 27 °C at at least two different temperatures.

26. A method for regulating temperature-dependent expression of a target gene in a plant or plant cell comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a target nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said target nucleic acid sequence which changes with increasing temperature at at least two d fferent temperatures.

27. An in vitro assay for identifying a target compound that regulates temperature perception in a plant comprising expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant cell to a test compound and

monitoring expression of said reporter gene at at least two different temperatures.

28. Use of a temperature responsive plant promoter sequence as an indicator of temperature perception in plant, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12°C to 27°C.

29. The use according to claim 28 wherein said promoter is operably linked to a reporter gene.

30. Use of a temperature responsive plant promoter sequence, wherein said promoter regulates temperature-dependent expression wherein expression changes with increasing temperature over a temperature range of 12 °C to 27 °C in a method for identifying a target compound that regulates temperature perception in a plant.

31. A use according to claim 30 wherein said method is carried

32. A use according to claim 30 wherein said method is carried out in vitro.

33. An assay for identifying a target compound that regulates temperature perception in a plant expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant or plant cell, wherein said promoter regulates temperature-dependent expression of said reporter m cleic acid seqi ance which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or pi?"it cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures .

3 . A transgenic plant expressing a nucleic acid construct comprising a plant promoter sequence operably linked to a reporter nucleic acid sequence in a plant cell, wherein said promoter regulates temperature-dependent expression of said reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12 °C to 27 °C.

35. The transgenic plant according to claim 34 wherein sc id promoter is a HSP70 promoter.

36. The transgenic plant according to claim 34 wherein said promoter comprises or consists of a sequence selected from SEQ ID NO. 1 to SEQ ID NO. 7 or 30 to 32.

37. A method for identifying a compound that regulates temperature perception in a plant comprising

measuring expression of an endogenous gene regulated by a promoter that regulates temperature-dependent expr ^ssion of the reporter nucleic acid sequence which changes with increasing temperature over a temperature range of 12°C to 27°C

exposing said plant or plant cell to a test compound and monitoring expression of said reporter gene at at least two different temperatures.

Download Citation


Sign in to the Lens

Feedback