{"search_session":{},"preferences":{"l":"en","queryLanguage":"en"},"patentId":"006-576-968-901-581","frontPageModel":{"patentViewModel":{"ref":{"entityRefType":"PATENT","entityRefId":"006-576-968-901-581"},"entityMetadata":{"linkedIds":{"empty":true},"tags":[],"collections":[{"id":22717,"type":"PATENT","title":"Citing Univ Nth Carolina Chapel Hill publications","description":"Patent documents citing scholarly work of Univ Nth Carolina Chapel Hill","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39650,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:36:50Z","updated":"2017-08-07T04:36:50Z","lastEventDate":"2017-08-07T04:36:50Z"},{"id":22721,"type":"PATENT","title":"Citing CNRS publications","description":"Patent documents citing scholarly work of CNRS","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":129822,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:38:15Z","updated":"2017-08-07T04:38:15Z","lastEventDate":"2017-08-07T04:38:15Z"},{"id":22722,"type":"PATENT","title":"Citing ICSTM publications","description":"Patent documents citing scholarly work of ICSTM","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":51214,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:40:07Z","updated":"2017-08-07T04:40:07Z","lastEventDate":"2017-08-07T04:40:07Z"},{"id":22728,"type":"PATENT","title":"Citing UC Davis publications","description":"Patent documents citing scholarly work of UC Davis","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":34174,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:41:48Z","updated":"2017-08-07T04:41:48Z","lastEventDate":"2017-08-07T04:41:48Z"},{"id":22729,"type":"PATENT","title":"Citing UC Los Angeles publications","description":"Patent documents citing scholarly work of UC Los Angeles","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":73948,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:42:18Z","updated":"2017-08-07T04:42:18Z","lastEventDate":"2017-08-07T04:42:18Z"},{"id":22732,"type":"PATENT","title":"Citing UC Berkeley publications","description":"Patent documents citing scholarly work of UC Berkeley","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":71443,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:43:57Z","updated":"2017-08-07T04:43:57Z","lastEventDate":"2017-08-07T04:43:57Z"},{"id":22741,"type":"PATENT","title":"Citing TAMU publications","description":"Patent documents citing scholarly work of TAMU","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":20782,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:47:22Z","updated":"2017-08-07T04:47:22Z","lastEventDate":"2017-08-07T04:47:22Z"},{"id":22745,"type":"PATENT","title":"Citing Washington Univ St Louis publications","description":"Patent documents citing scholarly work of Washington Univ St Louis","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":53436,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:48:14Z","updated":"2017-08-07T04:48:14Z","lastEventDate":"2017-08-07T04:48:14Z"},{"id":22755,"type":"PATENT","title":"Citing TSRI publications","description":"Patent documents citing scholarly work of TSRI","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":47193,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:51:37Z","updated":"2017-08-07T04:51:37Z","lastEventDate":"2017-08-07T04:51:37Z"},{"id":22757,"type":"PATENT","title":"Citing Cornell Univ publications","description":"Patent documents citing scholarly work of Cornell Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":60392,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:53:01Z","updated":"2017-08-07T04:53:01Z","lastEventDate":"2017-08-07T04:53:01Z"},{"id":22760,"type":"PATENT","title":"Citing Ghent Univ publications","description":"Patent documents citing scholarly work of Ghent Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":19868,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:54:24Z","updated":"2017-08-07T04:54:24Z","lastEventDate":"2017-08-07T04:54:24Z"},{"id":22763,"type":"PATENT","title":"Citing NYU publications","description":"Patent documents citing scholarly work of NYU","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":34711,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:55:15Z","updated":"2017-08-07T04:55:15Z","lastEventDate":"2017-08-07T04:55:15Z"},{"id":22766,"type":"PATENT","title":"Citing McGill Univ publications","description":"Patent documents citing scholarly work of McGill Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":33777,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:56:02Z","updated":"2017-08-07T04:56:02Z","lastEventDate":"2017-08-07T04:56:02Z"},{"id":22775,"type":"PATENT","title":"Citing Kyoto Univ publications","description":"Patent documents citing scholarly work of Kyoto Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":48499,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:00:03Z","updated":"2017-08-07T05:00:03Z","lastEventDate":"2017-08-07T05:00:03Z"},{"id":22782,"type":"PATENT","title":"Citing ETH Zurich publications","description":"Patent documents citing scholarly work of ETH Zurich","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":28682,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:02:38Z","updated":"2017-08-07T05:02:38Z","lastEventDate":"2017-08-07T05:02:38Z"},{"id":22786,"type":"PATENT","title":"Citing Duke Univ publications","description":"Patent documents citing scholarly work of Duke Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":52418,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:04:02Z","updated":"2017-08-07T05:04:02Z","lastEventDate":"2017-08-07T05:04:02Z"},{"id":22792,"type":"PATENT","title":"Citing HUJI publications","description":"Patent documents citing scholarly work of HUJI","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31459,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:07:10Z","updated":"2017-08-07T05:07:10Z","lastEventDate":"2017-08-07T05:07:10Z"},{"id":22793,"type":"PATENT","title":"Citing Univ Wisconsin publications","description":"Patent documents citing scholarly work of Univ Wisconsin","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":57249,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:07:38Z","updated":"2017-08-07T05:07:38Z","lastEventDate":"2017-08-07T05:07:38Z"},{"id":22798,"type":"PATENT","title":"Citing Univ Edinburgh publications","description":"Patent documents citing scholarly work of Univ Edinburgh","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":21541,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:07Z","updated":"2017-08-07T05:09:07Z","lastEventDate":"2017-08-07T05:09:07Z"},{"id":22800,"type":"PATENT","title":"Citing Baylor College Med publications","description":"Patent documents citing scholarly work of Baylor College Med","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":37085,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:55Z","updated":"2017-08-07T05:09:55Z","lastEventDate":"2017-08-07T05:09:55Z"},{"id":22802,"type":"PATENT","title":"Citing UC System publications","description":"Patent documents citing scholarly work of UC System","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":266608,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:10:38Z","updated":"2017-08-07T05:10:38Z","lastEventDate":"2017-08-07T05:10:38Z"},{"id":22805,"type":"PATENT","title":"Citing UC San Francisco publications","description":"Patent documents citing scholarly work of UC San Francisco","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":73241,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:15:33Z","updated":"2017-08-07T05:15:33Z","lastEventDate":"2017-08-07T05:15:33Z"},{"id":22811,"type":"PATENT","title":"Citing Univ Pennsylvania publications","description":"Patent documents citing scholarly work of Univ Pennsylvania","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":65126,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:17:40Z","updated":"2017-08-07T05:17:40Z","lastEventDate":"2017-08-07T05:17:40Z"},{"id":22817,"type":"PATENT","title":"Citing Univ Arizona publications","description":"Patent documents citing scholarly work of Univ Arizona","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":33455,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:19:53Z","updated":"2017-08-07T05:19:53Z","lastEventDate":"2017-08-07T05:19:53Z"},{"id":22821,"type":"PATENT","title":"Citing Univ Illinois publications","description":"Patent documents citing scholarly work of Univ Illinois","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":36173,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:21:06Z","updated":"2017-08-07T05:21:06Z","lastEventDate":"2017-08-07T05:21:06Z"},{"id":22824,"type":"PATENT","title":"Citing Rockefeller Univ publications","description":"Patent documents citing scholarly work of Rockefeller Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":32455,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:22:00Z","updated":"2017-08-07T05:22:00Z","lastEventDate":"2017-08-07T05:22:00Z"},{"id":22841,"type":"PATENT","title":"Citing Osaka Univ publications","description":"Patent documents citing scholarly work of Osaka Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":46815,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:27:12Z","updated":"2017-08-07T05:27:12Z","lastEventDate":"2017-08-07T05:27:12Z"},{"id":22842,"type":"PATENT","title":"Citing Univ Toronto publications","description":"Patent documents citing scholarly work of Univ Toronto","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":65159,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:27:52Z","updated":"2017-08-07T05:27:52Z","lastEventDate":"2017-08-07T05:27:52Z"},{"id":22843,"type":"PATENT","title":"Citing Penn State publications","description":"Patent documents citing scholarly work of Penn State","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39578,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:28:48Z","updated":"2017-08-07T05:28:48Z","lastEventDate":"2017-08-07T05:28:48Z"},{"id":22844,"type":"PATENT","title":"Citing Northwestern Univ publications","description":"Patent documents citing scholarly work of Northwestern Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":37711,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:29:24Z","updated":"2017-08-07T05:29:24Z","lastEventDate":"2017-08-07T05:29:24Z"},{"id":22848,"type":"PATENT","title":"Citing Stanford Univ publications","description":"Patent documents citing scholarly work of Stanford Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":108345,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:31:21Z","updated":"2017-08-07T05:31:21Z","lastEventDate":"2017-08-07T05:31:21Z"},{"id":22850,"type":"PATENT","title":"Citing Oregon Health Science Univ publications","description":"Patent documents citing scholarly work of Oregon Health Science Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":16957,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:32:56Z","updated":"2017-08-07T05:32:56Z","lastEventDate":"2017-08-07T05:32:56Z"},{"id":22852,"type":"PATENT","title":"Citing Univ Oxford publications","description":"Patent documents citing scholarly work of Univ Oxford","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":51799,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:33:16Z","updated":"2017-08-07T05:33:16Z","lastEventDate":"2017-08-07T05:33:16Z"},{"id":22856,"type":"PATENT","title":"Citing NIH publications","description":"Patent documents citing scholarly work of NIH","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":151649,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:35:15Z","updated":"2017-08-07T05:35:15Z","lastEventDate":"2017-08-07T05:35:15Z"},{"id":22859,"type":"PATENT","title":"Citing Harvard Univ publications","description":"Patent documents citing scholarly work of Harvard Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":175224,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:37:44Z","updated":"2017-08-07T05:37:44Z","lastEventDate":"2017-08-07T05:37:44Z"},{"id":22860,"type":"PATENT","title":"Citing UC San Diego publications","description":"Patent documents citing scholarly work of UC San Diego","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":70050,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:40:14Z","updated":"2017-08-07T05:40:14Z","lastEventDate":"2017-08-07T05:40:14Z"},{"id":22870,"type":"PATENT","title":"Citing UC Santa Cruz publications","description":"Patent documents citing scholarly work of UC Santa Cruz","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":6086,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:44:35Z","updated":"2017-08-07T05:44:35Z","lastEventDate":"2017-08-07T05:44:35Z"},{"id":22878,"type":"PATENT","title":"Citing Univ London publications","description":"Patent documents citing scholarly work of Univ London","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":96093,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:47:35Z","updated":"2017-08-07T05:47:35Z","lastEventDate":"2017-08-07T05:47:35Z"},{"id":22879,"type":"PATENT","title":"Citing Michigan State Univ publications","description":"Patent documents citing scholarly work of Michigan State Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":19328,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:48:59Z","updated":"2017-08-07T05:48:59Z","lastEventDate":"2017-08-07T05:48:59Z"},{"id":22899,"type":"PATENT","title":"Citing Univ Rochester publications","description":"Patent documents citing scholarly work of Univ Rochester","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":24884,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:56:06Z","updated":"2017-08-07T05:56:06Z","lastEventDate":"2017-08-07T05:56:06Z"},{"id":22903,"type":"PATENT","title":"Citing Kings College London publications","description":"Patent documents citing scholarly work of Kings College London","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":26647,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:58:18Z","updated":"2017-08-07T05:58:18Z","lastEventDate":"2017-08-07T05:58:18Z"},{"id":22904,"type":"PATENT","title":"Citing Univ Utah publications","description":"Patent documents citing scholarly work of Univ Utah","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31415,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:58:45Z","updated":"2017-08-07T05:58:45Z","lastEventDate":"2017-08-07T05:58:45Z"},{"id":22911,"type":"PATENT","title":"Citing Univ Cambridge publications","description":"Patent documents citing scholarly work of Univ Cambridge","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":58870,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T06:00:47Z","updated":"2017-08-07T06:00:47Z","lastEventDate":"2017-08-07T06:00:47Z"},{"id":27083,"type":"PATENT","title":"Patents citing scholarly work funded by Wellcome Trust","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":45204,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2018-01-23T03:10:18Z","updated":"2018-01-23T03:17:28Z","lastEventDate":"2018-01-23T03:17:28Z"},{"id":185277,"type":"PATENT","title":"lens-seq-2008-2009-seq-pubyr-families-use","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39465,"tags":[],"user":{"id":11753382,"username":"poldham","firstName":"Paul","lastName":"Oldham","created":"2013-11-12T12:46:15.000Z","displayName":"Paul Oldham","profilePictureKey":"lens/users/5c122e46-fca5-4dba-a591-52919b87fbd0/profile-picture","preferences":"{}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2020-11-10T13:28:57Z","updated":"2020-11-10T13:29:55Z","lastEventDate":"2020-11-10T13:29:55Z"},{"id":195299,"type":"PATENT","title":"pets and care practices","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":372660622,"username":"jorgenripe","firstName":"","lastName":"","created":"2020-10-09T18:12:13.000Z","displayName":"jorgenripe","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2021-10-01T01:10:49Z","updated":"2021-10-01T01:11:14Z","lastEventDate":"2021-10-01T01:11:14Z"},{"id":201180,"type":"PATENT","title":"Test_Patents","description":"Patents","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":450478416,"username":"FlavioNeo","firstName":"","lastName":"","created":"2022-05-11T07:08:46.000Z","displayName":"FlavioNeo","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-05-11T08:38:22Z","updated":"2022-05-11T08:38:40Z","lastEventDate":"2022-05-11T08:38:40Z"},{"id":201520,"type":"PATENT","title":"teste","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":452358642,"username":"Monicaconatus","firstName":"","lastName":"","created":"2022-05-24T11:19:47.000Z","displayName":"Monicaconatus","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-05-25T11:23:54Z","updated":"2023-06-07T09:07:57Z","lastEventDate":"2023-06-07T09:07:57Z"},{"id":202596,"type":"PATENT","title":"mRNA","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":402174617,"username":"SreePrabhu","firstName":"Sreenivasa","lastName":"Prabhu","created":"2021-05-01T13:06:40.000Z","displayName":"Sreenivasa Prabhu","preferences":"{}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2022-07-07T09:17:17Z","updated":"2022-07-07T09:17:21Z","lastEventDate":"2022-07-07T09:17:21Z"},{"id":205085,"type":"PATENT","title":"trasngenicos","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":477714811,"username":"anggieapap","firstName":"","lastName":"","created":"2022-11-05T00:29:17.000Z","displayName":"anggieapap","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-11-05T01:18:17Z","updated":"2022-11-05T01:18:19Z","lastEventDate":"2022-11-05T01:18:19Z"},{"id":205103,"type":"PATENT","title":"Human Resources","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":432061555,"username":"luisa charry","firstName":"Luisa Fernanda","lastName":"Charry Piñeros","created":"2021-12-11T12:59:37.000Z","displayName":"Luisa Fernanda Charry Piñeros","preferences":"{\"usage\":\"professional\"}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-11-06T16:53:59Z","updated":"2022-11-06T16:54:03Z","lastEventDate":"2022-11-06T16:54:03Z"},{"id":207822,"type":"PATENT","title":"Chong_search","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":11703,"tags":[],"user":{"id":496851915,"username":"norazrin","firstName":"Dr. Norazrin","lastName":"Ariffin","created":"2023-03-03T16:35:22.000Z","displayName":"Dr. Norazrin Ariffin","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2023-03-07T04:08:03Z","updated":"2023-03-07T04:08:07Z","lastEventDate":"2023-03-07T04:08:07Z"},{"id":209190,"type":"PATENT","title":"NON BINARY","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":504469641,"username":"Nefy","firstName":"","lastName":"","created":"2023-04-26T15:53:47.000Z","displayName":"Nefy","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2023-05-02T16:52:50Z","updated":"2023-05-02T16:52:53Z","lastEventDate":"2023-05-02T16:52:53Z"}],"notes":[],"inventorships":[],"privateCollections":[],"publicCollections":[{"id":22717,"type":"PATENT","title":"Citing Univ Nth Carolina Chapel Hill publications","description":"Patent documents citing scholarly work of Univ Nth Carolina Chapel Hill","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39650,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:36:50Z","updated":"2017-08-07T04:36:50Z","lastEventDate":"2017-08-07T04:36:50Z"},{"id":22721,"type":"PATENT","title":"Citing CNRS publications","description":"Patent documents citing scholarly work of CNRS","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":129822,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:38:15Z","updated":"2017-08-07T04:38:15Z","lastEventDate":"2017-08-07T04:38:15Z"},{"id":22722,"type":"PATENT","title":"Citing ICSTM publications","description":"Patent documents citing scholarly work of ICSTM","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":51214,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:40:07Z","updated":"2017-08-07T04:40:07Z","lastEventDate":"2017-08-07T04:40:07Z"},{"id":22728,"type":"PATENT","title":"Citing UC Davis publications","description":"Patent documents citing scholarly work of UC Davis","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":34174,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:41:48Z","updated":"2017-08-07T04:41:48Z","lastEventDate":"2017-08-07T04:41:48Z"},{"id":22729,"type":"PATENT","title":"Citing UC Los Angeles publications","description":"Patent documents citing scholarly work of UC Los Angeles","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":73948,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:42:18Z","updated":"2017-08-07T04:42:18Z","lastEventDate":"2017-08-07T04:42:18Z"},{"id":22732,"type":"PATENT","title":"Citing UC Berkeley publications","description":"Patent documents citing scholarly work of UC Berkeley","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":71443,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:43:57Z","updated":"2017-08-07T04:43:57Z","lastEventDate":"2017-08-07T04:43:57Z"},{"id":22741,"type":"PATENT","title":"Citing TAMU publications","description":"Patent documents citing scholarly work of TAMU","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":20782,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:47:22Z","updated":"2017-08-07T04:47:22Z","lastEventDate":"2017-08-07T04:47:22Z"},{"id":22745,"type":"PATENT","title":"Citing Washington Univ St Louis publications","description":"Patent documents citing scholarly work of Washington Univ St Louis","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":53436,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:48:14Z","updated":"2017-08-07T04:48:14Z","lastEventDate":"2017-08-07T04:48:14Z"},{"id":22755,"type":"PATENT","title":"Citing TSRI publications","description":"Patent documents citing scholarly work of TSRI","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":47193,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:51:37Z","updated":"2017-08-07T04:51:37Z","lastEventDate":"2017-08-07T04:51:37Z"},{"id":22757,"type":"PATENT","title":"Citing Cornell Univ publications","description":"Patent documents citing scholarly work of Cornell Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":60392,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:53:01Z","updated":"2017-08-07T04:53:01Z","lastEventDate":"2017-08-07T04:53:01Z"},{"id":22760,"type":"PATENT","title":"Citing Ghent Univ publications","description":"Patent documents citing scholarly work of Ghent Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":19868,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:54:24Z","updated":"2017-08-07T04:54:24Z","lastEventDate":"2017-08-07T04:54:24Z"},{"id":22763,"type":"PATENT","title":"Citing NYU publications","description":"Patent documents citing scholarly work of NYU","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":34711,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:55:15Z","updated":"2017-08-07T04:55:15Z","lastEventDate":"2017-08-07T04:55:15Z"},{"id":22766,"type":"PATENT","title":"Citing McGill Univ publications","description":"Patent documents citing scholarly work of McGill Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":33777,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:56:02Z","updated":"2017-08-07T04:56:02Z","lastEventDate":"2017-08-07T04:56:02Z"},{"id":22775,"type":"PATENT","title":"Citing Kyoto Univ publications","description":"Patent documents citing scholarly work of Kyoto Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":48499,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:00:03Z","updated":"2017-08-07T05:00:03Z","lastEventDate":"2017-08-07T05:00:03Z"},{"id":22782,"type":"PATENT","title":"Citing ETH Zurich publications","description":"Patent documents citing scholarly work of ETH Zurich","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":28682,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:02:38Z","updated":"2017-08-07T05:02:38Z","lastEventDate":"2017-08-07T05:02:38Z"},{"id":22786,"type":"PATENT","title":"Citing Duke Univ publications","description":"Patent documents citing scholarly work of Duke Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":52418,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:04:02Z","updated":"2017-08-07T05:04:02Z","lastEventDate":"2017-08-07T05:04:02Z"},{"id":22792,"type":"PATENT","title":"Citing HUJI publications","description":"Patent documents citing scholarly work of HUJI","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31459,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:07:10Z","updated":"2017-08-07T05:07:10Z","lastEventDate":"2017-08-07T05:07:10Z"},{"id":22793,"type":"PATENT","title":"Citing Univ Wisconsin publications","description":"Patent documents citing scholarly work of Univ Wisconsin","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":57249,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:07:38Z","updated":"2017-08-07T05:07:38Z","lastEventDate":"2017-08-07T05:07:38Z"},{"id":22798,"type":"PATENT","title":"Citing Univ Edinburgh publications","description":"Patent documents citing scholarly work of Univ Edinburgh","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":21541,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:07Z","updated":"2017-08-07T05:09:07Z","lastEventDate":"2017-08-07T05:09:07Z"},{"id":22800,"type":"PATENT","title":"Citing Baylor College Med publications","description":"Patent documents citing scholarly work of Baylor College Med","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":37085,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:55Z","updated":"2017-08-07T05:09:55Z","lastEventDate":"2017-08-07T05:09:55Z"},{"id":22802,"type":"PATENT","title":"Citing UC System publications","description":"Patent documents citing scholarly work of UC System","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":266608,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:10:38Z","updated":"2017-08-07T05:10:38Z","lastEventDate":"2017-08-07T05:10:38Z"},{"id":22805,"type":"PATENT","title":"Citing UC San Francisco publications","description":"Patent documents citing scholarly work of UC San Francisco","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":73241,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:15:33Z","updated":"2017-08-07T05:15:33Z","lastEventDate":"2017-08-07T05:15:33Z"},{"id":22811,"type":"PATENT","title":"Citing Univ Pennsylvania publications","description":"Patent documents citing scholarly work of Univ Pennsylvania","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":65126,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:17:40Z","updated":"2017-08-07T05:17:40Z","lastEventDate":"2017-08-07T05:17:40Z"},{"id":22817,"type":"PATENT","title":"Citing Univ Arizona publications","description":"Patent documents citing scholarly work of Univ Arizona","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":33455,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:19:53Z","updated":"2017-08-07T05:19:53Z","lastEventDate":"2017-08-07T05:19:53Z"},{"id":22821,"type":"PATENT","title":"Citing Univ Illinois publications","description":"Patent documents citing scholarly work of Univ Illinois","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":36173,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:21:06Z","updated":"2017-08-07T05:21:06Z","lastEventDate":"2017-08-07T05:21:06Z"},{"id":22824,"type":"PATENT","title":"Citing Rockefeller Univ publications","description":"Patent documents citing scholarly work of Rockefeller Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":32455,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:22:00Z","updated":"2017-08-07T05:22:00Z","lastEventDate":"2017-08-07T05:22:00Z"},{"id":22841,"type":"PATENT","title":"Citing Osaka Univ publications","description":"Patent documents citing scholarly work of Osaka Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":46815,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:27:12Z","updated":"2017-08-07T05:27:12Z","lastEventDate":"2017-08-07T05:27:12Z"},{"id":22842,"type":"PATENT","title":"Citing Univ Toronto publications","description":"Patent documents citing scholarly work of Univ Toronto","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":65159,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:27:52Z","updated":"2017-08-07T05:27:52Z","lastEventDate":"2017-08-07T05:27:52Z"},{"id":22843,"type":"PATENT","title":"Citing Penn State publications","description":"Patent documents citing scholarly work of Penn State","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39578,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:28:48Z","updated":"2017-08-07T05:28:48Z","lastEventDate":"2017-08-07T05:28:48Z"},{"id":22844,"type":"PATENT","title":"Citing Northwestern Univ publications","description":"Patent documents citing scholarly work of Northwestern Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":37711,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:29:24Z","updated":"2017-08-07T05:29:24Z","lastEventDate":"2017-08-07T05:29:24Z"},{"id":22848,"type":"PATENT","title":"Citing Stanford Univ publications","description":"Patent documents citing scholarly work of Stanford Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":108345,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:31:21Z","updated":"2017-08-07T05:31:21Z","lastEventDate":"2017-08-07T05:31:21Z"},{"id":22850,"type":"PATENT","title":"Citing Oregon Health Science Univ publications","description":"Patent documents citing scholarly work of Oregon Health Science Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":16957,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:32:56Z","updated":"2017-08-07T05:32:56Z","lastEventDate":"2017-08-07T05:32:56Z"},{"id":22852,"type":"PATENT","title":"Citing Univ Oxford publications","description":"Patent documents citing scholarly work of Univ Oxford","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":51799,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:33:16Z","updated":"2017-08-07T05:33:16Z","lastEventDate":"2017-08-07T05:33:16Z"},{"id":22856,"type":"PATENT","title":"Citing NIH publications","description":"Patent documents citing scholarly work of NIH","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":151649,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:35:15Z","updated":"2017-08-07T05:35:15Z","lastEventDate":"2017-08-07T05:35:15Z"},{"id":22859,"type":"PATENT","title":"Citing Harvard Univ publications","description":"Patent documents citing scholarly work of Harvard Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":175224,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:37:44Z","updated":"2017-08-07T05:37:44Z","lastEventDate":"2017-08-07T05:37:44Z"},{"id":22860,"type":"PATENT","title":"Citing UC San Diego publications","description":"Patent documents citing scholarly work of UC San Diego","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":70050,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:40:14Z","updated":"2017-08-07T05:40:14Z","lastEventDate":"2017-08-07T05:40:14Z"},{"id":22870,"type":"PATENT","title":"Citing UC Santa Cruz publications","description":"Patent documents citing scholarly work of UC Santa Cruz","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":6086,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:44:35Z","updated":"2017-08-07T05:44:35Z","lastEventDate":"2017-08-07T05:44:35Z"},{"id":22878,"type":"PATENT","title":"Citing Univ London publications","description":"Patent documents citing scholarly work of Univ London","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":96093,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:47:35Z","updated":"2017-08-07T05:47:35Z","lastEventDate":"2017-08-07T05:47:35Z"},{"id":22879,"type":"PATENT","title":"Citing Michigan State Univ publications","description":"Patent documents citing scholarly work of Michigan State Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":19328,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:48:59Z","updated":"2017-08-07T05:48:59Z","lastEventDate":"2017-08-07T05:48:59Z"},{"id":22899,"type":"PATENT","title":"Citing Univ Rochester publications","description":"Patent documents citing scholarly work of Univ Rochester","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":24884,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:56:06Z","updated":"2017-08-07T05:56:06Z","lastEventDate":"2017-08-07T05:56:06Z"},{"id":22903,"type":"PATENT","title":"Citing Kings College London publications","description":"Patent documents citing scholarly work of Kings College London","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":26647,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:58:18Z","updated":"2017-08-07T05:58:18Z","lastEventDate":"2017-08-07T05:58:18Z"},{"id":22904,"type":"PATENT","title":"Citing Univ Utah publications","description":"Patent documents citing scholarly work of Univ Utah","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31415,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:58:45Z","updated":"2017-08-07T05:58:45Z","lastEventDate":"2017-08-07T05:58:45Z"},{"id":22911,"type":"PATENT","title":"Citing Univ Cambridge publications","description":"Patent documents citing scholarly work of Univ Cambridge","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":58870,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T06:00:47Z","updated":"2017-08-07T06:00:47Z","lastEventDate":"2017-08-07T06:00:47Z"},{"id":27083,"type":"PATENT","title":"Patents citing scholarly work funded by Wellcome Trust","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":45204,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2018-01-23T03:10:18Z","updated":"2018-01-23T03:17:28Z","lastEventDate":"2018-01-23T03:17:28Z"},{"id":185277,"type":"PATENT","title":"lens-seq-2008-2009-seq-pubyr-families-use","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":39465,"tags":[],"user":{"id":11753382,"username":"poldham","firstName":"Paul","lastName":"Oldham","created":"2013-11-12T12:46:15.000Z","displayName":"Paul Oldham","profilePictureKey":"lens/users/5c122e46-fca5-4dba-a591-52919b87fbd0/profile-picture","preferences":"{}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2020-11-10T13:28:57Z","updated":"2020-11-10T13:29:55Z","lastEventDate":"2020-11-10T13:29:55Z"},{"id":195299,"type":"PATENT","title":"pets and care practices","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":372660622,"username":"jorgenripe","firstName":"","lastName":"","created":"2020-10-09T18:12:13.000Z","displayName":"jorgenripe","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2021-10-01T01:10:49Z","updated":"2021-10-01T01:11:14Z","lastEventDate":"2021-10-01T01:11:14Z"},{"id":201180,"type":"PATENT","title":"Test_Patents","description":"Patents","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":450478416,"username":"FlavioNeo","firstName":"","lastName":"","created":"2022-05-11T07:08:46.000Z","displayName":"FlavioNeo","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-05-11T08:38:22Z","updated":"2022-05-11T08:38:40Z","lastEventDate":"2022-05-11T08:38:40Z"},{"id":201520,"type":"PATENT","title":"teste","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":452358642,"username":"Monicaconatus","firstName":"","lastName":"","created":"2022-05-24T11:19:47.000Z","displayName":"Monicaconatus","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-05-25T11:23:54Z","updated":"2023-06-07T09:07:57Z","lastEventDate":"2023-06-07T09:07:57Z"},{"id":202596,"type":"PATENT","title":"mRNA","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":402174617,"username":"SreePrabhu","firstName":"Sreenivasa","lastName":"Prabhu","created":"2021-05-01T13:06:40.000Z","displayName":"Sreenivasa Prabhu","preferences":"{}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2022-07-07T09:17:17Z","updated":"2022-07-07T09:17:21Z","lastEventDate":"2022-07-07T09:17:21Z"},{"id":205085,"type":"PATENT","title":"trasngenicos","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":477714811,"username":"anggieapap","firstName":"","lastName":"","created":"2022-11-05T00:29:17.000Z","displayName":"anggieapap","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-11-05T01:18:17Z","updated":"2022-11-05T01:18:19Z","lastEventDate":"2022-11-05T01:18:19Z"},{"id":205103,"type":"PATENT","title":"Human Resources","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":432061555,"username":"luisa charry","firstName":"Luisa Fernanda","lastName":"Charry Piñeros","created":"2021-12-11T12:59:37.000Z","displayName":"Luisa Fernanda Charry Piñeros","preferences":"{\"usage\":\"professional\"}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2022-11-06T16:53:59Z","updated":"2022-11-06T16:54:03Z","lastEventDate":"2022-11-06T16:54:03Z"},{"id":207822,"type":"PATENT","title":"Chong_search","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":11703,"tags":[],"user":{"id":496851915,"username":"norazrin","firstName":"Dr. Norazrin","lastName":"Ariffin","created":"2023-03-03T16:35:22.000Z","displayName":"Dr. Norazrin Ariffin","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2023-03-07T04:08:03Z","updated":"2023-03-07T04:08:07Z","lastEventDate":"2023-03-07T04:08:07Z"},{"id":209190,"type":"PATENT","title":"NON BINARY","description":"","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":50000,"tags":[],"user":{"id":504469641,"username":"Nefy","firstName":"","lastName":"","created":"2023-04-26T15:53:47.000Z","displayName":"Nefy","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":true,"savedQueries":[],"created":"2023-05-02T16:52:50Z","updated":"2023-05-02T16:52:53Z","lastEventDate":"2023-05-02T16:52:53Z"}],"privateNotes":[],"landscapeCollections":[],"landscapeNotes":[]},"document":{"record_lens_id":"006-576-968-901-581","lens_id":["006-576-968-901-581","184-504-621-864-234"],"doc_key":"US_7553667_B2_20090630","created":"2016-01-15T07:22:54.868","docdb_id":57772294,"lens_internal":{"earliest_lens_id_created_time":"2016-01-15T07:22:54.868","last_modified":"2024-03-25T08:29:42.928","legacy_pub_key":"US_7553667_B2","has_doc_lang":true,"has_biblio_lang":true,"has_all_title_lang":true,"has_all_abstract_lang":true,"has_all_claims_lang":true,"has_description_lang":true},"jurisdiction":"US","doc_number":"7553667","kind":"B2","date_published":"2009-06-30","year_published":2009,"ids":["US_7553667_B2","006-576-968-901-581","184-504-621-864-234","US_7553667_B2_20090630","US","7553667","B2","US7553667B2","US7553667","7553667B2"],"lang":"en","publication_type":"GRANTED_PATENT","application_reference":{"jurisdiction":"US","doc_number":"6742505","kind":"A","date":"2005-02-22"},"priority_claim":[{"jurisdiction":"US","doc_number":"6742505","kind":"A","date":"2005-02-22"},{"jurisdiction":"US","doc_number":"51675305","kind":"A","date":"2005-08-18"},{"jurisdiction":"CA","doc_number":"0300822","kind":"W","date":"2003-06-06"},{"jurisdiction":"US","doc_number":"38708802","kind":"P","date":"2002-06-06"}],"priority_claim.source":"DOCDB","earliest_priority_claim_date":"2002-06-06","title":{"en":[{"text":"Regulation of gene expression using chromatin remodelling factors","lang":"en","source":"DOCDB","data_format":"DOCDBA"}]},"title_lang":["en"],"has_title":true,"applicant":[{"name":"CA MINISTER AGRICULTURE & FOOD","residence":"CA","sequence":1,"app_type":"applicant"}],"applicant_count":1,"has_applicant":true,"inventor":[{"name":"HANNOUFA ABDELALI","residence":"CA","sequence":1},{"name":"LYDIATE DEREK J","residence":"CA","sequence":2},{"name":"GAO MING-JUN","residence":"CA","sequence":3}],"inventor_count":3,"has_inventor":true,"agent":[{"name":"Merchant & Gould P.C.","sequence":1}],"agent_count":1,"has_agent":true,"owner":[{"name":"HER MAJESTY THE QUEEN IN RIGHT OF CANADA AS REPRESENTED BY THE MINISTER OF AGRICULTURE AND AGRI-FOOD","address":"RESEARCH BRANCH, 107 SCIENCE PLACE, SASKATOON, SASKATCHEWAN S7N OX2","country":"CA","sequence":2,"recorded_date":"2005-10-19","execution_date":"2005-02-15","is_current_owner":true}],"owner_count":1,"owner_all":[{"name":"HER MAJESTY THE QUEEN IN RIGHT OF CANADA AS REPRESENTED BY THE MINISTER OF AGRICULTURE AND AGRI-FOOD","address":"RESEARCH BRANCH, 107 SCIENCE PLACE, SASKATOON, SASKATCHEWAN S7N OX2","country":"CA","sequence":2,"recorded_date":"2005-10-19","execution_date":"2005-02-15","is_current_owner":true}],"owner_all_count":1,"has_owner":true,"primary_examiner":{"name":"Cathy Kingdon Worley","department":"1638"},"has_examiner":true,"class_ipcr":[{"symbol":"C12N15/82","version_indicator":"2006-01-01","class_symbol_position":"F","class_value":"I","action_date":"2009-06-30","class_status":"B","class_data_source":"H","generating_office":"US","sequence":1},{"symbol":"A01H1/00","version_indicator":"2006-01-01","class_value":"I","action_date":"2006-05-06","class_status":"R","class_data_source":"M","generating_office":"EP","sequence":2},{"symbol":"C07H21/04","version_indicator":"2006-01-01","class_symbol_position":"L","class_value":"I","action_date":"2009-06-30","class_status":"B","class_data_source":"H","generating_office":"US","sequence":3},{"symbol":"C12N5/04","version_indicator":"2006-01-01","class_value":"I","action_date":"2006-05-06","class_status":"R","class_data_source":"M","generating_office":"EP","sequence":4},{"symbol":"C12N15/00","version_indicator":"2006-01-01","class_symbol_position":"L","class_value":"I","action_date":"2009-06-30","class_status":"B","class_data_source":"H","generating_office":"US","sequence":5},{"symbol":"C12N15/74","version_indicator":"2006-01-01","class_symbol_position":"L","class_value":"I","action_date":"2009-06-30","class_status":"B","class_data_source":"H","generating_office":"US","sequence":6}],"class_ipcr.first_symbol":"C12N15/82","class_ipcr.later_symbol":["A01H1/00","C07H21/04","C12N5/04","C12N15/00","C12N15/74"],"class_ipcr.inv_symbol":["C12N15/82","A01H1/00","C07H21/04","C12N5/04","C12N15/00","C12N15/74"],"class_ipcr.add_symbol":[],"class_ipcr.source":"DOCDB","class_cpc":[{"symbol":"C12N15/8217","version_indicator":"2013-01-01","class_symbol_position":"F","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"EP","sequence":1},{"symbol":"C12N15/8217","version_indicator":"2013-01-01","class_symbol_position":"F","class_value":"I","action_date":"2019-08-22","class_status":"B","class_data_source":"H","generating_office":"US","sequence":2}],"class_cpc_cset":[],"class_cpc.first_symbol":"C12N15/8217","class_cpc.later_symbol":[],"class_cpc.inv_symbol":["C12N15/8217","C12N15/8217"],"class_cpc.add_symbol":[],"class_cpc.source":"DOCDB","class_national":[{"symbol":"435/468","symbol_position":"F"},{"symbol":"435/455","symbol_position":"L"},{"symbol":"435/471","symbol_position":"L"},{"symbol":"435/440","symbol_position":"L"},{"symbol":"800/278","symbol_position":"L"},{"symbol":"536/23.4","symbol_position":"L"},{"symbol":"536/24.1","symbol_position":"L"},{"symbol":"536/23.6","symbol_position":"L"}],"class_national.first_symbol":"435/468","class_national.later_symbol":["435/455","435/471","435/440","800/278","536/23.4","536/24.1","536/23.6"],"class_national.source":"DOCDB","reference_cited":[{"patent":{"num":1,"document_id":{"jurisdiction":"US","doc_number":"2006123506","kind":"A1","date":"2006-06-08","name":"HANNOUFA ABDELALI [CA], et al"},"lens_id":"001-008-207-148-719","category":[],"us_category":[],"cited_phase":"SEA","rel_claims":[],"sequence":1}},{"npl":{"num":1,"text":"Mehra-Chaudhary et al. Msx3 protein recruits histone deacetylase to down-regulate the Msx1 promoter. (Biochem. J. (2001) vol. 353, pp. 13-22).","npl_type":"a","external_id":["10.1042/bj3530013","10.1042/0264-6021:3530013","11115394","pmc1221538"],"record_lens_id":"090-857-590-003-284","lens_id":["155-402-582-462-144","090-857-590-003-284","141-675-518-921-030","144-018-931-836-04X","180-152-333-833-44X"],"sequence":2,"category":[],"us_category":[],"cited_phase":"SEA","rel_claims":[]}},{"npl":{"num":2,"text":"Jenster et al. Steroid receptor induction of gene transcription: a two-step model. (1997) PNAS, vol. 94, pp. 7879-7884.","npl_type":"a","external_id":["9223281","10.1073/pnas.94.15.7879","pmc21523"],"record_lens_id":"105-008-447-734-718","lens_id":["170-351-095-145-447","105-008-447-734-718","167-145-507-884-241"],"sequence":3,"category":[],"us_category":[],"cited_phase":"SEA","rel_claims":[]}},{"npl":{"num":3,"text":"Murfett et al. Identification of Arabidopsis histone deacetylase HDA6 mutants that affect transgene expression. (2001) The Plant Cell, vol. 13, pp. 1047-1061.","npl_type":"a","external_id":["11340181","10.2307/3871363","pmc135561","10.1105/tpc.13.5.1047"],"record_lens_id":"018-431-597-425-763","lens_id":["050-620-755-576-333","018-431-597-425-763","044-220-012-194-545","179-658-242-386-202","054-044-980-119-932"],"sequence":4,"category":[],"us_category":[],"cited_phase":"SEA","rel_claims":[]}},{"npl":{"num":4,"text":"Ma et al. Plant antibodies for immunotherapy. (1995) Plant Physiol. vol. 109, pp. 341-346.","npl_type":"a","external_id":["10.1104/pp.109.2.341","7480334","pmc157595"],"record_lens_id":"001-945-201-684-525","lens_id":["051-357-118-713-084","001-945-201-684-525","045-710-516-008-265"],"sequence":5,"category":[],"us_category":[],"cited_phase":"SEA","rel_claims":[]}},{"patent":{"num":1,"document_id":{"jurisdiction":"US","doc_number":"5428147","kind":"A","date":"1995-06-27","name":"BARKER RICHARD F [US], et al"},"lens_id":"096-480-093-910-976","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":1}},{"patent":{"num":2,"document_id":{"jurisdiction":"US","doc_number":"2003143712","kind":"A1","date":"2003-07-31","name":"VERDIN ERIC [US], et al"},"lens_id":"055-876-201-011-518","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":2}},{"patent":{"num":3,"document_id":{"jurisdiction":"CA","doc_number":"2407460","kind":"A1","date":"2001-11-08","name":"SANGAMO BIOSCIENCES INC [US]"},"lens_id":"007-789-731-120-758","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":3}},{"patent":{"num":4,"document_id":{"jurisdiction":"EP","doc_number":"1094112","kind":"A2","date":"2001-04-25","name":"CA MINISTER AGRICULTURE & FOOD [CA]"},"lens_id":"069-718-777-092-597","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":4}},{"patent":{"num":5,"document_id":{"jurisdiction":"WO","doc_number":"9735990","kind":"A2","date":"1997-10-02","name":"HARVARD COLLEGE [US], et al"},"lens_id":"198-223-667-968-087","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":5}},{"patent":{"num":6,"document_id":{"jurisdiction":"WO","doc_number":"9837184","kind":"A1","date":"1998-08-27","name":"UNIV CALIFORNIA [US]"},"lens_id":"162-015-752-628-180","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":6}},{"patent":{"num":7,"document_id":{"jurisdiction":"WO","doc_number":"0037660","kind":"A1","date":"2000-06-29","name":"DOW AGROSCIENCES CANADA INC [CA], et al"},"lens_id":"076-321-642-910-01X","category":[],"us_category":[],"cited_phase":"APP","rel_claims":[],"sequence":7}},{"npl":{"num":1,"text":"Wade et al., \"Histone acetylation: chromatin in action\", Trends in Biochemical Sciences (1997); 22: 128-132.","npl_type":"a","external_id":["9149532","10.1016/s0968-0004(97)01016-5"],"record_lens_id":"064-043-636-996-918","lens_id":["197-117-679-015-587","064-043-636-996-918","134-152-151-724-906"],"sequence":8,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":2,"text":"Hampsey, \"A SAGA of histone acetylation and gene expression\", Trends in Genetics (1997); 13: 427-429.","npl_type":"a","external_id":["10.1016/s0168-9525(97)01292-4","9385836"],"record_lens_id":"092-940-302-703-180","lens_id":["186-327-724-324-626","092-940-302-703-180","104-429-932-897-261"],"sequence":9,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":3,"text":"Brown et al., \"The many HATs of trascription coactivators\", Trends in Biochemical Sciences (2000); 25: 15-19.","npl_type":"a","external_id":["10.1016/s0968-0004(99)01516-9","10637607"],"record_lens_id":"044-089-050-065-41X","lens_id":["089-697-663-118-790","044-089-050-065-41X","140-585-888-705-778"],"sequence":10,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":4,"text":"Ahmad et al., \"WD Repeats of the p48 Subunit of Chicken Chromatin Assembly Factor-1 Required for in Vitro Interaction with Chicken Histone Deacetylase-2\", Journal of Biological Chemistry (1999); vol. 274, No. 23: 16646-16653.","npl_type":"a","external_id":["10.1074/jbc.274.23.16646","10347232"],"record_lens_id":"095-177-067-154-064","lens_id":["120-686-408-198-955","095-177-067-154-064","115-535-906-346-288"],"sequence":11,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":5,"text":"Altschul et al., \"Gapped BLAST and PSI-BLAST: a new generation of protein database search programs\", Nucleic Acids Research (1997); vol. 25, No. 17: 3389-3402.","npl_type":"a","external_id":["pmc146917","10.1093/nar/25.17.3389","9254694"],"record_lens_id":"028-862-168-091-90X","lens_id":["101-877-037-546-211","028-862-168-091-90X","064-715-490-736-062"],"sequence":12,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":6,"text":"An et al., \"Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues\", The Plant Journal (1996); vol. 10, No. 1: 107-121.","npl_type":"a","external_id":["8758981","10.1046/j.1365-313x.1996.10010107.x"],"record_lens_id":"083-444-325-388-225","lens_id":["197-384-601-002-360","083-444-325-388-225","140-799-794-398-256"],"sequence":13,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":7,"text":"Archdeacon et al., \"A single amino acid substitution beyond the C2H2-zinc finger in Ros derepresses virulence and T-DNA genes in Agrobacterium tumefaciens\", FEMS Microbiology Letters (2000); 187: 175-178.","npl_type":"a","external_id":["10.1111/j.1574-6968.2000.tb09156.x","10.1016/s0378-1097(00)00197-x","10856653"],"record_lens_id":"086-107-115-671-382","lens_id":["094-663-388-472-36X","086-107-115-671-382","132-689-507-017-768","132-873-134-648-507","109-951-491-800-973"],"sequence":14,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":8,"text":"Bannister et al., \"The CBP co-activator is a histone acetyltransferase\", Nature (1996); vol. 384: 641-643.","npl_type":"a","external_id":["10.1038/384641a0","8967953"],"record_lens_id":"116-164-504-799-643","lens_id":["180-099-992-008-216","116-164-504-799-643","123-448-336-885-996"],"sequence":15,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":9,"text":"Beetham et al., \"A tool for functional plant genomics: Chimeric RNA/DNA oligonucleotides cause in vivo gene-specific mutations\", Proceedings of the National Academy of Sciences of USA (1999); vol. 96: 8774-8778.","npl_type":"a","external_id":["10411951","pmc17592","10.1073/pnas.96.15.8774"],"record_lens_id":"015-976-981-517-743","lens_id":["061-295-886-227-240","015-976-981-517-743","089-646-821-429-915"],"sequence":16,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":10,"text":"Berleth et al., \"Plant morphogenesis: long-distance coordination and local patterning\", Current Opinion in Plant Biology (2001); vol. 4: 57-62.","npl_type":"a","external_id":["11163169","10.1016/s1369-5266(00)00136-9"],"record_lens_id":"118-245-185-107-749","lens_id":["197-641-000-622-171","118-245-185-107-749","131-906-958-295-291"],"sequence":17,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":11,"text":"Bittinger et al., \"rosR, a Determinant of Nodulation Competitiveness in Rhizobium etli\", Molecular Plant-Microbe Interactions (1997); vol. 10, No. 2: 180-186.","npl_type":"a","external_id":["9057324","10.1094/mpmi.1997.10.2.180"],"record_lens_id":"083-216-631-601-683","lens_id":["099-586-823-214-767","083-216-631-601-683","097-684-113-315-252"],"sequence":18,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":12,"text":"Boyle et al., \"Repression of the Defense Gene PR-10alpha by the Single-Stranded DNA Binding Protein SEBF\", The Plant Cell (2001); vol. 13: 2525-2537.","npl_type":"a","external_id":["10.1105/tpc.13.11.2525","11701886","10.2307/3871592","pmc139469"],"record_lens_id":"064-903-535-488-743","lens_id":["175-440-919-866-009","064-903-535-488-743","190-111-987-147-176","127-999-738-757-213","041-609-525-076-532","064-720-869-435-148"],"sequence":19,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":13,"text":"Brandstatter et al., \"Two Genes with Similarity to Bacterial Response Regulators Are Rapidly and Specifically Induced by Cytokinin in Arabidopsis\", The Plant Cell (1998); vol. 10: 1009-1019.","npl_type":"a","external_id":["10.1105/tpc.10.6.1009","pmc144033","10.2307/3870686","9634588"],"record_lens_id":"017-938-605-864-00X","lens_id":["048-433-792-430-362","017-938-605-864-00X","199-262-195-291-618","174-219-369-237-988","041-674-298-731-795"],"sequence":20,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":14,"text":"Brightwell et al., \"Pleiotropic Effects of Regulatory ros Mutants of Agrobacterium radiobacter and Their Interaction with Fe and Glucose\", Molecular Plant-Microbe Interactions (1995); vol. 8, No. 5: 747-754.","npl_type":"a","external_id":["7579618","10.1094/mpmi-8-0747"],"record_lens_id":"135-611-374-531-817","lens_id":["142-767-597-334-444","135-611-374-531-817","147-899-270-905-168"],"sequence":21,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":15,"text":"Burge et al., \"Prediction of Complete Gene Structures in Human Genomic DNA\", Journal of Molecular Biology (1997); vol. 268: 78-94.","npl_type":"a","external_id":["10.1006/jmbi.1997.0951","9149143"],"record_lens_id":"059-157-004-313-028","lens_id":["171-752-230-007-754","059-157-004-313-028","114-639-506-770-83X"],"sequence":22,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":16,"text":"Caddick et al., \"An ethanol inducible gene switch for plants used to manipulate carbon metabolism\", Nature Biotechnology (1998); vol. 16: 177-180.","npl_type":"a","external_id":["10.1038/nbt0298-177","9487526"],"record_lens_id":"017-024-334-168-289","lens_id":["048-752-098-343-099","017-024-334-168-289","135-408-827-587-773"],"sequence":23,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":17,"text":"Carrington et al., \"Bipartite Signal Sequence Mediates Nuclear Translocation of the Plant Potyviral Nla Protein\", The Plant Cell (1991); vol. 3: 953-962.","npl_type":"a","external_id":["10.2307/3869157","pmc160062","1822993","10.1105/tpc.3.9.953"],"record_lens_id":"029-853-542-077-094","lens_id":["155-262-025-831-590","029-853-542-077-094","122-321-210-816-982","170-958-884-045-01X","009-609-554-005-864"],"sequence":24,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":18,"text":"Chou et al., \"Agrobacterium transcriptional regulator Ros is a prokaryotic zinc finger protein that regulates the plant oncogene ipt\" Proceedings of the National Academy of Sciences of USA (1998); vol. 95: 5293-5298.","npl_type":"a","external_id":["pmc20254","10.1073/pnas.95.9.5293","9560269"],"record_lens_id":"017-199-840-720-587","lens_id":["134-661-481-282-712","017-199-840-720-587","186-797-793-860-293"],"sequence":25,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":19,"text":"Chrivia et al., \"Phosphorylated CREB binds specifically to the nuclear protein CBP\", Nature (1993); vol. 365: 855-859.","npl_type":"a","external_id":["8413673","10.1038/365855a0"],"record_lens_id":"083-110-981-905-884","lens_id":["085-429-706-154-155","083-110-981-905-884","168-091-183-398-452"],"sequence":26,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":20,"text":"Clough et al., \"Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana\" The Plant Journal (1998); vol. 16, No. 6: 735-743.","npl_type":"a","external_id":["10069079","10.1046/j.1365-313x.1998.00343.x"],"record_lens_id":"049-427-391-860-033","lens_id":["198-611-696-374-282","049-427-391-860-033","161-103-756-740-018"],"sequence":27,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":21,"text":"Cooley et al., \"The virC and virD Operons of the Agrobacterium Ti Plasmid Are Regulated by the ros Chromosomal Gene: Analysis of the Cloned ros Gene\" Journal of Bacteriology (1991); vol. 173, No. 8: 2608-2616.","npl_type":"a","external_id":["2013576","pmc207827","10.1128/jb.173.8.2608-2616.1991"],"record_lens_id":"008-088-251-152-069","lens_id":["053-364-447-306-111","008-088-251-152-069","073-841-458-369-649"],"sequence":28,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":22,"text":"D'Souza-Ault et al., \"Analysis of the Ros Repressor of Agrobacterium virC and virD Operons: Molecular Intercommunication between Plasmid and Chromosomal Genes\" Journal of Bateriology (1993); vol. 175, No. 11: 3486-3490.","npl_type":"a","external_id":["10.1128/jb.175.11.3486-3490.1993","8501053","pmc204748"],"record_lens_id":"026-224-177-733-266","lens_id":["098-339-587-567-311","026-224-177-733-266","100-431-399-340-453"],"sequence":29,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":23,"text":"Eisner et al., \"Analysis of Arabidopsis thaliana transgenic plants transformed with CER2 and CER3 genes in sense and antisense orientations\" Theoretical and Applied Genetics (1998); vol. 97: 801-809.","npl_type":"a","external_id":["10.1007/s001220050959"],"record_lens_id":"039-781-850-567-784","lens_id":["179-687-142-031-212","039-781-850-567-784"],"sequence":30,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":24,"text":"Emiliani et al., \"Characterization of a human RPD3 ortholog, HDAC3\", Proceedings of the National Academy of Sciences of USA (1998); vol. 95: 2795-2800.","npl_type":"a","external_id":["9501169","10.1073/pnas.95.6.2795","pmc19648"],"record_lens_id":"057-200-282-690-358","lens_id":["183-289-687-045-009","057-200-282-690-358","191-894-356-124-656"],"sequence":31,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":25,"text":"Fischle et al., \"A New Family of Human Histone Deacetylases Related to Saccharomyces cerevisiae HDA1p\" The Journal of Biological Chemistry (1999); vol. 274, No. 17: 11713-11720.","npl_type":"a","external_id":["10.1074/jbc.274.17.11713","10206986"],"record_lens_id":"065-709-632-713-727","lens_id":["067-242-547-837-254","065-709-632-713-727","082-294-569-216-684"],"sequence":32,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":26,"text":"Fukaki et al., \"Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis thaliana\" The Plant Journal (1998); vol. 14, No. 4: 425-430.","npl_type":"a","external_id":["10.1046/j.1365-313x.1998.00137.x","9670559"],"record_lens_id":"042-806-273-270-054","lens_id":["194-533-604-557-502","042-806-273-270-054","131-528-933-494-766"],"sequence":33,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":27,"text":"Gao et al., \"Regulation and characterization of four CBF transcription factors from Brassica napus\", Plant Molecular Biology (2002); vol. 49, 459-471.","npl_type":"a","external_id":["12090622","10.1023/a:1015570308704"],"record_lens_id":"025-952-701-798-197","lens_id":["047-354-681-935-307","025-952-701-798-197","125-943-293-416-778"],"sequence":34,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":28,"text":"Gao et al., \"Expression of the extrinsic 23-kDa protein of photosystem II in response to salt stress is associated with the K+/Na+ discrimination locus Kna 1 in wheat\", Plant Cell Reports (2001); vol. 20: 774-778.","npl_type":"a","external_id":["10.1007/s00299-001-0409-9"],"record_lens_id":"041-865-741-701-024","lens_id":["129-044-099-839-765","041-865-741-701-024"],"sequence":35,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":29,"text":"Gao et al., \"A novel protein from Brassica napus has a putative KID domain and responds to low temperature\", The Plant Journal (2003); vol. 33: 1073-1086.","npl_type":"a","external_id":["10.1046/j.1365-313x.2003.01694.x","12631331"],"record_lens_id":"037-063-959-980-872","lens_id":["174-583-479-978-585","037-063-959-980-872","160-566-416-454-685"],"sequence":36,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":30,"text":"Gatz, Christiane, \"Chemical Control of Gene Expression\", Annual Review Plant Physiology and Plant Molecular Biology (1997); vol. 48: 89-108.","npl_type":"a","external_id":["10.1146/annurev.arplant.48.1.89","15012258"],"record_lens_id":"059-076-073-246-59X","lens_id":["109-712-577-723-333","059-076-073-246-59X","177-897-163-029-536"],"sequence":37,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":31,"text":"Gatz et al., \"Promoters that respond to chemical inducers\", Trends in Plant Science (1998); vol. 3, No. 9: 352-358.","npl_type":"a","external_id":["10.1016/s1360-1385(98)01287-4"],"record_lens_id":"087-530-835-462-954","lens_id":["133-618-199-379-852","087-530-835-462-954"],"sequence":38,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":32,"text":"Gelmetti et al., \"Aberrant Recruitment of the Nuclear Receptor Corepressor-Histone Deacetylase Complex by the Acute Myeloid Leukemia Fusion Partner ETO\" Molecular and Cellular Biology (1998); vol. 18, No. 12: 7185-7191.","npl_type":"a","external_id":["9819405","pmc109300","10.1128/mcb.18.12.7185"],"record_lens_id":"074-334-035-108-375","lens_id":["196-945-354-378-651","074-334-035-108-375","182-485-655-051-182"],"sequence":39,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":33,"text":"Gonzalez et al., \"Characterization of Motifs Which Are Critical for Activity of the Cyclic AMP-Responsive Transcription Factor CREB\", Molecular and Cellular Biology (1991); vol. 11, No. 3: 1306-1312.","npl_type":"a","external_id":["1671708","pmc369401","10.1128/mcb.11.3.1306-1312.1991","10.1128/mcb.11.3.1306"],"record_lens_id":"010-362-108-654-075","lens_id":["191-917-212-976-525","010-362-108-654-075","194-918-356-859-831","115-779-303-666-515","126-449-794-136-320"],"sequence":40,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":34,"text":"Gonzalez et al., \"Cyclic AMP Stimulates Somatostatin Gene Transcription by Phosphorylation of CREB at Serine 133\" Cell (1989); vol. 59: 675-680.","npl_type":"a","external_id":["2573431","10.1016/0092-8674(89)90013-5"],"record_lens_id":"160-196-693-691-034","lens_id":["181-825-169-138-153","160-196-693-691-034","176-493-434-432-662"],"sequence":41,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":35,"text":"Grustein, Michael, \"Histone acetylation in chromatin structure and transcription\", Nature (1997): vol. 389: 349-352.","npl_type":"a","external_id":["9311776","10.1038/38664"],"record_lens_id":"098-319-331-961-747","lens_id":["144-946-748-059-475","098-319-331-961-747","120-338-564-335-658"],"sequence":42,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":36,"text":"Hart et al., \"A 61 bp enhancer element of the tobacco beta-1,3-glucanase B gene interacts with one or more regulated nuclear proteins\", Plant Molecular Biology (1993); vol. 21: 121-131.","npl_type":"a","external_id":["8425042","10.1007/bf00039623"],"record_lens_id":"074-850-497-496-537","lens_id":["101-832-293-975-489","074-850-497-496-537","137-079-605-148-925"],"sequence":43,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":37,"text":"Hassig et al., \"Histone Deacetylase Activity Is Required for Full Transcriptional Repression by mSin3A\", Cell (1997); vol. 89: 341-347.","npl_type":"a","external_id":["10.1016/s0092-8674(00)80214-7","9150133"],"record_lens_id":"080-381-325-395-447","lens_id":["097-463-024-450-293","080-381-325-395-447","195-020-422-411-345"],"sequence":44,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":38,"text":"Hassig et al., \"Nuclear histone acetylases and deacetylases and transcriptional regulation: HATs off to HDAC's\", Current Opinion in Chemical Biology (1997); vol. 1: 300-308.","npl_type":"a","external_id":["9667866","10.1016/s1367-5931(97)80066-x"],"record_lens_id":"029-829-455-514-532","lens_id":["134-718-616-696-168","029-829-455-514-532","102-352-198-875-563"],"sequence":45,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":39,"text":"Hassig et al., \"A role for histone deacetylase activity in HDAC1-mediated transcriptional repression\", Proceedings of the National Academy of Sciences of USA (1998); vol. 95: 3519-3524.","npl_type":"a","external_id":["10.1073/pnas.95.7.3519","9520398","pmc19868"],"record_lens_id":"103-475-762-035-546","lens_id":["105-222-961-499-383","103-475-762-035-546","140-527-838-584-802"],"sequence":46,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":40,"text":"Helarlutta et al., \"The SHORT-ROOT Gene Controls Radial Patterning of the Arabidopsis Root through Radial Signaling\", Cell (2000); vol. 101: 555-567.","npl_type":"a","external_id":["10.1016/s0092-8674(00)80865-x","10850497"],"record_lens_id":"058-490-800-347-563","lens_id":["133-893-235-012-801","058-490-800-347-563","157-840-944-136-34X"],"sequence":47,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":41,"text":"Holtorf et al., \"Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana\", Plant Molecular Biology (1995); vol. 29, 637-646.","npl_type":"a","external_id":["8541491","10.1007/bf00041155"],"record_lens_id":"093-066-559-415-131","lens_id":["159-497-130-430-600","093-066-559-415-131","187-630-050-157-750"],"sequence":48,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":42,"text":"Hurley et al., \"Regulation of Changes in Cytosolic Ca2+and Na+Concentrations in Rat Submandibular Gland Acini Exposed to Carbachol and ATP\", Journal of Cellular Physiology (1996); vol. 168: 229-238.","npl_type":"a","external_id":["10.1002/(sici)1097-4652(199608)168:2<229::aid-jcp1>3.3.co;2-8","10.1002/(sici)1097-4652(199608)168:2<229::aid-jcp1>3.0.co;2-r","8707858"],"record_lens_id":"009-713-693-305-824","lens_id":["062-689-124-632-328","009-713-693-305-824","082-532-326-395-594","015-308-749-908-711","078-715-088-583-342"],"sequence":49,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":43,"text":"Jofuku et al., \"Control of Arabidopsis Flower and Seed Development by the Homeotic Gene APETALA2\", The Plant Cell (1994); vol. 6: 1211-1225.","npl_type":"a","external_id":["10.1105/tpc.6.9.1211","pmc160514","0007919989","10.2307/3869820","7919989"],"record_lens_id":"054-717-847-531-788","lens_id":["165-784-917-194-305","054-717-847-531-788","096-556-194-595-029","153-478-082-166-398","193-485-332-587-993"],"sequence":50,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":44,"text":"Johnson et al., \"Histone deacetylases: complex transducers of nuclear signals\", Cell & Development Biology (1999); vol. 10: 179-188.","npl_type":"a","external_id":["10441071","10.1006/scdb.1999.0299"],"record_lens_id":"002-857-102-718-394","lens_id":["180-147-217-764-225","002-857-102-718-394","176-996-606-512-314"],"sequence":51,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":45,"text":"Johnson et al., \"Activation domains of transcriptional regulatory proteins\", Journal of Nutritional Biochemistry (1993); vol. 4: 386-398.","npl_type":"a","external_id":["10.1016/0955-2863(93)90069-9"],"record_lens_id":"013-232-380-588-453","lens_id":["143-719-681-213-901","013-232-380-588-453"],"sequence":52,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":46,"text":"Kadosh et al., \"Repression by Une6 Involves Recruitment of a Complex Containing Sin3 Corepressor and Rpd3 Histone Deacetylase to Target Promoters\", Cell (1997); vol. 89: 365-371.","npl_type":"a","external_id":["10.1016/s0092-8674(00)80217-2","9150136"],"record_lens_id":"005-989-735-982-906","lens_id":["022-607-913-469-671","005-989-735-982-906","055-683-800-150-64X"],"sequence":53,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":47,"text":"Kakimoto, Tatsuo, \"CKI1, a Histidine Kinase Homolog Implicated in Cytokinin Signal Transduction\", Science (1996); vol. 274: 982-985.","npl_type":"a","external_id":["10.1126/science.274.5289.982","8875940"],"record_lens_id":"161-955-228-906-141","lens_id":["169-149-885-400-938","161-955-228-906-141","174-801-104-398-480"],"sequence":54,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":48,"text":"Kapila et al., \"An Agrobacterium-mediated transient gene expression system for intact leaves\", Plant Science (1997); vol. 122: 101-108.","npl_type":"a","external_id":["10.1016/s0168-9452(96)04541-4"],"record_lens_id":"012-723-265-483-103","lens_id":["174-484-877-373-705","012-723-265-483-103"],"sequence":55,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":49,"text":"Kaya et al., \"FASCIATA Genes for Chromatin Assembly Factor-1 in Arabidopsis Maintain the Cellular Organization of Apical Meristems\", Cell (2001); vol. 104: 131-142.","npl_type":"a","external_id":["10.1016/s0092-8674(01)00197-0","11163246"],"record_lens_id":"015-325-147-570-017","lens_id":["101-153-664-973-69X","015-325-147-570-017","018-487-601-288-363"],"sequence":56,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":50,"text":"Keller et al., \"Molecular Analysis of the Rhizobium meliloti mucR Gene Regulating the Biosynthesis of the Exopolysaccharides Succinoglycan and Galactoglucan\", Molecular Plant-Microbe Interactions (1995); vol. 8, No. 2: 267-277.","npl_type":"a","external_id":["10.1094/mpmi-8-0267","7756693"],"record_lens_id":"043-506-891-639-033","lens_id":["110-503-390-623-169","043-506-891-639-033","183-703-905-359-219"],"sequence":57,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":51,"text":"Khochbin et al., \"The origin and utility of histone deacetylases\", FEBS Letters (1997); vol. 419: 157-160.","npl_type":"a","external_id":["9428625","10.1016/s0014-5793(97)01423-3"],"record_lens_id":"115-940-619-385-400","lens_id":["138-592-029-893-92X","115-940-619-385-400","146-750-615-574-586"],"sequence":58,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":52,"text":"Knight et al., \"Cold Calcium Signaling in Arabidopsis Involves Two Cellular Pools and a Change in Calcium Signature after Acclimation\", The Plant Cell (1996); vol. 8: 489-503.","npl_type":"a","external_id":["8721751","pmc161115","10.1105/tpc.8.3.489","10.2307/3870327"],"record_lens_id":"030-484-977-291-852","lens_id":["194-511-842-942-177","030-484-977-291-852","133-508-944-262-949","138-664-882-085-866","152-212-990-101-798"],"sequence":59,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":53,"text":"Kohno-Murase et al., \"Effects of an antisense napin gene on seed storage compounds in transgenic Brassica napus seeds\", Plant Molecular Biology (1994); vol. 26: 1115-1124.","npl_type":"a","external_id":["10.1007/bf00040693","7811970"],"record_lens_id":"039-287-961-915-16X","lens_id":["098-171-353-996-520","039-287-961-915-16X","127-015-844-300-685"],"sequence":60,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":54,"text":"Kölle et al., \"Substrate and sequential site specificity of cytoplasmic histone acetyltransferases of maize and rat liver\", FEBS Letters (1998); vol. 421: 109-114.","npl_type":"a","external_id":["10.1016/s0014-5793(97)01544-5","9468289"],"record_lens_id":"009-807-545-686-01X","lens_id":["076-545-938-245-947","009-807-545-686-01X","069-390-973-961-79X"],"sequence":61,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":55,"text":"Kuo et al., \"Roles of histone acetyltransferases and deacetylases in gene regulation\", BioEssays (1998); vol. 20: 615-626.","npl_type":"a","external_id":["9780836","10.1002/(sici)1521-1878(199808)20:8<615::aid-bies4>3.0.co;2-h"],"record_lens_id":"051-659-010-076-734","lens_id":["144-623-440-081-696","051-659-010-076-734","120-787-737-658-353"],"sequence":62,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":56,"text":"Laurenzio et al., \"The Scarecrow Gene Regulates an Asymmetric Cell Division That is Essential for Generating the Radial Organization of the Arabidopsis Root\", Cell (1996); vol. 86: 423-433.","npl_type":"a","external_id":["10.1016/s0092-8674(00)80115-4","8756724"],"record_lens_id":"024-570-998-430-982","lens_id":["166-653-579-223-551","024-570-998-430-982","139-178-779-904-539"],"sequence":63,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":57,"text":"Liscum et al., \"Phototropism: A \"Simple\" Physiological Response Modulated by Multiple Interacting Photosensory-response Pathways\", Photochemistry and Photobiology (2000); vol. 72, No. 3: 273-282.","npl_type":"a","external_id":["10.1562/0031-8655(2000)072<0273:pasprm>2.0.co;2","10.1562/0031-8655(2000)0720273pasprm2.0.co2","10989595"],"record_lens_id":"025-811-966-461-785","lens_id":["119-209-865-174-88X","025-811-966-461-785","144-710-188-060-679","158-264-455-635-758","036-528-451-782-913"],"sequence":64,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":58,"text":"Lotan et al., \"Arabidopsis Leafy Cotyledonl Is Sufficient to Induce Embryo Development in Vegetative Cells\", Cell (1998); vol. 93: 1195-1205.","npl_type":"a","external_id":["10.1016/s0092-8674(00)81463-4","9657152"],"record_lens_id":"076-683-176-822-263","lens_id":["156-886-429-224-350","076-683-176-822-263","092-302-772-971-933"],"sequence":65,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":59,"text":"Lusser et al., \"Histone acetylation: lessons from the plant kingdom\", Trends in Plant Science (2001); vol. 6, No. 2: 59-65.","npl_type":"a","external_id":["10.1016/s1360-1385(00)01839-2","11173289"],"record_lens_id":"003-002-782-590-410","lens_id":["148-336-238-871-68X","003-002-782-590-410","189-595-236-250-760"],"sequence":66,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":60,"text":"Mandel et al., \"Definition of constitutive gene expression in plants: the translation initiation factor 4A gene as a model\", Plant Molecular Biology (1995); vol. 29: 995-1004.","npl_type":"a","external_id":["8555462","10.1007/bf00014972"],"record_lens_id":"018-396-251-879-433","lens_id":["140-353-028-083-662","018-396-251-879-433","139-806-569-386-045"],"sequence":67,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":61,"text":"Meyer et al., \"The Promoter of the Gene Encoding 3',5'-Cyclic Adenosine Monophosphate (cAMP) Response Element Binding Protein Contains cAMP Response Elements: Evidence for Positivie Autoregulation of Gene Transcription\", Endocrinology (1993); vol. 132, No. 2: 770-780.","npl_type":"a","external_id":["10.1210/en.132.2.770","8381074","10.1210/endo.132.2.8381074"],"record_lens_id":"071-893-581-859-987","lens_id":["116-715-682-472-262","071-893-581-859-987","059-634-823-105-555","153-026-100-153-287","164-358-644-449-166"],"sequence":68,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":62,"text":"Miki et al., \"Fundamentals of gene transfer in plants\", In Plant Metabolism, 2nd edition (1997); DT Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison Wesly, Langmans Ltd., London: 561-579.","npl_type":"a","external_id":[],"lens_id":[],"sequence":69,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":63,"text":"Monroy et al., \"Low-Temperature Signal Transduction: Induction of Cold Acclimation-Specific Genes of Alfalfa by Calcium at 25° C.\", The Plant Cell (1995); vol. 7: 321-331.","npl_type":"a","external_id":["10.1105/tpc.7.3.321","10.2307/3869854","7734966","pmc160785"],"record_lens_id":"033-844-639-354-609","lens_id":["142-107-486-745-132","033-844-639-354-609","056-031-627-286-22X","147-219-638-302-196","134-987-714-309-577"],"sequence":70,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":64,"text":"Montminy, Marc, \"Transcriptional Regulation by Cyclic AMP\", Annual Review of Biochemistry (1997); vol. 66: 807-822.","npl_type":"a","external_id":["9242925","10.1146/annurev.biochem.66.1.807"],"record_lens_id":"019-088-454-127-778","lens_id":["155-749-833-130-818","019-088-454-127-778","178-188-625-550-858"],"sequence":71,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":65,"text":"Murashige et al., \"A Revised Medium for Rapid Growth and Bio Assays with Tabacco Tissue Cultures\", Physiologia Plantarum (1962); vol. 15: 473-497.","npl_type":"a","external_id":["10.1111/j.1399-3054.1962.tb08052.x"],"record_lens_id":"077-580-667-120-981","lens_id":["169-950-771-932-833","077-580-667-120-981"],"sequence":72,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":66,"text":"Murfett et al., \"Identification of Arabidopsis Histone Deacetylase HDA6 Mutants That Affect Transgene Expression\", The Plant Cell (2001); vol. 13: 1047-1061.","npl_type":"a","external_id":["11340181","10.2307/3871363","pmc135561","10.1105/tpc.13.5.1047"],"record_lens_id":"018-431-597-425-763","lens_id":["050-620-755-576-333","018-431-597-425-763","044-220-012-194-545","179-658-242-386-202","054-044-980-119-932"],"sequence":73,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":67,"text":"Murray et al., \"Codon usage in plant genes\", Nucleic Acids Research (1989); vol. 17, No. 2: 477-498.","npl_type":"a","external_id":["10.1093/nar/17.2.477","pmc331598","2644621"],"record_lens_id":"024-898-864-464-879","lens_id":["165-872-661-891-245","024-898-864-464-879","180-538-531-176-999"],"sequence":74,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":68,"text":"Nakai et al., \"A Knowledge Base for Predicting Protein Localization Sites in Eukaryotic Cells\", Genomics (1992); vol. 14: 897-911.","npl_type":"a","external_id":["10.1016/s0888-7543(05)80111-9","pmc7134799","1478671"],"record_lens_id":"045-918-073-024-145","lens_id":["131-704-280-958-040","045-918-073-024-145","051-661-192-858-747"],"sequence":75,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":69,"text":"Nakajima et al., \"Intercellular movement of the putative transciption factor SHR in root patterning\", Nature (2001); vol. 413: 307-311.","npl_type":"a","external_id":["10.1038/35095061","11565032"],"record_lens_id":"096-189-341-036-701","lens_id":["155-486-883-172-010","096-189-341-036-701","104-384-692-833-288"],"sequence":76,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":70,"text":"Odell et al., \"Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter\", Nature (1985); vol. 313: 810-812.","npl_type":"a","external_id":["10.1038/313810a0","3974711"],"record_lens_id":"058-816-599-846-72X","lens_id":["095-247-794-897-551","058-816-599-846-72X","121-019-049-026-891"],"sequence":77,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":71,"text":"Ogas et al., \"Cellular Differentiation Regulated by Gibberellin in the Arabidopsis thaliana pickle Mutant\", Science (1997); vol. 277: 91-94.","npl_type":"a","external_id":["9204906","10.1126/science.277.5322.91"],"record_lens_id":"000-153-458-859-763","lens_id":["087-797-430-127-106","000-153-458-859-763","031-940-934-146-551"],"sequence":78,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":72,"text":"Ogryzko et al., \"The Transcriptional Coactivators p300 and CBP Are Histone Acetyltransferases\", Cell (1996); vol. 87: 953-959.","npl_type":"a","external_id":["8945521","10.1016/s0092-8674(00)82001-2"],"record_lens_id":"186-909-550-342-962","lens_id":["189-547-661-372-439","186-909-550-342-962","192-437-604-414-074"],"sequence":79,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":73,"text":"Pazin et al., \"What's up and Down with Histone Deacetylation and Transcription?\", Cell (1997); vol. 89: 325-328.","npl_type":"a","external_id":["10.1016/s0092-8674(00)80211-1","9150131"],"record_lens_id":"100-519-269-573-597","lens_id":["153-094-839-430-742","100-519-269-573-597","106-270-987-797-277"],"sequence":80,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":74,"text":"Pysh et al., \"The GRAS gene family in Arabidopsis: sequence characterization and basic expression analysis of the Scarecrow-Like genes\", The Plant Journal (1999); vol. 18, No. 1: 111-119.","npl_type":"a","external_id":["10341448","10.1046/j.1365-313x.1999.00431.x"],"record_lens_id":"085-241-134-805-527","lens_id":["154-910-252-800-416","085-241-134-805-527","143-806-852-570-811"],"sequence":81,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":75,"text":"Quinn, Patrick G., \"Distinct Activation Domains with cAMP Response Element-binding Protein (CREB) Mediate Basal and cAMP-stimulated Transcription\", The Journal of Biological Chemistry (1993); vol. 268, No. 23: 16999-17009.","npl_type":"a","external_id":["8394325","10.1016/s0021-9258(19)85293-6"],"record_lens_id":"055-697-486-209-419","lens_id":["193-582-384-370-176","055-697-486-209-419","155-357-354-061-509"],"sequence":82,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":76,"text":"Ridgway et al., \"CAF-1 and the inheritance of chromatin states: at the crossroads of DNA replication and repair\", Journal of Cell Science (2000); vol. 113: 2647-2658.","npl_type":"a","external_id":["10893180","10.1242/jcs.113.15.2647"],"record_lens_id":"009-401-201-767-385","lens_id":["057-857-666-911-590","009-401-201-767-385","159-143-856-364-245"],"sequence":83,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":77,"text":"Rizzo et al., \"Unique Strains of SV40 in Commercial Poliovaccines from 1995 Not Readily Indetifiable with Current Testing for SV40 Infection\", Cancer Research (1999); vol. 59: 6103-6108.","npl_type":"a","external_id":["10626798"],"record_lens_id":"106-289-870-622-393","lens_id":["120-253-711-397-865","106-289-870-622-393"],"sequence":84,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":78,"text":"Robbins et al., \"Two Interdependent Basic Domains in Nucleoplasmin Nuclear Targeting Sequence: Identification of a Class of Bipartite Nuclear Targeting Sequence\", Cell (1991); vol. 64: 615-623.","npl_type":"a","external_id":["1991323","10.1016/0092-8674(91)90245-t"],"record_lens_id":"052-850-864-972-243","lens_id":["174-204-975-785-747","052-850-864-972-243","103-599-252-766-060"],"sequence":85,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":79,"text":"Rundlett et al., \"HDA1 and RPD3 are members of distinct yeast histone deacetylase complexes that regulate silencing and transcription\", Proceedings of the National Academy of Sciences in the USA (1996); vol. 93: 14503-14508.","npl_type":"a","external_id":["8962081","10.1073/pnas.93.25.14503","pmc26162"],"record_lens_id":"026-801-881-909-373","lens_id":["113-002-035-595-216","026-801-881-909-373","130-895-592-574-677"],"sequence":86,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":80,"text":"Salter et al., \"Characterization of the ethanol-inducible alc gene expression system for transgenic plants\", The Plant Journal (1998); vol. 16, No. 1: 127-132.","npl_type":"a","external_id":["10.1046/j.1365-313x.1998.00281.x"],"record_lens_id":"062-175-962-486-94X","lens_id":["099-319-381-566-733","062-175-962-486-94X"],"sequence":87,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":81,"text":"Sardana et al., \"Construction and rapid testing of synthetic and modified toxin gene sequences CrylA (b & c) by expression in maize endosperm culture\", Plant Cell Reports (1996); vol. 15: 677-681.","npl_type":"a","external_id":["24178609","10.1007/s002990050097","10.1007/bf00231923"],"record_lens_id":"083-395-400-718-020","lens_id":["117-722-068-487-095","083-395-400-718-020","184-088-287-439-223","162-060-412-257-494","098-088-029-938-671"],"sequence":88,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":82,"text":"Scheres et al., \"Mutations affecting the radial organisation of the Arabidopsis root display specific defects throughout the embryonic axis\", Development (1995); vol. 121: 53-62.","npl_type":"a","external_id":[],"lens_id":[],"sequence":89,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":83,"text":"Schumacher et al., \"The Lateral suppressor (Ls) gene of tomato encodes a new member of the VHI1D protein family\", Proceeding of the National Academy of Sciences in the USA (1999); vol. 96: 290-295.","npl_type":"a","external_id":["9874811","10.1073/pnas.96.1.290","pmc15132"],"record_lens_id":"001-411-364-708-791","lens_id":["013-098-771-016-597","001-411-364-708-791","146-476-090-243-100"],"sequence":90,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":84,"text":"Shaywitz et al., \"Magnitude of the CREB-Dependent Transcriptional Response Is Determined by the Strength of the Interaction between the Kinase-Inducible Domain of CREB and the KIX Domain of CREB-Binding Protein\", Molecular and Cellular Biology (2000); vol. 20, No. 24: 9409-9422.","npl_type":"a","external_id":["11094091","10.1128/mcb.20.24.9409-9422.2000","pmc102197"],"record_lens_id":"022-851-380-453-996","lens_id":["105-462-643-441-605","022-851-380-453-996","066-711-056-405-265"],"sequence":91,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":85,"text":"Silverstone et al., \"The Arabidopsis RGA Gene Encodes a Transcriptional Regulator Repressing the Gibberellin Signal Transduction Pathway\", The Plant Cell (1998); vol. 10: 155-169.","npl_type":"a","external_id":["pmc143987","10.2307/3870695","9490740","10.1105/tpc.10.2.155"],"record_lens_id":"066-841-070-214-815","lens_id":["127-182-383-461-432","066-841-070-214-815","130-548-090-039-301","077-784-906-602-094","153-869-949-394-616"],"sequence":92,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":86,"text":"Stockinger et al., \"Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit\", Proceedings of the National Academy of Science in the USA (1997); vol. 94: 1035-1040.","npl_type":"a","external_id":["pmc19635","10.1073/pnas.94.3.1035","9023378"],"record_lens_id":"019-583-008-127-127","lens_id":["065-429-348-203-926","019-583-008-127-127","173-625-496-748-622"],"sequence":93,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":87,"text":"Stockinger et al., \"Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interactions with CBF1, a transcriptional activator involved in cold-regulated gene expression\", Nucleic Acids Research (2001), vol. 29, No. 7: 1524-1533.","npl_type":"a","external_id":["pmc31267","10.1093/nar/29.7.1524","11266554"],"record_lens_id":"123-860-754-291-319","lens_id":["134-577-245-840-32X","123-860-754-291-319","170-181-354-129-531"],"sequence":94,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":88,"text":"Struhl, Kevin, \"Histone acetylation and transcriptional regulatory mechanisms\", Genes & Development (1998); vol. 12: 599-606.","npl_type":"a","external_id":["9499396","10.1101/gad.12.5.599"],"record_lens_id":"033-164-720-671-426","lens_id":["076-087-812-441-162","033-164-720-671-426","115-825-572-182-812"],"sequence":95,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":89,"text":"Tian et al., \"Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development\", Proceedings of the National Academy of Sciences (2001); vol. 98, No. 1: 200-205.","npl_type":"a","external_id":["11134508","10.1073/pnas.011347998","pmc14568","10.1073/pnas.98.1.200"],"record_lens_id":"024-572-491-835-429","lens_id":["191-497-516-892-322","024-572-491-835-429","123-118-968-014-660","035-728-657-793-335","137-421-513-048-178"],"sequence":96,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":90,"text":"Tian et al., \"Arabidopsis SHY2/IAA3 Inhibits Auxin-Regulated Gene Expression\", The Plant Cell (2002); vol. 14: 301-319.","npl_type":"a","external_id":["10.1105/tpc.010283","11884676","pmc152914"],"record_lens_id":"064-402-238-229-037","lens_id":["174-943-285-673-288","064-402-238-229-037","088-215-966-154-835"],"sequence":97,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":91,"text":"Ulmasov et al., \"Aux/IAA Proteins Repress Expression of Reporter Genes Containing Natural and Highly Active Synthetic Auxin Response Elements\", The Plant Cell (1997); vol. 9: 1963-1971.","npl_type":"a","external_id":["pmc157050","9401121","10.2307/3870557","10.1105/tpc.9.11.1963"],"record_lens_id":"083-882-258-449-576","lens_id":["119-667-044-653-726","083-882-258-449-576","105-126-177-943-25X","104-046-666-360-008","031-905-473-558-786"],"sequence":98,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":92,"text":"van der Krol et al., \"The Basic Domain of Plant B-ZIP Proteins Facilitates Import of a Reporter Protein into Plant Nuclei\", The Plant Cell (1991); vol. 3: 667-675.","npl_type":"a","external_id":["pmc160034","1841723","10.1105/tpc.3.7.667"],"record_lens_id":"087-524-513-247-951","lens_id":["106-924-104-067-773","087-524-513-247-951","186-328-812-626-661"],"sequence":99,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":93,"text":"Varagona et al., \"Monocot Regulatory Protein Opaque-2 Is Localized in the Nucleus of Maize Endosperm and Transformed Tobacco Plant\", The Plant Cell (1991); vol. 3: 105-113.","npl_type":"a","external_id":["10.1105/tpc.3.2.105","pmc159983","1840902","10.2307/3869280"],"record_lens_id":"035-440-333-517-817","lens_id":["113-420-065-067-926","035-440-333-517-817","119-889-971-772-359","170-262-826-903-789","193-943-130-066-79X"],"sequence":100,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":94,"text":"Varagona et al., \"Nuclear Localization Signal(s) Required for Nuclear Targeting in the Maize Regulatory Protein Opaque-2\", The Plant Cell (1992); vol. 4: 1213-1227.","npl_type":"a","external_id":["pmc160209","1332794","10.1105/tpc.4.10.1213","10.2307/3869408"],"record_lens_id":"111-057-761-984-57X","lens_id":["142-319-014-617-970","111-057-761-984-57X","170-089-598-617-994","141-637-343-859-943","156-307-634-280-715"],"sequence":101,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":95,"text":"Verbsky et al., \"Chromatin remodeling in plants\", Current Opinion in Plant Biology (2001); vol. 4: 494-500.","npl_type":"a","external_id":["10.1016/s1369-5266(00)00206-5","11641064"],"record_lens_id":"113-061-355-538-843","lens_id":["191-330-017-351-930","113-061-355-538-843","173-073-528-075-248"],"sequence":102,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":96,"text":"Verdel et al., \"Identification of a New Family of Higher Eukaryotic Histone Deacetylases\", The Journal of Biological Chemistry (1999); vol. 274, No. 4: 2440-2445.","npl_type":"a","external_id":["10.1074/jbc.274.4.2440","9891014"],"record_lens_id":"062-860-867-423-428","lens_id":["076-497-824-557-674","062-860-867-423-428","117-040-286-318-814"],"sequence":103,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":97,"text":"Vidal et al., \"RPD3 Encodes a Second Factor Required To Achieve Maximum Positive and Negative Transcriptional States in Saccharomyces cervisiae\", Molecular and Cellular Biology (1991); vol. 11, No. 12: 6317-6327.","npl_type":"a","external_id":["10.1128/mcb.11.12.6317-6327.1991","1944291","pmc361826","10.1128/mcb.11.12.6317"],"record_lens_id":"015-641-473-550-200","lens_id":["023-398-219-225-384","015-641-473-550-200","129-956-893-950-657","048-668-865-861-996","066-672-270-613-39X"],"sequence":104,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":98,"text":"Weissbach et al. (1999), Methods for Plant Molecular Biology, Academy Press, New York VIII: 421-463.","npl_type":"a","external_id":[],"lens_id":[],"sequence":105,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}},{"npl":{"num":99,"text":"Wu et al., \"Functional analysis of a RPD3 histone deacetylase homologue in Arabidopsis thaliana\", Plant Molecular Biology (2000); vol. 44: 167-176.","npl_type":"a","external_id":["10.1023/a:1006498413543","11117260"],"record_lens_id":"052-714-635-788-841","lens_id":["194-558-550-933-197","052-714-635-788-841","103-308-801-150-662"],"sequence":106,"category":[],"us_category":[],"cited_phase":"APP","rel_claims":[]}}],"reference_cited.source":"DOCDB","reference_cited.patent_count":8,"cites_patent":true,"reference_cited.npl_count":103,"reference_cited.npl_resolved_count":100,"cites_npl":true,"cites_resolved_npl":true,"cited_by":{"patent_count":0,"patent":[]},"cited_by_patent":false,"family":{"simple":{"size":2,"id":217020985,"member":[{"lens_id":"073-814-191-377-880","document_id":{"jurisdiction":"US","doc_number":"20050278809","kind":"A1","date":"2005-12-15"}},{"lens_id":"006-576-968-901-581","document_id":{"jurisdiction":"US","doc_number":"7553667","kind":"B2","date":"2009-06-30"}}]},"extended":{"size":11,"id":184067373,"member":[{"lens_id":"001-008-207-148-719","document_id":{"jurisdiction":"US","doc_number":"20060123506","kind":"A1","date":"2006-06-08"}},{"lens_id":"016-415-498-903-130","document_id":{"jurisdiction":"WO","doc_number":"2003104462","kind":"A3","date":"2004-05-06"}},{"lens_id":"159-198-359-809-467","document_id":{"jurisdiction":"CA","doc_number":"2488697","kind":"C","date":"2010-05-25"}},{"lens_id":"122-915-377-429-595","document_id":{"jurisdiction":"CA","doc_number":"2535696","kind":"A1","date":"2006-08-22"}},{"lens_id":"006-576-968-901-581","document_id":{"jurisdiction":"US","doc_number":"7553667","kind":"B2","date":"2009-06-30"}},{"lens_id":"151-449-542-337-210","document_id":{"jurisdiction":"AU","doc_number":"2003233720","kind":"A1","date":"2003-12-22"}},{"lens_id":"091-818-186-906-099","document_id":{"jurisdiction":"WO","doc_number":"2003104462","kind":"A2","date":"2003-12-18"}},{"lens_id":"161-302-400-369-467","document_id":{"jurisdiction":"AU","doc_number":"2006200381","kind":"A1","date":"2006-09-07"}},{"lens_id":"073-814-191-377-880","document_id":{"jurisdiction":"US","doc_number":"20050278809","kind":"A1","date":"2005-12-15"}},{"lens_id":"037-073-042-385-325","document_id":{"jurisdiction":"US","doc_number":"7582807","kind":"B2","date":"2009-09-01"}},{"lens_id":"081-488-493-332-185","document_id":{"jurisdiction":"CA","doc_number":"2488697","kind":"A1","date":"2003-12-18"}}]}},"sequence":{"seq_list_key":"US_7553667_B2","type":["N","P"],"length_bucket":["NT_1_100","NT_101_5000","AA_301","AA_1_50","AA_51_300"],"length":[5,7,8,136,9,137,10,138,11,142,143,16,17,18,149,21,22,24,536,25,26,27,29,30,31,32,33,34,36,38,42,43,45,46,57,59,447,461,214,215,472,221,486,107,108,237,111,112,240,113],"organism":[{"name":"Arabidopsis thaliana","tax_id":3702},{"name":"Arabidopsis","tax_id":3701},{"name":"Rhizobium etli","tax_id":29449},{"name":"Agrobacterium tumefaciens","tax_id":358},{"name":"Unknown/Artificial","tax_id":-1},{"name":"Homo sapiens","tax_id":9606},{"name":"Gallus gallus","tax_id":9031},{"name":"Mus musculus","tax_id":10090},{"name":"Nicotiana tabacum","tax_id":4097},{"name":"Solanum lycopersicum","tax_id":4081},{"name":"Brassica napus","tax_id":3708},{"name":"Solanum tuberosum","tax_id":4113},{"name":"Zea mays","tax_id":4577},{"name":"Xenopus","tax_id":262014},{"name":"Potyvirus","tax_id":12195},{"name":"Simian virus 12","tax_id":46771},{"name":"Rattus norvegicus","tax_id":10116}],"document_location":["BDRAW","DDESC","CLAIM"],"count":110,"data_source":["USPTO_FULLTEXT_RB","EMBLPAT_EBI","DDBJPAT","GBPAT_NCBI"]},"has_sequence":true,"legal_status":{"ipr_type":"patent for invention","granted":true,"earliest_filing_date":"2003-06-06","grant_date":"2009-06-30","anticipated_term_date":"2023-11-14","discontinuation_date":"2013-07-29","has_disclaimer":true,"patent_status":"EXPIRED","publication_count":2,"has_spc":false,"has_grant_event":false,"has_entry_into_national_phase":false},"abstract":{"en":[{"text":"The invention provides a method to regulate expression of a gene of interest in a plant comprising, introducing into the plant a first nucleotide sequence comprising, the gene of interest operatively linked to a first regulatory region, and an operator sequence capable of binding a fusion protein, and a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding the fusion protein. The fusion protein comprising, a DNA binding protein, or a portion thereof, capable of binding the operator sequence, and a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein. In this manner, expression of the second nucleotide sequence produces the fusion protein that regulates expression of the gene of interest.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}]},"abstract_lang":["en"],"has_abstract":true,"claim":{"en":[{"text":"1. A method to regulate expression of a nucleic acid sequence of interest comprising: i) providing a eukaryote having: 1) a first nucleotide sequence comprising, a) said nucleic acid sequence of interest operatively linked to a first regulatory region, b) an operator sequence capable of binding a fusion protein, and; 2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding said fusion protein, said fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding said operator sequence, and; b) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodeling protein, wherein said recruitment factor protein comprises SEQ ID NO:81 or a fragment thereof, wherein said fragment is capable of binding to HDA19; and ii) growing said eukaryote, wherein expression of said second nucleotide sequence produces said fusion protein that regulates expression of said nucleic acid sequence of interest.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"2. The method of claim 1 , wherein the eukaryote is a plant.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"3. The method of claim 1 , wherein said operator sequence is selected from the group consisting of a ROS operator, a Tet operator, Sin3, VP16, GAL4, Lex A, UMe6, ERF, SEBF, CBF and a DNA binding domain of a transcription factor.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"4. The method of claim 1 , wherein the recruitment factor is characterized as having a histone deacetylase binding domain or a histone acetylase binding domain.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"5. The method of claim 2 , wherein said first, second, or both said first an second nucleotide sequences are incorporated into said plant by crossing.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"6. The method of claim 5 , wherein said crossing comprises crossing a first plant comprising said first nucleotide sequence with a second plant comprising said second nucleotide sequence, to obtain progeny.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"7. The method of claim 2 , wherein said first, second, or both said first and second nucleotide sequences are incorporated into said plant by transformation.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"8. An isolated nucleic acid sequence encoding the sequence of BnSCL1 (SEQ ID NO:81).","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"9. An isolated nucleic acid sequence encoding amino acids 1 to 358 of SEQ ID NO:81.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"10. An isolated nucleic acid sequence encoding amino acids 1 to 261 of SEQ ID NO:81.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"11. An isolated nucleic acid sequence encoding amino acids 1 to 217 of SEQ ID NO:81.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"12. An isolated nucleic acid sequence encoding amino acids 146 to 358 of SEQ ID NO:81.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"13. The method of claim 1 , wherein the recruitment factor protein comprises SEQ ID NO:81.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"14. A method to regulate expression of a nucleic acid of interest in a plant comprising: i) introducing into said plant: 1) a first nucleotide sequence comprising, a) said nucleic acid sequence of interest operatively linked to a first regulatory region, b) an operator sequence capable of binding a fusion protein, and; 2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding said fusion protein, said fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding said operator sequence, and; b) the polypeptide of SEQ ID NO:81 or a fragment of SEQ ID NO:81 wherein said fragment is capable of binding to HDA19; and ii) growing said plant, wherein expression of said second nucleotide sequence produces said fusion protein that regulates expression of said nucleic acid sequence of interest.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}]},"claim_lang":["en"],"has_claim":true,"description":{"en":{"text":"FIELD OF INVENTION The present invention relates to the regulation of gene expression. More particularly, the present invention relates to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using chromatin remodelling factors. BACKGROUND OF THE INVENTION Transgenic plants have been an integral component of advances made in agricultural biotechnology. They are necessary tools for the production of plants exhibiting desirable traits (e.g. herbicide and insect resistance, drought and cold tolerance), or producing products of nutritional or pharmaceutical importance. As the applications of transgenic plants become ever more sophisticated, it is becoming increasingly necessary to develop strategies to fine-tune the expression of introduced genes. The ability to tightly regulate the expression of transgenes is important to address many safety, regulatory and practical issues. To this end, it is necessary to develop tools and strategies to regulate the expression of transgenes in a predictable manner. Several strategies have so far been employed to control plant gene/transgene expression. These include the use of regulated promoters, such as inducible or developmental promoters, whereby the expression of genes of interest is driven by promoters responsive to various regulatory factors (Gatz, 1997). Other strategies involve co-suppression (Eisner et al., 1998) or anti-sense technology (Kohno-Murase et al., 1994), whereby plants are transformed with genes, or fragments thereof, that are homologous to genes either in the sense or antisense orientations. Chimeric RNA-DNA oligonucleotides have also been used to block the expression of target genes in plants (Beetham et al., 1999; Zhu et al., 1999). Posttranslational modifications of histones in chromatin are important mechanisms in the regulation of gene expression. Protein-protein interactions between histones H3, H4, H2A and H2B form an octomeric core which is wrapped with DNA. N-terminal tails of histones protrude from the octamer and are subject to posttranslational modification involving acetylation and deacetylation of conserved lysine residues. A nucleosome comprises 26 lysine residues that may be subject to acetylation. Acetylation of core histones, including H4 and H3 via histone acetyltransferase (HAT), is correlated with transcriptionally active chromatin of eukaryotic cells. Acetylation is thought to weaken the interactions of histones with DNA and induce alterations in nucleosome structure. These alterations enhance the accessibility of promoters to components of the transcription machinery, and increase transcription. HATs have been identified in yeast, insects, plants and mammals (e.g. Kolle et al. 1998), and are typically components of multiprotein complexes including components of RNA polymerase II complex, TFIID, TFIIC and recruitment factors (e.g. see Lusser et al. 2001 for review). Histone deacetylation, via histone deacetylase (HD, HDA, HDAC), is thought to lead to a less accessible chromatin conformation, resulting in the repression of transcription (e.g. Pazin and Kadonaga, 1997; Struhl, 1998; Lusser et al., 2001). The role of the yeast histone deacetylase, RPD3, in transcriptional repression was first discovered through a genetic screen for transcriptional repressors in S. cerevisiae (Vidal and Gaber, 1991). Since then, a number of yeast and mammalian HDAC genes have been cloned (Rundlett et al., 1996; Emiliani et al., 1998; Hassig et al., 1998; Verdel and Khochbin, 1999). Most eukaryotic histone deacetylases show some sequence homology to yeast RPD3, suggesting that these proteins are all members derived from a single gene family (Khochbin and Wolffe, 1997; Verdel and Khochbin, 1999). In yeast and mammalian cells, the RPD3/HDACs mediate transcriptional repression by interacting with specific DNA-binding proteins or associated corepressors and by recruitment to target promoters (Kadosh and Struhl, 1997; Hassig et al., 1997; Nagy et al., 1997; Gelmetti et al., 1998). Recently, a second family of histone deacetylases, HDA19 and related proteins, were identified in yeast and mammalian cells (Rundlett et al., 1996; Fischle et al., 1999; Verdel and Khochbin, 1999). The deacetylase domain of HDA19-related proteins is homologous to but significantly different from that of RPD3 (Fischle et al., 1999; Verdel and Khochbin, 1999). These proteins also appear to be functionally different from RPD-like proteins in yeast cells (Rundlett et al., 1996). WO 97/35990 discloses mammalian-derived histone deacetylase (HDx) gene sequences, gene products, and uses for these sequences and products. The down regulation of gene expression in plants using histone deacetylase, fused to a DNA binding domain that targeted the fusion protein to a specific gene, has been demonstrated (Wu et al., 2000a; Wu et al., 2000b). The present invention embraces the use of fusion proteins comprising a DNA binding domain fused to a recruitment factor, that is capable of recruiting chromatin remodelling proteins such as HDAC and HAT, to specific DNA sites to regulate expression of a gene of interest. Also disclosed is the use of fusion proteins comprising a DNA binding portion fused to histone acetyltransferase (HAT) to regulate transcription of a gene of interest. SUMMARY OF THE INVENTION The present invention relates to the regulation of gene expression. More particularly, the present invention relates to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using chromatin remodelling factors. It is an object of the invention to provide an improved method for regulating gene expression using chromatin remodeling factors. According to an aspect of an embodiment of the present invention, there is provided a method to regulate the expression of a gene of interest in a plant comprising: i) introducing to the plant: 1) a first nucleotide sequence comprising, a) the gene of interest operatively linked to a first regulatory region,b) an operator sequence capable of binding a fusion protein, and;2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding a fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion of a DNA binding protein capable of binding the operator sequence, and;b) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein,ii) growing the plant, wherein expression of the second nucleotide sequence produces the fusion protein and regulates expression of the gene of interest. The present invention also embraces the methods as defined above, wherein the first and second regulatory regions are either the same or different and are selected from the group consisting of a constitutive promoter, an inducible promoter, a tissue specific promoter, and a developmental promoter. The present invention also relates to a method of enhancing the expression of a gene of interest or enhancing the transcription of a gene of interest in a plant comprising: i) introducing to the plant: 1) a first nucleotide sequence comprising, a) the gene of interest operatively linked to a first regulatory region, and;b) an operator sequence that interacts with a fusion protein;2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding a fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding the operator sequence, and;b) a histone acetyltransferase (HAT) protein, or portion thereof, capable of increasing histone acetylation;ii) growing the plant, wherein expression of the second nucleotide sequence produces the fusion protein and increases transcription of the gene of interest. The present invention pertains to a method of regulating the expression of a gene of interest or enhancing the transcription of a gene of interest in a plant comprising: i) introducing to the plant: 1) a first nucleotide sequence comprising, a) the gene of interest operatively linked to a first regulatory region, and;b) an operator sequence that interacts with a fusion protein;2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding a fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding the operator sequence, and;b) a chromatin remodelling factor, or portion thereof, capable of increasing histone acetylation;ii) growing the plant, wherein expression of the second nucleotide sequence produces the fusion protein and regulates the transcription of the gene of interest. The present invention also embraces the methods as defined above, wherein the first and second regulatory regions are either the same or different and are selected from the group consisting of a constitutive promoter, an inducible promoter, a tissue specific promoter, and a developmental promoter. The first and second nucleotide sequences may be placed within the same or within different vectors, genetic constructs, or nucleic acid molecules. Preferably, the first nucleotide sequence and the second nucleotide sequence are chromosomally integrated into a plant or plant cell. The two nucleotide sequences may be integrated into two different genetic loci of a plant or plant cell, or the two nucleotide sequences may be integrated into a singular genetic locus of a plant or plant cell. However, the second nucleotide sequence may be integrated into the DNA of the plant or it may be present as an extra-chromosomal element, for example, but not wishing to be limiting a plasmid. Also, according to the present invention there is provided a method for selectively controlling the transcription of a gene of interest, comprising: i) producing a first plant comprising a first genetic construct, the first genetic construct comprising a first regulatory region operatively linked to the gene of interest and at least one operator sequence capable of binding a fusion protein;ii) producing a second plant comprising a second genetic construct, the second genetic construct comprising a second regulatory region in operative association with a nucleic sequence encoding the fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding the operator sequence, and;b) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein;iii) crossing the first plant and the second plant to obtain progeny comprising both the first genetic construct and the second genetic construct, the progeny characterized in that the expression of the fusion protein regulates expression of the gene of interest. The present invention also embraces the methods as defined above, wherein the first and second regulatory regions are either the same or different and are selected from the group consisting of a constitutive promoter, an inducible promoter, a tissue specific promoter, and a developmental promoter. The present invention also pertains to the method as just defined, wherein the nucleic acid sequence encoding the fusion protein is optimised for expression in a plant, and that the nucleotide sequence encodes a nuclear localization signal. Also, according to the present invention there is provided a method for selectively controlling the transcription of a gene of interest, comprising: i) producing a first plant comprising a first genetic construct, the first genetic construct comprising a first regulatory region operatively linked to the gene of interest and at least one operator sequence capable of binding a fusion protein;ii) producing a second plant comprising a second genetic construct, the second genetic construct comprising a second regulatory region in operative association with a nucleic sequence encoding the fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding the operator sequence, and;b) a HAT protein, or portion thereof, capable of histone acetylation in plants;iii) crossing the first plant and the second plant to obtain progeny comprising both the first genetic construct and the second genetic construct and characterized in that the expression of the fusion protein up-regulates the expression of the gene of interest. The present invention also provides the method as just defined, wherein, the nucleic acid sequence encoding the fusion protein is optimised for expression in the plant, and that the nucleic acid sequence encodes a nuclear localization signal. The present invention also embraces the methods as defined above, wherein the first and second regulatory regions are either the same or different and are selected from the group consisting of a constitutive promoter, an inducible promoter, a tissue specific promoter, and a developmental promoter. Furthermore, this invention provides a method to regulate expression of an endogenous nucleic acid sequence of interest in a plant comprising: i) introducing into the plant a nucleotide sequence comprising, a regulatory region, operatively linked with a nucleotide sequence encoding a fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding a segment of a DNA sequence of the endogenous nucleotide sequence of interest;b) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein; andii) growing the plant, wherein expression of the nucleotide sequence produces the fusion protein that regulates expression of the endogenous nucleic acid sequence of interest. The present invention also includes a method to regulate expression of an endogenous nucleic acid sequence of interest in a plant comprising: i) introducing into the plant a nucleotide sequence comprising a regulatory region, operatively linked with a nucleotide sequence encoding a recruitment factor protein, the recruitment factor protein capable of binding an endogenous DNA binding protein, the endogenous DNA binding protein characterized in binding a segment of a DNA sequence of the endogenous nucleotide sequence of interest, and;ii) growing the plant, wherein expression of the nucleotide sequence produces the recruitment factor thereby regulating expression of the endogenous nucleic acid sequence of interest. This summary of the invention does not necessarily describe all necessary features of the invention. BRIEF DESCRIPTION OF THE DRAWINGS These and other features of the invention will become more apparent from the following description in which reference is made to the appended drawings wherein: FIG. 1 shows the nucleotide and deduced amino acid sequences of wild type ROS and a modified ROS of Agrobacterium tumefaciens . FIG. 1(A) shows the amino acid sequence alignment of known ROS repressors (wild-type ROS, SEQ ID NO:1; ROSR, SEQ ID NO:63; ROSAR, SEQ ID NO: 64; MucR, SEQ ID NO: 65), and a synthetic ROS (SEQ ID NO: 4). The amino acid sequence ‘PKKKRKV’ (SEQ ID NO: 6) at the carboxy end of synthetic ROS is one of several nuclear localization signals. FIG. 1(B) shows the nucleotide sequence of a synthetic ROS (SEQ ID NO:2) that had been optimised for plant codon usage containing a nuclear localization signal peptide (in italics). Optional restriction sites at the 5′ end of the sequence are underlined. FIG. 1(C) shows the consensus nucleotide (SEQ ID NO:3) and predicted amino acid (SEQ ID NO:4) sequence, of a composite ROS sequence comprising all possible nucleotide sequences that encode wild type ROS repressor, and the wild type ROS amino acid sequence. The amino acid sequence ‘PKKKRKV’ (SEQ ID NO:6) at the carboxy end represents a nuclear localization signal. Amino acids in bold identify the zinc finger motif. Nucleotide codes are as follows: N=A or C or T or G; R=A or G; Y=C or T; M=A or C; K=T or G; S=C or G; W=A or T; H=A or T or C; B=T or C or G; D=A or T or G; V=A or C or G. FIG. 1(D) shows the nucleotide sequence of the operator sequences of the virC/virD (SEQ ID NO:27) and ipt (SEQ ID NO:8) genes. FIG. 1(E) shows a consensus operator sequence (SEQ ID NO:5) derived from the virC/virD (SEQ ID NOs:66-67) and ipt (SEQ ID NOs:68-69) operator sequences. This sequence comprises 10 amino acids, however, only the first 9 amino acids are required for binding ROS. FIGS. 2-4 shows in a diagrammatic form several variations of regulating gene expression using the methods of the present invention. FIG. 5 shows schematic representations of nucleotide constructs that place the expression of a gene of interest under the control a regulatory region, in this case a CaMV35S regulatory region, modified to contain a ROS operator site. FIG. 5(A) shows the nucleotide construct p74-315 in which a CaMV35S regulatory region, modified to contain a ROS operator site downstream of the TATA box, is operatively linked to a gene of interest (β-glucuronidase; GUS). FIG. 5(B) shows the nucleotide construct p74-316 in which a CaMV35S regulatory region is modified to contain a ROS operator site upstream of the TATA box is operatively linked to the protein encoding region of GUS. FIG. 5(C) shows the nucleotide construct p74-309 in which a CaMV35S regulatory region modified to contain ROS operator sites upstream and downstream of the TATA box is transcriptionally fused (i.e. operatively linked) to the protein encoding region of GUS. FIG. 5(D) shows construct p74-118 comprising a 35S regulatory region with three ROS operator sites downstream from the TATA box. The 35S regulatory region is operatively linked to the gene of interest (GUS). FIG. 6 shows a schematic representation of a nucleotide construct that places the expression of a gene of interest gene under the control of a regulatory region, in this case, the tms2 regulatory region that has been modified to contain ROS operator sites. FIG. 6(A) shows the nucleotide construct p76-507 in which a tms2 regulatory region is operatively linked to a gene of interest (in this case encoding β-glucuronidase, GUS). FIG. 6(B) shows the nucleotide construct p76-508 in which a tms2 regulatory region modified to contain two tandemly repeated ROS operator sites downstream of the TATA box is transcriptionally fused (i.e. operatively linked) to the protein coding region of GUS. FIG. 7 shows a schematic representation of a nucleotide construct that places the expression of a gene of interest under the control of a regulatory region, in this case actin 2 regulatory region, that has been modified to contain ROS operator sites. FIG. 7(A) shows the nucleotide construct p75-101 in which an actin2 regulatory region is operatively linked to a gene of interest (the β-glucuronidase (GUS) reporter gene). FIG. 7(B) shows the nucleotide construct p74-501 in which an actin2 regulatory region modified to contain two tandemly repeated ROS operator sites upstream of the TATA box is transcriptionally fused (operatively linked) to the a gene of interest (GUS). FIG. 8 shows Southern analysis of transgenic Arabidopsis plants. FIG. 8(A) shows Southern analysis of a plant comprising a first genetic construct, p74-309 (35S-operator sequence-GUS; see FIG. 5(C) for map). DNA was digested with ClaI or XhoI and the blot was probed with the ORF of the GUS gene. FIG. 8(B) shows Southern analysis of a plant comprising a second genetic construct p75-101 (see FIG. 7A ). HindIII digests were probed with NPTII. FIG. 9 shows expression of a gene of interest in plants. Upper panel shows expression of GUS under the control of 35S (pBI121; 35S:GUS). Middle panel shows GUS expression under the control of actin2 comprising ROS operator sequences (p74-501; see FIG. 7(B) for construct). Lower panel shows the lack of GUS activity in a non-transformed control. FIG. 10 shows alignments of bnKCP1 and sequence comparison of kinase inducible domains (KIDs) in bnKCP1 and CREB family members. FIG. 10(A) shows alignment of the deduced amino acid sequences of bnKCP1 (SEQ ID NO:71), atKCP (SEQ ID NO:72), atKCL1 (SEQ ID NO:73) and atKCL2 (SEQ ID NO:74) proteins. Serine (S)-rich residues and the conserved region (GKSKS domain) among the four sequences are single underlined and double underlined, respectively. The putative nuclear localization signal (NLS) and the phosphorylation site of protein kinase A are indicated by asterisks and diamonds, respectively. FIG. 10(B) shows alignment of the amino acid sequences of bnKCP1 (SEQ ID NO:75), hydra CREB (hyCREB) (SEQ ID NO:77), canfa CREM (cCREM) (SEQ ID NO:80), and mammalian ATF-1 (SEQ ID NO:76), CREB (SEQ ID NO:78) and CREM (SEQ ID NO:79). Diamonds indicate the conserved phosphorylation site of protein kinase A. FIG. 10(C) shows a phylogenetic tree of the KIDs sequences using the NTI Vector program. FIG. 11 shows structural features of bnKCP1. FIG. 11(A) shows schematic representation of entire bnKCP1 protein. Numbers above or under the boxes refer to positions of amino acid residues. S-rich (34-58), GKSKS (88-143) and KID (161-215) domains or motifs are shown in dotted boxes, the nuclear localization signal (NLS) in black box, and the three acidic motifs (I, II, III) in gray boxes. FIG. 11(B) shows secondary structure features and hydrophilicity of bnKCP1 analyzed using DNAstar Protean program. FIG. 12 shows Southern blot analysis of Brassica genomic DNA. Total genomic DNA (10 μg/lane) from Brassica napus cv Westar was digested with restriction enzymes EcoRI (EI), XbaI (X), HindIII (H), PstI (P), EcoRV (EV) and KpnI (K). The entire ORF of bnKCP1 was used as a probe. FIG. 13 shows in vitro interaction of wild type and mutant bnKCP1 proteins with the GST-HDA19 and GST-Gcn5 fusion proteins. FIG. 13(A) shows a schematic representation of the bnKCP1 and its deletion mutants obtained by deletion of C-terminal regions of bnKCP1. FIG. 13(B) shows binding activities of bnKCP1 and its mutants with GST-HDA19, GST-Gcn5 and GST alone (negative control), respectively, as indicated. The wild type bnKCP1, mutants bnKCP1 1-160 and bnKCP1 1-80 , luciferase (as positive control) and negative control (no template) were produced using in vitro transcription/translation reactions. The translation products were incubated with GST fusion proteins or GST and their binding activities were examined as described in Example 4. FIG. 13(C) shows activation of lacZ reporter gene by bnKCP1 and its deletion mutants, ΔbnKCP1 1-160 and ΔbnKCP1 1-80 , in yeast cells. MaV203 yeast cells carrying plasmid pDBLeu-HDA19 and the reporter gene were transfected with the plamid pPC86-bnKCP1, pPC86-bnKCP1 1-160 , pPC86-bnKCP1 1-80 or pPC86 vector only. Yeast strains A and B were used as negative and positive controls, respectively. The β-galactosidase activity was assayed using chlorophenol red-β-D-galactopyranoside (CPRG) and was expressed as a percentage of activity conveyed by bnKCP1. FIG. 14 shows the effect of S 188 on the interaction between bnKCP1 and GST-HDA19 fusion protein. A glycine residue (G 188 ) was introduced by site-directed mutagenesis to replace S 188 . The binding activities of wild-type bnKCP1 and the mutant ΔbnKCP1G 188 with GST-HDA19 or GST alone (negative control) were examined with GST pulldown affinity assay as described in Example 4. FIG. 14A shows the introduction of G188 into the KID of bnKCP1(wild-type KID (SEQ ID NO:109)mutant KID (SEQ ID NO:110 )). FIG. 14B shows in vitro protein interaction of bnKCP1 and the mutant ΔbnKCP1G 188 with GST-HDA19 or GST alone. FIG. 15 shows expression patterns of bnKCP1 mRNA in different tissues. Total RNA (20 μg/lane) was isolated from leaves with petioles, flowers, roots, stems and immature siliques. FIG. 16 shows expression of bnKCP1 gene in response to low temperature, LaCl 3 and inomycin treatments. Total RNA (20 μg/lane) was isolated from leaf blades of four-leaf stage Brassica napus cv Westar seedlings after exposure to different stress conditions and analyzed by northern blotting using the bnKCP1 ORF as probe. FIG. 16(A) shows bnKCP1 transcript accumulation in leaves and stems of seedlings exposed to cold (4° C.). FIG. 16(B) shows expression pattern of bnKCP1 gene after treatment with LaCl 3 and inomycin. FIG. 17 shows transactivation of the lacZ gene by bnKCP1 in yeast. The lacZ gene was driven by a promoter containing GAL4 DNA binding sites and integrated into the genome of yeast MaV203. FIG. 17(A) is a schematic representation of the bnKCP1 and its deletion mutants. FIG. 17(B) Yeast cells carrying the reporter gene were transfected with the effector plasmids pDBLeu-bnKCP1, pDBLeu-bnKCP1 1-160 , pDBLeu-bnKCP1 1-80 , and pDBLeu-bnKCP1 81-215 or the pDBLeu vector only. Yeast strains A and B (GibcoL BRL, Life Technologies) were used as negative and positive controls, respectively. The β-galactosidase activity was assayed using CPRG (chlorophenol red-β-D-galactopyranoside) and was expressed as a percentage of activity conveyed by the positive control (strain C). Bars indicate the standard error of three replicates. FIG. 18 shows the nuclear localization of GUS-bnKCP1 protein in onion cells. FIG. 18(A) is a schematic diagram of the GUS-bnKCP1 fusion construct containing the CaMV 35S promoter. The bnKCP1 was fused in-frame to the GUS reporter gene. FIG. 18(B) shows transient expression of GUS-bnKCP1 fusion protein (top) and GUS alone (bottom) in onion cells. Onion tissues were simultaneously analysed using histochemical GUS assay (left) and nucleus-specific staining with DAPI (right) as described in Example 4. FIG. 19 shows a diagrammatic representation of a strategy for preparing fusions between a recruitment factor involved in chromatin remodelling and a DNA binding protein. In the non-limiting example shown in this figure, the recruitment factor is KID (see Example 4), and the DNA binding protein is a zinc finger. FIG. 20 shows alignment of the deduced products of BnSCL1 (SEQ ID NO:81), AtSCL15 (accession number Z99708) (SEQ ID NO:82) and LsSCL (accession number AF273333) (SEQ ID NO:83). Identical and conserved amino acids in the three proteins are shown as white letters on a black background and black letter on a gray background, respectively. Amino acids with weak similarity are indicated as white letters on a gray background. Amino acids with no similarity are shown as black letters on a white background. The putative nuclear localization signals, and LXXLL motif, are indicated by asterisks and dots, respectively. The VHIID motif, two leucine heptad regions (LHRI and LHRII), PFYRE and SAW motif are underlined as indicated. FIG. 21 shows a phylogenetic tree of the GRAS family sequences made by the NTI Vector program in Brassica napus, Arabidopsis thaliana, Hordeum vulgare, Zea mays, Lycopersicon esculentum, Pisum sativum and Oryza sativa . The BnSCL1 is underlined. FIG. 22 shows DNA gel blot analysis of BnSCL1 gene. Total genomic DNA (10 μg/lane) from Brassica napus was digested with restriction enzymes EcoRI (EI), XbaI (X), HindIII (H), PstI (P), EcoRV (EV) and KpnI (K), and hybridized with the entire ORF of BnSCL1 under high stringency conditions. FIG. 23 shows in vitro interaction of wild type and mutant BnSCL1 proteins with the GST-HDA19 fusion protein. FIG. 23(A) is a schematic representation of the BnSCL1 and its deletion mutants obtained by the deletion of its C-terminal regions. FIG. 23(B) shows the binding activities of BnSCL1 and its mutants with GST-HDA19. The wild type BnSCL1, mutants ΔBnSCL1 1-358 , ΔBnSCL1 1-261 , ΔBnSCL1 1-217 and ΔBnSCL1 1-145 , luciferase (positive control) and negative control (no template) were produced using in vitro transcription/translation reactions. The translation products were incubated with GST fusion proteins or GST alone (data not shown) and their binding activities were examined as described in Example 5. Arrow point to band representing the in vitro translated ΔBnSCL1 1-145 protein that did not bind to the recombinant protein. FIG. 24 shows in vivo interaction of wild type and mutant BnSCL1 proteins. FIG. 24(A) is a schematic representation of the BnSCL1 and its deletion mutants. FIG. 24(B) shows the activation of lacZ reporter gene by BnSCL1 and its deletion mutants in yeast cells. MaV203 yeast cells carrying plasmid pDBLeu-HDA19 and the lacZ reporter gene were transfected with the plasmid pPC86-BnSCL1, pPC86-BnSCL1 1-358 , pPC86-BnSCL1 1-261 , pPC86-BnSCL1 1-217 , pPC86-BnSCL1 1-145 , pPC86-BnSCL1 146-358 , pPC86-BnSCL1 218-438 or pPC86 vector only. The negative control yeast strain A, and the positive controls yeast strains B and C (GIBCOL BRL, Life Technologies) were also used. The β-Galactosidase activity was assayed using CPRG (chlorophenol red-β-D-galactopyranoside) and was expressed as a percentage of activity conveyed by yeast strain C. Bars indicate the standard error of three replicates. FIG. 25 shows transactivation of the lacZ gene by BnSCL1 protein in yeast. FIG. 25(A) is a schematic representation of the BnSCL1 and its deletion mutants. FIG. 25(B) shows the activation of lacZ reporter gene by BnSCL1 and its deletion mutants in yeast cells. The lacZ reporter gene was driven by a promoter containing GAL4 DNA binding sites and integrated into the genome of yeast MaV203 cell. Yeast cells carrying the reporter gene were transfected with the effector plasmids pDBLeu-BnSCL1, pDBLeu-BnSCL1 1-358 , pDBLeu-BnSCL1 1-261 , pDBLeu-BnSCL1 1-217 , pDBLeu-BnSCL1 1-145 , pDBLeu-BnSCL1 146-358 , pDBLeu-BnSCL1 218-438 or pDBLeu vector only. Yeast strains A, B, C and D (GIBCOL BRL, Life Technologies) were used as controls as described in Example 5. The β-Galactosidase activity was assayed using CPRG and was expressed as a percentage of activity conveyed by the wild type BnSCL1 protein. Bars indicate the standard error of three replicates. FIG. 26 shows expression patterns of BnSCL1 mRNA in different tissues. FIG. 26(A) is a RNA gel blot analysis of total RNA (20 μg/lane) isolated from leaves, flowers, roots, stems and siliques, electrophoresed through a 1.2% agarose gel containing formaldehyde and probed with the ORF of BnSCL1 as described in Example 5. EtBr stained total RNA is shown to indicate even loading. FIG. 26(B) is a quantitative one-step RT-PCR analysis of total RNA extracted from leaves, flowers, roots, stems, siliques and shoots. Quantitative RT-PCR products were electrophoresed through a 1% agarose gel and hybridized with 32 P-labelled 5′-end fragment (435 bp) of BnSCL1 ORF. A 960 bp fragment of the Brassica napus actin gene co-amplified with BnSCL1 was used as an internal standard as described in Example 5. FIG. 27 shows expression of BnSCL1 gene in four-leaf stage Brassica napus seedlings in the presence or absence of 2,4-D. Total RNA was isolated from the fourth leaves after the indicated period of the first foliar application of 1 mM 2,4-D and subjected to quantitative one-step RT-PCR. The RT-PCR products were analyzed by Southern blotting using the BnSCL1 ORF as probe (left) and the blotting results were shown graphically relative to the level of internal standard Actin (arbitrary value of 100)(right). FIG. 28 shows kinetics of BnSCL1 mRNA accumulation in response to auxin in the presence and absence of histone deacetylase inhibitor sodium butyrate. Nine-day-old light-grown seedlings were treated with 10 mM sodium butyrate for 24 h followed by exogenous 2,4-D application at variable concentrations as indicated. Quantitative one-step RT-PCR was used to analyze total RNA extracted from shoots ( FIG. 28A ) and roots ( FIG. 28B ; see legend to FIG. 27 Expression of BnSCL1 in response to 2,4-D was also analyzed using quantitative RT-PCR of total RNA isolated from shoots and roots of 10 dpg seedlings in the presence of 50 μM NPA, an auxin transport inhibitor, for 24 h before the exogenous application of 2,4-D ( FIG. 28C ). FIG. 29 shows in a diagrammatic form several constructs that may be used to regulate gene expression as described in Example 6. FIG. 30 shows in a diagrammatic form several constructs that may be used to regulate gene expression as described in Example 7. FIG. 31 shows a graph of transient expression of GUS reporter gene using constructs of FIG. 30 as described in Example 7. GUS activity was measured as pmol 4-methylumbelliferone per mg protein per minute, and expressed as % of GUS activity in the control sample, the bars indicate the standard deviations. DESCRIPTION OF PREFERRED EMBODIMENT The present invention relates to the regulation of gene expression. More particularly, the present invention relates to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using chromatin remodelling factors. The following description is of a preferred embodiment. Gene regulation can be used in applications such as metabolic engineering to produce plants that accumulate large amounts of certain intermediate compounds. Regulation of gene expression can also be used for control of transgenes across generations, or production of F1 hybrid plants with seed characteristics that would be undesirable in the parental line, for example but not limited to, hyper-high oil, reduced fiber content, low glucosinolate levels, reduced levels of phytotoxins, and the like. In the latter examples, low glucosinolate levels, or other phytotoxins, may be desired in seeds while higher concentrations of these compounds may be required elsewhere, for example in the case of glucosinolates, within cotyledons, due to their role in plant defence. Another non-limiting example for the controlled regulation of a gene of interest during plant development is seed specific down regulation of sinapine biosynthesis, as for example in seeds of Brassica napus . In many instances, transgene expression needs to be regulated only in certain plant organs/tissues or at certain stages of development. The methods as described herein may also be used to control the expression of a gene of interest that encodes a protein used to for plant selection purposes. For example, which is to be considered non-limiting, a gene of interest may encode a protein that is capable of metabolizing a compound from a non-toxic form to a toxic form thereby selectively removing plants that express the gene of interest. The present invention provides a method to regulate the expression of a gene of interest by transforming a plant with one or more constructs comprising: 1) a first nucleotide sequence comprising, a) a nucleic acid sequence of interest operatively linked to a regulatory region,b) an operator sequence capable of binding a fusion protein, and;2) a second nucleotide sequence comprising a regulatory region in operative association with a nucleotide sequence encoding the fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion of a DNA binding protein capable of binding the operator sequence, and;b) a recruitment factor protein, or a portion of a recruitment factor protein capable of binding a chromatin remodelling protein, wherein binding of the fusion protein to the operator sequence of the first nucleotide sequence regulates expression of the nucleic acid sequence of interest from the first nucleotide sequence. The operator sequence of the first nucleotide sequence may be positioned upstream of the ORF of the nucleic acid sequence of interest. These first and second nucleotide sequences may be placed within the same or within different vectors, genetic constructs, or nucleic acid molecules. Preferably, the first nucleotide sequence and the second nucleotide sequence are chromosomally integrated into a plant or plant cell. The two nucleotide sequences may be integrated into two different genetic loci of a plant or plant cell, or the two nucleotide sequences may be integrated into a singular genetic locus of a plant or plant cell. However, the second nucleotide sequence may be integrated into the DNA of the plant or it may be present as an extra-chromosomal element, for example, but not wishing to be limiting a plasmid. By “operatively linked” it is meant that the particular sequences interact either directly or indirectly to carry out their intended function, such as mediation or modulation of gene expression. The interaction of operatively linked sequences may, for example, be mediated by proteins that in turn interact with the sequences. A transcriptional regulatory region and a sequence of interest are “operably linked” when the sequences are functionally connected so as to permit transcription of the sequence of interest to be mediated or modulated by the transcriptional regulatory region. By the term “regulate the expression” it is meant reducing or increasing the level of mRNA, protein, or both mRNA and protein, encoded by a gene or nucleotide sequence of interest in the presence of the fusion protein encoded by the second nucleotide sequence, relative to the level of mRNA, protein or both mRNA and protein encoded by the nucleic acid sequence of interest in the absence of the fusion protein encoded by the second nucleotide sequence. By the term “fusion protein” it is meant a protein comprising two or more amino acid portions which are not normally found together within the same protein in nature and that are encoded by a single gene. Fusion proteins may be prepared by standard techniques in molecular biology known to those skilled in the art (see for example FIG. 17 ). In the context of the present invention, at least one of the amino acid portions is capable of binding an operator sequence as defined herein. By the term “binding” it is meant reversible or non-reversible association of two components, for example the operator sequence and the DNA binding domain of a protein, including a fusion protein, or the recruitment factor protein and chromatin remodelling protein as described herein. Preferably, the two components have a tendency to remain associated, but are capable of dissociation under appropriate conditions. Conditions may include, but are not limited to the addition of a third component, chemical, etc which enhances dissociation of the bound components. By the term “recruitment factor” it is meant a protein or peptide sequence capable of interacting with, or binding a chromatin remodelling protein. Preferably, the recruitment factor and the chromatin remodelling protein interact or bind in a manner such that the activity of the chromatin remodelling protein is retained. However, by binding the recruitment factor, the activity of the chromatin remodelling protein may be modified in some manner. Non-limiting examples of recruitment factors include KID, for example bnKCP1, or fragments thereof (Example 4), BnSCL1, or fragments thereof (see Examples 5 and 7), ADA, SAGA, STAGA, PCAF, TFIID, and TFIIIC (Lusser, 2001, Table 1, which is incorporated herein by reference). A recruitment factor may be modified to include a DNA binding region, for example as outlined in FIG. 17 , [or a native recruitment factor may be utilized to target proteins that interact with genes in their native context]. An example, which is not to be considered limiting in any manner, bnKCP1, or active fragments thereof (see Example 4) can target transcription factors that are known to bind DNA. Examples of such transcription factors include ERF (Hart et al., 1993), SEBF (Boyle and Brisson, 2001), or CBF (Stockinger et al., 1997). In this manner by over expressing bnKCP1, regulation of the expression of a gene that is dependant on ERF, CBF or SEBF activity may be regulated. Another non-limiting example of a recruitment factor is BnSCL1, or active fragments thereof (see Example 5). An example, which is not to be considered limiting, of a protein that interacts with bnKCP1 and BnSCL1 is the chromatin remodelling protein HDAC, for example HDA19. By the term “chromatin remodelling protein” it is meant a protein that is capable of altering the structure of chromatin. Preferably the chromatin remodelling protein is histone acetyl transferase (HAT) or histone deacetylase (referred to either as HD, HDA, or HDAC). Any HAT protein, HDAC protein, or any derivative of any HAT protein or HDAC protein may be used in the method of the present invention provided that the HAT protein, HDAC protein or derivative thereof exhibits the respective histone acetylase, or histone deacetylase activity in plants. By the term “HD binding domain” or “histone deacetylase binding domain”, it is meant a sequence of amino acid residues which interacts with a histone deacetylase enzyme through protein-protein interactions. Such protein-protein interactions can be monitored in several ways, for example, which is not to be considered limiting, by yeast two-hybrid experiments. Non-limiting examples of proteins comprising a HD binding domain include bnKCP1 and BnSCL1. By the term “DNA binding protein or portion of a DNA binding protein” it is meant a protein or amino acid sequence capable of binding to a specific operator sequence. By “operator sequence” it is meant a sequence of DNA that is capable of binding to the DNA binding protein or portion of the DNA binding protein. Examples of a DNA binding proteins capable of binding specific operator sequences include, but are not limited to, the ROS repressor, TET repressor, Sin3, VP16, GAL4, Lex A, UMe6, ERF, SEBF and CBF. Any DNA binding protein or portion of any DNA binding protein may be employed in the method of the present invention provided that the protein or portion thereof is capable of binding to an operator sequence. As an example, but not to be considered limiting in any manner, the ROS repressor may be employed in the method of the present invention. By ROS repressor it is meant any ROS repressor, analog or derivative thereof as known within the art which is capable of binding to an operator sequence. These include ROS repressors as described herein, as well as other microbial ROS repressors, for example but not limited to ROSAR ( Agrobacterium radiobacter ; Brightwell et al., 1995) (SEQ ID NO:64), MucR ( Rhizobium meliloti ; Keller M et al., 1995) (SEQ ID NO:65), and ROSR ( Rhizobium elti ; Bittinger et al., 1997; also see Cooley et al., 1991; Chou et al., 1998; Archdeacon J et al., 2000; D'Souza-Ault M. R., 1993; all of which are incorporated herein by reference) (SEQ ID NO:63). The DNA sequence of ROS, or any other DNA binding protein, may be modified to optimize expression within a plant. Examples of ROS repressors that may be used as described herein are provided in FIGS. 1(A) to (C) and (SEQ ID NOs: 1-4). The DNA binding protein, or portion thereof that exhibits DNA binding activity may be fused to a recruitment factor or chromatin remodelling protein as described herein. Examples of such fusion proteins can be prepared, using methods known in the art, for example but not limited to the method outlined in FIG. 17 . FIG. 17 discloses a strategy for creating fusion between the zinc finger domain of the ROS repressor and the KID domain of bnKCP1. This involves amplification of regions encoding the zinc finger domain of the ROS repressor and the KID domain using the following primers: zinc finger: The forward primer (zf-F) contains a restriction enzyme site at the 5′ end and the reverse primer (zf-R) contains 15 nucleotides from the 5′ end of the KID region.;KID domain: The forward primer (KID-F) contains 15 nucleotides from the 3′ region of the zinc finger domain, and the reverse primer (KID-R) contains a restriction enzyme site at the 3′ end. The amplified zinc finger and KID fragments are combined and used as a template for a new round of PCR amplification where only the forward primer (zf-F) of the zinc finger and the reverse primer (KID-R) of the KID domain are used. The two separate templates are amplified to create one single in frame fusion fragment encoding the zinc finger and KID domains, and containing restriction sites at each end. This product is then cloned into a plant expression vector. However, it is to be understood that fusion of a recruitment factor with a DNA binding protein may not be required in order to regulate expression of a nucleic acid sequence of interest. Recruitment factors are known to bind chromatin remodelling proteins and factors that directly or indirectly bind DNA. For example, bnKCP1 (Example 4) exhibits the property of binding ERF. Depending upon the chromatin remodelling protein selected, gene expression may be up-regulated or down-regulated. For example, which is not to be considered limiting in any manner, the binding of a fusion protein containing a recruitment factor capable of recruiting HAT to a gene, may result in up-regulation of expression of a nucleic acid sequence of interest, while a fusion protein that recruits HDAC will result in the down-regulation of the expression of a nucleic acid sequence of interest. However, it is within the scope of the present invention that modification to the rate of up-regulation and down-regulation of gene expression may occur depending upon the location of the operator sequence that binds the fusion protein. The operator sequence is preferably located in proximity to the nucleic acid sequence of interest, either upstream of or downstream of the nucleic acid sequence of interest (see for example FIG. 5A-D ). Alternatively, the operator sequence may be within the non-coding region of the nucleic acid sequence of interest, for example, but not wishing to be limiting, within an intron of the gene. If it is desired to have the expression of a nucleic acid sequence of interest reduced or repressed, the operator sequence may be located within a nucleotide region that interferes with binding of transcription factors required for transcription of the nucleic acid sequence of interest, for example, interfering with the binding of the RNA polymerase to the nucleic acid sequence of interest, or reducing the rate of migration of the polymerase along a nucleotide sequence, or both. An operator sequence may consist of a minimal sequence required for binding of a DNA binding protein or fragment thereof, or it may comprise an inverted repeat or palindromic sequences of a specified length. For example, but not wishing to be limiting, the ROS operator sequence may comprise 9 or more nucleotide base pairs (see FIGS. 1 (D) and (E)) that exhibits the property of binding a DNA binding domain of a ROS repressor. A consensus sequence of a 10 amino acid region including the 9 amino acid DNA binding site sequence is WATDHWKMAR (SEQ ID NO: 5; FIG. 1 (E)). The last amino acid, “R”, of the consensus sequence is not required for ROS binding (data not presented). Examples of operator sequences, which are not to be considered limiting in any manner, also include, as is the case with the ROS operator sequence from the virC or virD gene promoters, a ROS operator made up of two 11 bp inverted repeats separated by TTTA: TATATTTCAATTTTATTGTAATATA;(SEQ ID NO: 7)or the operator sequence of the IPT gene: TATAATTAAAATATTAACTGTCGCATT.(SEQ ID NO: 8) However, it is to be understood that analogs or variants of SEQ ID NO's:7, 8 and 5 may also be used providing they exhibit the property of binding a DNA binding domain, preferably a DNA binding domain of the ROS repressor. For example, but not to be considered limiting in any manner, in the promoter of the divergent virC/virD genes of Agrobacterium tumefaciens , ROS binds to a 9 bp inverted repeat sequence in an orientation-independent manner (Chou et al., 1998). The ROS operator sequence in the ipt promoter also consists of a similar sequence to that in the virC/virD except that it does not form an inverted repeat (Chou et al., 1998). Only the first 9 bp are homologous to ROS box in virC/virD indicating that the second 9 bp sequence may not be a requisite for ROS binding. Accordingly, the use of ROS operator sequences or variants thereof that retain the ability to interact with ROS, as operator sequences to selectively control the expression of genes or nucleotide sequences of interest, is within the scope of the present invention. Other operator sequences include sequences known to bind transcription factors, for example but not limited to: TAAGAGCCGCC (SEQ ID NO:9), which is known to bind ERF (in ethylene responsive genes; Hart et al., 1993);GACTGTCAC (SEQ ID NO:10), which is known to bind to SEBF (in pathogenesis responsive genes; Boyle and Brisson, 2001);TACCGACAT (SEQ ID NO:11) and TGGCCGAC (SEQ ID NO:12), which are known to bind CBF (in low temperature responsive genes; Stockinger et al., 1997). The transcription factors ERF, SEBF and CBF are example of factors that can be targeted by the recruitment factor bnKCP1. By “regulatory region” or “regulatory element” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active and in operative association with a nucleic acid sequence of interest, this may result in expression of the nucleic acid sequence of interest. A regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation. A “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activity, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers. “Regulatory region”, as used herein, also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region. In the context of this disclosure, the term “regulatory element” or “regulatory region” typically refers to a sequence of DNA, usually, but not always, upstream (5′) to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site. However, it is to be understood that other nucleotide sequences, located within introns, or 3′ of the sequence may also contribute to the regulation of expression of a coding region of interest. An example of a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element. Most, but not all, eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site. A promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression. There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive. A regulatory region that is developmentally regulated, or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue. However, some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well. An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically the protein factor, which binds specifically to an inducible regulatory region to activate transcription, may be present in an inactive form which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. A plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods. Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I. R. P., 1998; which is incorporated by reference). Examples, of potential inducible promoters include, but not limited to, teracycline-inducible promoter (Gatz, C., 1997; which is incorporated by reference), steroid inducible promoter (Aoyama, T. and Chua, N. H., 1997; which is incorporated by reference) and ethanol-inducible promoter (Salter, M. G., et al, 1998; Caddick, M. X. et al, 1998; which are incorporated by reference) cytokinin inducible IB6 and CKI1 genes (Brandstatter, I. and Kieber, J. J., 1998; Kakimoto, T., 1996; which are incorporated by reference) and the auxin inducible element, DR5 (Ulmasov, T., et al., 1997; which is incorporated by reference). A constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development. Examples of known constitutive regulatory elements include promoters associated with the CaMV 35S transcript. (Odell et al., 1985), the rice actin 1 (Zhang et al, 1991), actin 2 (An et al., 1996), or tms 2 (U.S. Pat. No. 5,428,147, which is incorporated herein by reference), and triosephosphate isomerase 1 (Xu et. al., 1994) genes, the maize ubiquitin 1 gene (Cornejo et al, 1993), the Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995). The term “constitutive” as used herein does not necessarily indicate that a gene under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types even though variation in abundance is often observed. The regulatory regions of the first and second nucleotide sequences denoted above, may be the same or different. For example, which is not to be considered limiting in any manner, the regulatory elements of the first and second genetic constructs may both be constitutive. In an aspect of an embodiment, the first and second nucleotide sequences may be maintained in the same plant. In an alternate embodiment the first and second nucleotide sequences are maintained in separate plants, a first and a second plant, respectively. The first nucleotide sequence encoding a nucleic acid sequence of interest is expressed within the first plant. In the second embodiment, the second plant expresses the second nucleic acid sequence encoding the fusion protein capable of regulating the expression of the nucleic acid sequence of interest within the first plant. Crossing of the first and second plants produces a progeny that expresses the fusion protein which regulates the expression of the nucleic acid sequence of interest. In this manner the expression of nucleic acid sequence of interest that is required to maintain parent stocks may be retained within a parent plant but not expressed in a progeny plant. Such a cross may produce sterile offspring. Alternatively, which is not to be considered limiting in any manner, the second regulatory element may be active before, during, or after the first regulatory element is active. Similarly, the first regulatory element may be active before, during, or after the second regulatory element is active. Other examples, which are not to be considered limiting, include the second regulatory element being an inducible regulatory element that is activated by an external stimulus so that regulation of gene expression may be controlled through the addition of an inducer. The second regulatory element may also be active during a specific developmental stage preceding, during, or following that of the activity of the first regulatory element. In this way the expression of the nucleic acid sequence of interest may be repressed or activated as desired within a plant. By “nucleic acid sequence of interest”, “nucleotide sequence of interest” or “coding region of interest” it is meant any gene or nucleotide sequence that is to be expressed within a host organism. Such a nucleotide sequence of interest may include, but is not limited to, a gene whose product has an effect on plant growth or yield, for example a plant growth regulator such as an auxin or cytokinin and their analogues, or a nucleotide sequence of interest may comprise a herbicide or a pesticide resistance gene, which are well known within the art. A nucleic acid sequence of interest or a coding region of interest, may encode an enzyme involved in the synthesis of, or in the regulation of the synthesis of, a product of interest, for example, but not limited to a protein, or an oil product. A nucleotide sequence of interest or a coding region of interest, may encode an industrial enzyme, protein supplement, nutraceutical, or a value-added product for feed, food, or both feed and food use. Examples of such proteins include, but are not limited to proteases, oxidases, phytases, chitinases, invertases, lipases, cellulases, xylanases, enzymes involved in oil biosynthesis, etc. A nucleotide sequence of interest or a coding region of interest, may also encode a pharmaceutically active protein, for example growth factors, growth regulators, antibodies, antigens, their derivatives useful for immunization or vaccination and the like. Such proteins include, but are not limited to, interleukins, insulin, G-CSF, GM-CSF, hPG-CSF, M-CSF or combinations thereof, interferons, for example, interferon-α, interferon-β, interferon-γ, blood clotting factors, for example, Factor VIII, Factor IX, or tPA or combinations thereof. If the nucleic acid sequence of interest or a coding region of interest, encodes a product that is directly or indirectly toxic to the plant, then by using the method of the present invention, such toxicity may be reduced throughout the plant by selectively expressing the nucleic acid sequence of interest within a desired tissue or at a desired stage of plant development. A nucleotide sequence of interest or a coding region of interest, may also include a gene that encodes a protein involved in regulation of transcription, for example DNA-binding proteins that act as enhancers or basal transcription factors. Moreover, a nucleotide sequence of interest may be comprised of a partial sequence or a chimeric sequence of any of the above genes, in a sense or antisense orientation. It is also contemplated that a nucleic acid sequence of interest or a coding region of interest, may be involved in the expression of a gene expression cascade, for example but not limited to a developmental cascade. In this embodiment, the nucleic acid sequence of interest is preferably associated with a gene that is involved at an early stage within the gene cascade, for example homeotic genes. Expression of a nucleic acid sequence of interest, for example a repressor of homeotic gene expression, represses the expression of a homeotic gene. Expression of the fusion protein that represses gene expression within the same plant, either via crossing, induction, temporal or developmental expression, of the regulatory region, as described herein, de-represses the expression of the homeotic gene thereby initiating a gene cascade. Conversely, using the methods described herein, expression of an introduced (i.e. transgenic) homeotic gene may be activated in a selective manner, so that it is expressed outside of its normal developmental or temporal expression pattern, thereby initiating a cascade of developmental events. This may be achieved by targeting a chromatin remodelling protein to a desired homeotic gene as described herein. Homeotic genes are well known to one of skill in the art, and include but are not limited to, transcription factor proteins and associated regulatory regions, for example controlling sequences that bind AP2 domain containing transcription factors, for example but not limited to, APETALA2 (a regulator of meristem identity, floral organ specification, seedcoat development and floral homeotic gene expression; Jofuku et al., 1994), CCAAT box-binding transcription factors (e.g. LEC1; WO 98/37184; Lotan, T. et al., 1998), or the controlling factor associated with PICKLE, a gene that produces a thickened, primary root meristem (Ogas, J. et al., 1997). A nucleic acid sequence of interest or a coding region of interest, may also be involved in the control of transgenes across generations, or production of F1 hybrid plants with seed characteristics that would be undesirable in the parental line or progeny, for example but not limited to, oil seeds characterized as having reduced levels of sinapine biosynthesis within the oil-free meal. In this case, a nucleic acid sequence of interest may be any enzyme involved in the synthesis of one or more intermediates in sinipine biosynthesis. An example, which is to be considered non-limiting, is caffeic o-methyltransferase (Acc# AAG51676), which is involved in ferulic acid biosynthesis. Other examples of genes of interest include genes that encode proteins involved in fiber, or glucosinolate, biosynthesis, or a protein involved in the biosynthesis of a phytotoxin. Phytotoxins may also be used for plant selection purposes. In this non-limiting example, a nucleic acid sequence of interest may encode a protein that is capable of metabolizing a compound from a non-toxic form to a toxic form thereby selectively removing plants that express the nucleic acid sequence of interest. The phytotoxic compound may be synthesized from endogenous precursors that are metabolized by the nucleic acid sequence of interest into a toxic form, for example plant growth regulators, or the phytotoxic compound may be synthesized from an exogenously applied compound that is only metabolized into a toxic compound in the presence of the nucleic acid sequence of interest. For example, which is not to be considered limiting, the nucleic acid sequence of interest may comprise indole acetamide hydrolase (IAH), that converts exogenously applied indole acetamide (IAM) or naphthaline acetemide (NAM), to indole acetic acid (IAA), or naphthaline acetic acid (NAA), respectively. Over-synthesis of IAA or NAA is toxic to a plant, however, in the absence of IAH, the applied IAM or NAM is non-toxic. Similarly, the nucleic acid sequence of interest may encode a protein involved in herbicide resistance, for example, but not limited to, phosphinothricin acetyl transferase, wherein, in the absence of the gene encoding the transferase, application of phosphinothricin, the toxic compound (herbicide) results in plant death. Other nucleic acid sequence of interest that encode lethal or conditionally lethal products may be found in WO 00/37660 (which is incorporated herein by reference). The nucleic acid sequence of interest, the nucleotide sequence of interest or a coding region of interest, may be expressed in suitable eukaryotic hosts which are transformed by the nucleotide sequences, or nucleic acid molecules, or genetic constructs, or vectors of the present invention. Examples of suitable hosts include, but are not limited to, insect hosts, mammalian hosts, yeasts and plants. Suitable plant hosts include, but are not limited to agricultural crops including canola, Brassica spp., maize, tobacco, alfalfa, rice, soybean, wheat, barley, sunflower, and cotton. The one or more chimeric genetic constructs of the present invention can further comprise a 3′ untranslated region. A 3′ untranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3′ end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5′-AATAAA-3′ although variations are not uncommon. One or more of the chimeric genetic constructs of the present invention can also include further enhancers, either translation or transcription enhancers, as may be required. These enhancer regions are well known to persons skilled in the art, and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence. Examples of suitable 3′ regions are the 3′ transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (Nos gene) and plant genes such as the soybean storage protein genes and the small subunit of the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene. To aid in identification of transformed plant cells, the constructs of this invention may be further manipulated to include selectable markers. Useful selectable markers in plants include enzymes which provide for resistance to chemicals such as an antibiotic for example, gentamycin, hygromycin, kanamycin, or herbicides such as phosphinothrycin, glyphosate, chlorosulfuron, and the like. Similarly, enzymes providing for production of a compound identifiable by colour change such as GUS (β-glucuronidase), or luminescence, such as luciferase or GFP, are useful. Also considered part of this invention are transgenic eukaryotes, for example but not limited to plants containing the chimeric gene construct of the present invention. However, it is to be understood that the chimeric gene constructs of the present invention may also be combined with nucleic acid sequence of interest for expression within a range of eukaryotic hosts. In instances where the eukaryotic host is a plant, methods of regenerating whole plants from plant cells are also known in the art. In general, transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques. Transgenic plants can also be generated without using tissue cultures (for example, Clough and Bent, 1998). The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, micro-injection, electroporation, etc. For reviews of such techniques see for example Weissbach and Weissbach, 1988; Geierson and Corey, 1988; and Miki and Iyer, 1997; Clough and Bent, 1998). The present invention further includes a suitable vector comprising the chimeric gene construct. The DNA binding protein which is employed in the method of the present invention may be naturally produced in an organism other than a plant. For example, but not wishing to be considered limiting, a ROS repressor is encoded by a nucleotide sequence of bacterial origin and, as such the nucleotide sequence may be optimised, for example, by changing its codons to favour plant codon usage, by attaching a nucleotide sequence encoding a nuclear localisation signal (NLS), for example but not limited to SV40 localization signal (see Robbins et al., 1991; Rizzo, P., et al., 1991; which are incorporated herein by reference) in order to improve the efficiency of ROS transport to the plant nucleus to facilitate the interaction with its respective operator, or both optimizing plant codon usage. Addition of an NLS to a fusion protein comprising a binding domain, for example the ROS repressor binding domain, and a recruitment factor, may also ensure targeting of the fusion product to the nuclear compartment. Similar optimization may be performed for other DNA binding proteins of non-plant source, however, such optimization may not always be required. Other possible nuclear localization signals that may be fused to a DNA binding protein include but are not limited to those listed in Table 1: TABLE 1nuclear localization signalsNuclear ProteinOrganismNLSRefAGAMOUSARienttnrqvtfcKRR(SEQ ID NO:13)1TGA-1ATRRlaqnreaaRKsRlRKK(SEQ ID NO:14)2TGA-1BTKKRaRlvrnresaqlsRqRKK(SEQ ID NO:15)2O2 NLS BMRKRKesnresaRRsRyRK(SEQ ID NO:16)3NIaVKKnqkhklkm-32aa-KRK(SEQ ID NO:17)4NucleoplasminXKRpaatkkagqaKKKKl(SEQ ID NO:18)5NO38XKRiapdsaskvpRKKtR(SEQ ID NO:19)5N1/N2XKRKteeesplKdKdaKK(SEQ ID NO:20)5GlucocorticoidreceptorM,RRkclqagmnleaRKtKK(SEQ ID NO:21)5a receptorHRKclqagmnleaRKtKK(SEQ ID NO:22)5β receptorHRKclqagmnleaRKtKK(SEQ ID NO:23)5ProgesteroneC,H,RaRKccqagmvlggRKfKK(SEQ ID NO:24)5receptorAndrogenHRKcyeagmtlgaRKlKK(SEQ ID NO:25)5receptorp53CRRcfevrvcacpgRdRK(SEQ ID NO:26)5+ A, Arabidopsis; X, Xenopus; M, mouse; R, rat; Ra, rabbit; H, human; C, chicken; T, tobacco; M, maize; V, potyvirus.References:1. Yanovsky et at., 19902. van der Krol and Chua, 19913. Varagona et at., 19924. Carrington et at., 19915. Robbins et at., 1991 Incorporation of a nuclear localization signal into the fusion protein of the present invention may facilitate migration of the fusion protein, into the nucleus. Without wishing to be bound by theory, reduced levels of fusion proteins elsewhere within the cell may be important when the DNA binding portion of the fusion protein may bind analogue operator sequences within other organelles, for example within the mitochondrion or chloroplast. Furthermore, the use of a nuclear localization signal may permit the use of a less active promoter or regulatory region to drive the expression of the fusion protein while ensuring that the concentration of the expressed protein remains at a desired level within the nucleus, and that the concentration of the protein is reduced elsewhere in the cell. Referring now to FIGS. 2A-C , there is shown aspects of an embodiment of the method of the present invention. Shown in FIG. 2A are two constructs which have been introduced within a plant cell. The constructs comprise: 1) a first nucleotide sequence ( 10 ) comprising, a) a nucleic acid sequence of interest ( 20 ) operatively linked to a first regulatory region ( 30 );b) an operator sequence ( 40 ) capable of binding a fusion protein ( 85 , FIG. 2B ), and;2) a second nucleotide sequence ( 60 ) comprising a second regulatory region ( 70 ) in operative association with a nucleotide sequence ( 80 ) encoding a fusion protein ( 85 ). The fusion protein ( FIG. 2B ; 85 ) encoded by nucleotide sequence ( 80 ) comprises a) a DNA binding protein ( 100 ), or a portion of a DNA binding protein capable of binding the operator sequence ( 40 , FIG. 2A ), and;b) a recruitment factor protein ( 110 ), or a portion of a recruitment factor protein capable of binding a chromatin remodelling protein ( 120 ), for example but not limited to histone deacetylase, HDAC. In the example shown in FIG. 2 A-C, the operator sequence ( 40 ) is shown as being upstream from the regulatory region ( 30 ), however, the operator sequence may also be positioned downstream from the regulatory region ( 40 ), for example between the regulatory region ( 40 ) and the nucleic acid sequence of interest ( 20 ; see for example the constructs in FIG. 5A-D ), within the coding region of the nucleic acid sequence of interest ( 20 ), or downstream of the nucleic acid sequence of interest ( 20 ). Referring now to FIG. 2C , but without wishing to be bound by theory, transcription and translation of nucleotide sequence ( 60 ; FIG. 2A ) produces fusion protein ( 80 ; FIG. 2B ) which is capable of binding operator sequence ( 40 ; FIG. 2A ) and for example, histone deacetylase ( 120 ). Without wishing to be bound by theory, the dual binding of histone deacetylase ( 120 ) to fusion protein ( 85 ) and fusion protein ( 85 ) to operator sequence ( 40 ) facilitates enzymatic deacetylation of histones (via bound histone deacetylase) in proximity of the nucleic acid sequence of interest ( 20 ) thereby causing repression of the nucleic acid sequence of interest ( 20 ). The first ( 10 ) and second ( 60 ) nucleotide sequences may be placed within the same or within different vectors, genetic constructs, or nucleic acid molecules. Preferably, the first nucleotide sequence and the second nucleotide sequence are chromosomally integrated into a plant or plant cell. The two nucleotide sequences may be integrated into two different genetic loci of a plant or plant cell, or the two nucleotide sequences may be integrated into a singular genetic locus of a plant or plant cell. However, the second nucleotide sequence may be integrated into the DNA of the plant or it may be present as an extra-chromosomal element, for example, but not wishing to be limiting a plasmid. Furthermore, the first and second regulatory regions may be the same or different, and maybe active in a constitutive, temporal, developmental or inducible manner. Referring now to FIGS. 3A-C , there is shown aspects of an alternate embodiment of the method of the present invention. Shown in FIG. 3A are two constructs which have been introduced into a plant cell. The constructs comprise: 1) a first nucleotide sequence ( 10 ) comprising, a) a nucleic acid sequence of interest ( 20 ) operatively linked to a regulatory region ( 30 ),b) an operator sequence ( 40 ) capable of binding a fusion protein ( 85 , FIG. 3B ), and;2) a second nucleotide sequence ( 60 ) comprising a regulatory region ( 70 ) in operative association with a nucleotide sequence ( 80 ) encoding a fusion protein ( 85 ). The fusion protein ( 85 ) encoded by nucleotide sequence ( 80 ) comprises, a) a DNA binding protein ( 100 ), or a portion of a DNA binding protein capable of binding the operator sequence ( 40 ), and;b) a recruitment factor protein ( 110 ), or a portion of a recruitment factor protein capable of binding a chromatin remodelling protein, for example but not limited, to free histone acetyltransferase (HAT) ( 120 ). In the example shown in FIG. 3 A-C, the operator sequence ( 40 ) is shown as being upstream from the regulatory region ( 30 ), however, the operator sequence may also be positioned downstream from the regulatory region ( 40 ), for example between the regulatory region ( 40 ) and the nucleic acid sequence of interest ( 20 ; see for example the constructs in FIG. 5A-D ), within the coding region of the nucleic acid sequence of interest ( 20 ), or downstream of the nucleic acid sequence of interest ( 20 ). Referring now to FIG. 3C , but without wishing to be bound by theory, transcription and translation of nucleotide sequence ( 80 ; FIG. 3A ) produces fusion protein ( 85 ; FIG. 3B ) which is capable of binding operator sequence ( 40 ; FIG. 3A ) and free histone acetyltransferase ( 120 ). Dual binding of histone acetyltransferase ( 120 ) to fusion protein ( 85 ) and fusion protein ( 85 ) to operator sequence ( 40 ) facilitates enzymatic acetylation of histones (via bound histone acetyltransferase) in proximity of the nucleic acid sequence of interest ( 20 ) thereby causing an increase in the transcription of the nucleic acid sequence of interest ( 20 ). The present invention also relates to a method of enhancing the expression of a nucleic acid sequence of interest or enhancing the transcription of one or more selected nucleotide sequences by transforming a plant with one or more constructs comprising: 1) a first nucleotide sequence comprising, a) a nucleic acid sequence of interest operatively linked to a regulatory region, and;b) an operator sequence that interacts with a fusion protein;2) a second nucleotide sequence comprising a regulatory region in operative association with a nucleotide sequence encoding a fusion protein comprising, a) a DNA binding protein, or a portion of a DNA binding protein capable of binding the operator sequence, and;b) a histone acetyltransferase (HAT) protein, or portion of a histone acetyltransferase protein which is capable of increasing histone acetylation; and wherein binding of the fusion protein to the operator sequence increases histone acetylation in the proximity of the nucleic acid sequence of interest within the first nucleotide sequence thereby increasing the transcription of the nucleic acid sequence of interest. These first and second nucleotide sequences may be placed within the same or within different vectors, genetic constructs, or nucleic acid molecules. Preferably, the first nucleotide sequence and the second nucleotide sequence are chromosomally integrated into a plant or plant cell. The two nucleotide sequences may be integrated into two different genetic loci of a plant or plant cell, or the two nucleotide sequences may be integrated into a singular genetic locus of a plant or plant cell. However, the second nucleotide sequence may be integrated into the DNA of the plant or it may be present as an extra-chromosomal element, for example, but not wishing to be limiting a plasmid, or transiently expressed, for example when using viral vectors, bioloistics for transformation. Preferably, the operator sequence is located in a nucleotide region that does not sterically hinder binding of transcription factors to the regulatory region, binding of the RNA polymerase to the nucleic acid sequence of interest, or migration of the polymerase along the DNA of the first nucleotide sequence, nucleic acid sequence of interest or both. Referring now to FIGS. 4A-C , there is shown aspects of an embodiment of the method of the present invention. Shown in FIG. 4A are two constructs which have been introduced within a plant cell. The constructs comprise: 1) a first nucleotide sequence ( 10 ) comprising, a) a nucleic acid sequence of interest ( 20 ) operatively linked to a regulatory region ( 30 ),b) an operator sequence ( 40 ) capable of binding a fusion protein ( 85 ), and;2) a second nucleotide sequence ( 60 ) comprising a regulatory region ( 70 ) in operative association with a nucleotide sequence ( 80 ) encoding a fusion protein ( 85 ). The fusion protein ( 85 ) encoded by nucleotide sequence ( 80 ) comprises a) a DNA binding protein ( 100 ), or a portion of a DNA binding protein capable of binding the operator sequence ( 40 ), and;b) a histone acetyltransferase protein ( 130 ), or a portion of a histone acetyltransferase protein. Referring now to FIG. 4C , but without wishing to be bound by theory, transcription and translation of nucleotide sequence ( 80 ; FIG. 4A ) produces fusion protein ( 85 ; FIG. 4B ) which comprises an active HAT protein ( 130 ), or portion thereof. Binding of the fusion protein ( 85 ) to the operator sequence facilitates enzymatic acetylation of histones in proximity to the nucleic acid sequence of interest ( 20 ) thereby enhancing the expression of a nucleic acid sequence of interest. In the example shown in FIG. 4 A-C, the operator sequence ( 40 ) is shown as being upstream from the regulatory region ( 30 ), however, the operator sequence may also be positioned downstream from the regulatory region ( 40 ), for example between the regulatory region ( 40 ) and the nucleic acid sequence of interest ( 20 ; see for example the constructs in FIG. 5A-D ), within the coding region of the nucleic acid sequence of interest ( 20 ), or downstream of the nucleic acid sequence of interest ( 20 ). Also contemplated by the present invention is the control of gene expression accomplished through combinations of activator, effector and gene of interest constructs as outlined in FIGS. 29 A and B (see Example 6). With reference to FIG. 29A , the expression of a gene of interest (reporter) is regulated using three constructs: a reporter construct (or gene of interest construct),an activator construct andan effector construct. The gene of interest construct includes a gene of interest, for example but not limited to a reporter gene (e.g. the lacZ gene), in operative association with a regulatory element and an operator sequence. The activator construct comprises a nucleic acid sequence encoding a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein, fused with a nucleotide sequence encoding a DNA binding protein, or a fragment thereof. The recruitment factor protein may be, for example but not limited to BnSCL1, bnKCP1 or an active fragment thereof; the DNA binding protein could be, for example but not limited to VP16 or GAL4 DNA Binding domain. In this case the activator construct produces a VP16-bNSCL1 fusion protein. The effector plasmid includes a nucleic acid sequence encoding a chromatin remodelling factor, for example but not limited to HDA19, operatively associated with a regulatory element and a nucleic acid sequence encoding a nuclear localisation signal. The constructs are expressed in eukaryotes, for example plant, animal or yeast. When the activator construct is co-expressed with the gene of interest (reporter) construct, the DNA binding sequence binds the operator sequence of the gene of interest construct. This results in modification in the expression of the gene of interest due to interaction of the activator protein within the transcriptional machinery. In this example, the activator protein is fused to a recruitment factor protein, and the VP16-BnSCL1 fusion protein binds the Tet operator sequence of the gene activator construct resulting in increased expression of the gene of interest. Co-expression of the effector construct, in conjunction with the gene of interest and activator constructs, results in synthesis of a chromatin remodelling factor, in this case HAD19, which associates with the recruitment factor protein, BnSCL1. Association of HDAC with the construct expressing the gene of interst, reduces expression of the gene of interest. In a second aspect, the expression of a gene of interest is regulated using two constructs: a gene of interest (reporter)+activator and an effector construct as shown in FIG. 29B . Expression of the reporter+activator construct results in an increased expression of the gene of interest due to binding of the activator portion of the construct to the operator sequence of the gene of interest construct. This association may be inhibited in the presence of tetracycline. As in the case outlined with reference to FIG. 29A , above, co-expression of the effector construct results in reduced expression of the gene of interest due to association of HDAC to the activator-recruitment factor fusion protein (VP16-BnSCL1 fusion) The present invention also provides for a method to regulate expression of a nucleic acid sequence of interest, wherein the nucleic acid sequence of interest comprises an endogenous sequence. In this embodiment, a nucleotide sequence comprising a regulatory region in operative association with a nucleotide sequence encoding a recruitment factor, or a portion thereof, that is known to interact with a factor that binds the nucleic acid sequence of interest, is expressed in the host. The recruitment factor protein, or a portion thereof is capable of binding a chromatin remodelling protein, for example but not limited, HDAC or HAT, and the recruitment factors also interacts with endogenous factors that bind the nucleotide sequence of interest (e.g. transcription factors). In this manner, expression of the recruitment factor in a temporal, tissue specific, or induced manner will result in the expression of the recruitment factor that binds the chromatin remodelling factor and the transcription factor resulting in modulation of expression of the nucleic acid sequence of interest. A non-limiting example of this embodiment includes the expression of bnKCP1 and its interaction with HDAC and transcription factors ERF, SEBF or CBF. Therefore, the present invention provides a method to regulate expression of an endogenous nucleic acid sequence of interest in a plant comprising: i) introducing into the plant a nucleotide sequence comprising, a regulatory region, operatively linked with a nucleotide sequence encoding a recruitment factor protein, the recruitment factor protein capable of binding an endogenous DNA binding protein, the endogenous DNA binding protein characterized in binding a segment of a DNA sequence of the endogenous nucleotide sequence of interest, and;ii) growing the plant, wherein expression of the nucleotide sequence produces the recruitment factor thereby regulating expression of the endogenous nucleic acid sequence of interest. An alternate embodiment of the present invention includes a method to regulate expression of an endogenous nucleic acid sequence of interest. In this example, a DNA binding protein, or a portion thereof, known to interact with the DNA of an endogenous nucleic acid sequence of interest is fused to a chromatin remodelling factor. Expression of the fusion protein permits the recruitment factor portion of the fusion protein to interact or bind with a chromatin remodelling, for example but not limited to HDAC or HAT, and the DNA binding portion of the fusion protein binds the nucleotide sequence of interest. In this manner, expression of the fusion protein in a temporal, tissue specific, or induced manner will result in the expression of a recruitment factor that binds a chromatin remodelling factor and the DNA of a nucleic acid sequence of interest, resulting in modulation of expression of the endogenous nucleic acid sequence of interest. Examples of DNA binding proteins, or portions thereof, that bind endogenous nucleic acid sequences of interest, which are not to be considered limiting, include ERF, SEBF or CBF. A non-limiting example of a recruitment factor is bnKCP1 or BnSCL1. Therefore, the present invention also provides a method to regulate expression of an endogenous nucleic acid sequence of interest in a plant comprising: i) introducing into the plant a nucleotide sequence comprising, a regulatory region, operatively linked with a nucleotide sequence encoding a fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion thereof, capable of binding a segment of a DNA sequence of the endogenous nucleotide sequence of interest, and;b) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodelling protein; andii) growing the plant, wherein expression of the nucleotide sequence produces the fusion protein that regulates expression of the endogenous nucleic acid sequence of interest. With reference to FIG. 31 , the expression of a gene of interest within a plant, for example but not limited to tobacco, is decreased by approximately 50% in the presence of an effector plasmid (a second nucleotide sequence), when compared to the control, or similar plasmid that does not comprise a fusion protein. The effector plasmid comprises a second regulatory region in operative association with a nucleotide sequence encoding a fusion protein comprising a DNA binding protein, or a portion thereof (e.g. GAL4), capable of binding the operator sequence, and a recruitment factor, or portion thereof (e.g. BnSCL1) which is capable of binding a histone deacetylase protein. In the example presented in FIG. 31 , the effector plasmid comprises the fusion protein GAL4-BnSCL1. The decrease associated with the effector plasmid comprising the fusion protein shown in FIG. 31 , suggests that the recruitment factor, for example BnSCL, is able to recruit the tobacco ortholog of the transcription repressor HDA19 to the UAS GAL4 promoter to repress the expression the gene of interest. Without wishing to be bound by theory, the transcription and translation of the effector plasmid (GAL4-BnSCL1) produces the fusion protein (GAL4BD-BnSCL1), which is capable of binding to operator sequence in the reporter plasmid (the first nucleic acid sequence comprising UAS GAL4 ), and to the transcription repressor (HDA19). Duel bonding of transcription repressor to the fusion protein (e.g. HDA19 to GAL4BD-BnSCL1), and of the fusion protein to operator sequence (e.g. UAS GAL4 ) facilitates enzymatic deacetylation of histones (via HDA19) in proximity of the gene of interest thereby causing repression of expression of the gene of interest (in this case shown in FIG. 31 , the reporter gene, GUS). Therefore, the present invention also relates to a method of repressing expression of a nucleic acid sequence of interest or in a plant comprising: introducing into said plant: 1) a first nucleotide sequence comprising, a) the nucleic acid sequence of interest operatively linked to a first regulatory region, and;b) an operator sequence capable of binding a fusion protein;2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding the fusion protein, the fusion protein comprising, a) a DNA binding protein, or a portion of a DNA binding protein, capable of binding the operator sequence, and;b) a recruitment factor, or portion of a recruitment factor protein which is capable of binding a histone deacetylase (HAD) protein, wherein expression of the second nucleotide sequence produces the fusion protein that when bound to the operator sequence, represses expression of the nucleic acid sequence of interest. Non-limiting examples of recruitment factors include KID, for example bnKCP1, or fragments thereof (Example 4), BnSCL1, or fragments thereof (see Examples 5 and 7), ADA, SAGA, STAGA, PCAF, TFIID, and TFIIIC (see Lusser, 2001, Table 1, which is incorporated herein by reference), or it may be modified to include a DNA binding region, for example as outlined in FIG. 17 . An example, which is not to be considered limiting in any manner, bnKCP1, or active fragments thereof (see Example 4) can target transcription factors that are known to bind DNA, for example ERF, SEBF, or CBF. Another non-limiting example of a recruitment factor is BnSCL1, or active fragments thereof (see Examples 5 and 7). An example, which is not to be considered limiting, of a protein that interacts with bnKCP1 and BnSCL1 is the chromatin remodelling protein HDAC, for example HDA19. The recruitment factor is preferably BnSCL1, which has been shown to bind to HAD protein HDA19 (Example 7). The present invention also provides a method of repressing expression of a nucleic acid sequence of interest in a plant comprising: introducing into said plant: 1) a first nucleotide sequence comprising, a) the nucleic acid sequence of interest operatively linked to a first regulatory region, and;b) an operator sequence capable of binding a BnSCL-fusion protein;2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding the BnSCL-fusion protein, the BnSCL-fusion protein comprising, a) a DNA binding protein, or a portion of a DNA binding protein, capable of binding the operator sequence, and;b) BnSCL1, or a portion of the BnSCL1 protein, wherein expression of the second nucleotide sequence produces the BnSCL-fusion protein, that when bound to the operator sequence, represses expression of the nucleic acid sequence of interest. For example, which is not to be considered limiting in any manner, the operator sequence may include the yeast transcription factor GAL4 and the DNA binding protein may include the DNA binding domain of GAL4 (GAL4BD). The first regulatory region may be CaMV 35S promoter and the second regulatory region a tCUP promoter. Binding of the BnSCL-GAL4BD fusion protein to GAL4 typically increases histone deacetylation in the proximity of the nucleic acid sequence of interest within the first nucleotide sequence thereby decreasing transcription of the nucleic acid sequence of interest. Also contemplated by the present invention is a method of increasing cold tolerance in a plant. The method comprises providing a plant having a nucleotide sequence of interest operatively linked to a first regulatory region; the nucleotide sequence of interest encodes bnKCP1, or a fragment thereof. The plant is maintained under conditions where bnKCP1 is expressed. In this manner, the plant expressing bnKCP1 is preconditioned for cold adaptation and exhibits increased cold tolerance. By the term cold in the context of cold tolerance, it is meant a temperature in the range of about −10° C. to about 10° C. An example of cold temperature, without wishing to be limiting, is a temperature in the range of about −8° C. to about 8° C.; a further example is a temperature of about −10 to about −1° C. Sequences of the present invention are listed in Table 2. TABLE 2Sequences defined in the present inventionSEQ ID NO: 1aa seq of wild-type ROS ( A. tumefaciens )FIG. 1A (WT-ROS)SEQ ID NO: 2Nucl seq synthetic ROS optimized for plant, with NLSFIG. 1BSEQ ID NO: 3Consensus nucl seq of composite ROSFIG. 1CSEQ ID NO: 4aa seq of synthetic ROSFIG. 1A, 1CSEQ ID NO: 5ROS binding sequenceFIG. 1ESEQ ID NO: 6aa seq of NLS (PKKKRKV)SEQ ID NO: 7ROS operator sequenceSEQ ID NO: 8IPT gene operator sequenceSEQ ID NO: 9Operator sequence binding to ERFSEQ ID NO: 10Operator sequence binding to SEBFSEQ ID NO: 11Operator sequence binding to CBFSEQ ID NO: 12Operator sequence binding to CBFSEQ ID NO: 13NLS of AGAMOUS proteinTable 1, page 30SEQ ID NO: 14NLS of TGA-1A proteinTable 1, page 30SEQ ID NO: 15NLS of TGA-1B proteinTable 1, page 30SEQ ID NO: 16NLS of O2 NLS B proteinTable 1, page 30SEQ ID NO: 17NLS of NIa proteinTable 1, page 30SEQ ID NO: 18NLS of nucleoplasmin proteinTable 1, page 30SEQ ID NO: 19NLS of NO38 proteinTable 1, page 30SEQ ID NO: 20NLS of N1/N2 proteinTable 1, page 30SEQ ID NO: 21NLS of Glucocorticoid receptorTable 1, page 30SEQ ID NO: 22NLS of Glucocorticoid a receptorTable 1, page 30SEQ ID NO: 23NLS of Glucocorticoid b receptorTable 1, page 30SEQ ID NO: 24NLS of Progesterone receptorTable 1, page 30SEQ ID NO: 25NLS of Androgen receptorTable 1, page 30SEQ ID NO: 26NLS of p53 proteinTable 1, page 30SEQ ID NO: 27VirC/VirD operator seqFIG. 1DSEQ ID NO: 28ROS-OPDS, p74–315SEQ ID NO: 29ROS-OPDA, p74–315SEQ ID NO: 30ROS-OPUS, p74–316SEQ ID NO: 31ROS-OPUA, p74–316SEQ ID NO: 32ROS-OPPS, p74–309SEQ ID NO: 33ROS-OPPA, p74–309SEQ ID NO: 34ROS-OP1, p74–508SEQ ID NO: 35ROS-OP2, p74–508SEQ ID NO: 36tms2 promoter sense primer, p74–508SEQ ID NO: 37tms2 promoter anti-sense primer, p74–508SEQ ID NO: 38Actin2 promoter sense primer, p74–501SEQ ID NO: 39Actin2 promoter anti-sense primer, p74–501SEQ ID NO: 40p74–315 seq from EcoRV to ATG of GUSSEQ ID NO: 41p74–316 seq from EcoRV to ATG of GUSSEQ ID NO: 42p74–309 seq from EcoRV to ATG of GUSSEQ ID NO: 43p74–118 seq from EcoRV to ATG of GUSSEQ ID NO: 44Forward primer for HDA19 A. thaliana ,pDBLeu-HDA19SEQ ID NO: 45Reverse primer for HDA19 A. thaliana ,pDBLeu-HDA19SEQ ID NO: 46Forward primer for Gcn5 Arabidopsis ,GST-Gcn5SEQ ID NO: 47Reverse primer for Gcn5 Arabidopsis ,GST-Gcn5SEQ ID NO: 48Reverse primer for HDA19, GST-HDA19SEQ ID NO: 49Forward primer for bnKCP1, 1–80, 1–160(generation of mutants)SEQ ID NO: 50Reverse primer for bnKCP1 1–160(generation of mutants)SEQ ID NO: 51Reverse primer for bnKCP1 1–80(generation of mutants)SEQ ID NO: 52Reverse primer for bnKCP1 (generationof mutants)SEQ ID NO: 53Forward primer for bnKCP1, 1–80 and1–160(in vivo assay and transactivation assay)SEQ ID NO: 54Reverse primer for bnKCP1 (in vivoassay and transactivation assay) and 81–215(transactivation assay)SEQ ID NO: 55Reverse primer for bnKCP1 1–160(in vivo assay and transactivation assay)SEQ ID NO: 56Reverse primer for bnKCP1 1–80(in vivo assay and transactivation assay)SEQ ID NO: 57Forward primer for bnKCP1G188SEQ ID NO: 58Reverse primer for bnKCP1G188SEQ ID NO: 59Forward primer for bnKCP1 81–215(transactivation assay)SEQ ID NO: 60Forward primer for entire coding regionof bnKCP1SEQ ID NO: 61Reverse primer for entire coding regionof bnKCP1SEQ ID NO: 62pat7 NLS (PLNKKRR)SEQ ID NO: 63aa seq of ROSR (ROS repressor)FIG. 1ASEQ ID NO: 64aa seq of ROSAR (ROS repressor)FIG. 1ASEQ ID NO: 65aa seq of MucR (ROS repressor)FIG. 1ASEQ ID NO: 66VirC/VirD DNA binding site seq (1)FIG. 1DSEQ ID NO: 67VirC/VirD DNA binding site seq (2)FIG. 1DSEQ ID NO: 68ipt DNA binding site seq (1)FIG. 1DSEQ ID NO: 69ipt DNA binding site seq (2)FIG. 1DSEQ ID NO: 70Consensus DNA binding site seqFIG. 1DSEQ ID NO: 71bnKCP aa seqFIG. 10ASEQ ID NO: 72atKCP aa seqFIG. 10ASEQ ID NO: 73atKCL1 aa seqFIG. 10ASEQ ID NO: 74atKCL2 aa seqFIG. 10ASEQ ID NO: 75bnKCP aa seqFIG. 10BSEQ ID NO: 76ATF-1 aa seqFIG. 10BSEQ ID NO: 77hyCREB aa seqFIG. 10BSEQ ID NO: 78CREB aa seqFIG. 10BSEQ ID NO: 79CREM aa seqFIG. 10BSEQ ID NO: 80cCREM aa seqFIG. 10BSEQ ID NO: 81aa seq of BnSCL1FIG. 20SEQ ID NO: 82aa seq of atSCL15FIG. 20SEQ ID NO: 83aa seq of lsSCRFIG. 20SEQ ID NO: 84BnSCL1 sense primerSEQ ID NO: 85BnSCL1 anti-sense primerSEQ ID NO: 86BnIAA1 sense primerSEQ ID NO: 87BnIAA1 anti-sense primerSEQ ID NO: 88BnIAA12 sense primerSEQ ID NO: 89BnIAA12 anti-sense primerSEQ ID NO: 90Forward primer for BnSCL1, BnSCL1 1–358 ,BnSCL1 1–261 , BnSCL1 1–217 andBnSCL1 1–145 for pET-28b vectorSEQ ID NO: 91Reverse primer for BnSCL1 for pET-28b vectorSEQ ID NO: 92Reverse primer for BnSCL1 1–358 forpET-28b vectorSEQ ID NO: 93Reverse primer for BnSCL1 1–261 forpET-28b vectorSEQ ID NO: 94Reverse primer for BnSCL1 1–217 for pET-28b vectorSEQ ID NO: 95Reverse primer for BnSCL1 1–145 forpET-28b vectorSEQ ID NO: 96Forward primer for BnSCL1, BnSCL1 1–358 ,BnSCL1 1–261 , BnSCL1 1–217 andBnSCL1 1–145 for pPC86 vectorSEQ ID NO: 97Forward primer for BnSCL1 146–358 forPC86 vectorSEQ ID NO: 98Forward primer for BnSCL1 218–434 forPC86 vectorSEQ ID NO: 99Reverse primer for BnSCL1 andBnSCL1 218–434 for PC86 vectorSEQ ID NO: 100Reverse primer for BnSCL1 1–358 forPC86 vectorSEQ ID NO: 101Reverse primer for BnSCL1 1–261 forPC86 vectorSEQ ID NO: 102Reverse primer for BnSCL1 1–217 forPC86 vectorSEQ ID NO: 103Reverse primer for BnSCL1 1–145 forPC86 vectorSEQ ID NO: 104aa seq of LXXLL motif ( 148 LGSLL 152 )SEQ ID NO: 105Forward primer for GAL4BDSEQ ID NO: 106Reverse primer for GAL4BDSEQ ID NO: 107Forward primer for BnSCL1SEQ ID NO: 108Reverse primer for BnSCL1 The above description is not intended to limit the claimed invention in any manner, furthermore, the discussed combination of features might not be absolutely necessary for the inventive solution. The present invention will be further illustrated in the following examples. However it is to be understood that these examples are for illustrative purposes only, and should not be used to limit the scope of the present invention in any manner. EXAMPLES Materials and Methods Plant Material Wild type Arabidopsis thaliana , ecotype Columbia, seeds were germinated on RediEarth (W.R. Grace & Co.) soil in pots covered with window screens under green house conditions (˜25° C., 16 hr light). Emerging bolts were cut back to encourage further bolting. Plants were used for transformation once multiple secondary bolts had been generated. Plant Transformation Plant transformation was carried out according to the floral dip procedure described in Clough and Bent (1998). Essentially, Agrobacterium tumefaciens transformed with the construct of interest (using standard methods as known in the art) was grown overnight in a 100 ml Luria-Bertani Broth (10 g/L NaCl, 10 g/L tryptone, 5 g/L yeast extract) containing 50 μg/ml kanamycin. The cell suspension culture was centrifuged at 3000×g for 15 min. The pellet was resuspended in 1L of the transformation buffer (sucrose (5%), SILWET L77 (0.05%)(Loveland Industries). The above-ground parts of the Arabidopsis plants were dipped into the Agrobacterium suspension for ˜1 min and the plants were then transferred to the greenhouse. The entire transformation process was repeated twice more at two day intervals. Plants were grown to maturity and seeds collected. To select for transformants, seeds were surface sterilized by washing in 0.05% TWEEN 20 for 5 minutes, with 95% ethanol for 5 min, and then with a solution containing sodium hypochlorite (1.575%) and TWEEN 20 (0.05%) for 10 min followed by 5 washings in sterile water. Sterile seeds were plated onto either Pete Lite medium (20-20-20 Peter's Professional Pete Lite fertilizer (Scott) (0.762 g/l), agar (0.7%), kanamycin (50 μg/ml), pH 5.5) or MS medium (MS salts (0.5×)(Sigma), B5 vitamins (1×), agar (0.7%), kanamycin (50 μg/ml) pH 5.7). Plates were incubated at 20° C., 16 hr light/8 hr dark in a growth room. After approximately two weeks, seedlings possessing green primary leaves were transferred to soil for further screening and analysis. Example 1 Optimization of ROS Protein Coding Region The ros nucleotide sequence is derived from Agrobacterium tumefaciens (SEQ ID NO:1; FIG. 1A ). Analysis of the protein coding region of the ros nucleotide sequence indicates that the codon usage may be altered to better conform to plant translational machinery. The protein coding region of the ros nucleotide sequence was therefore modified to optimize expression in plants (SEQ ID NO:2; FIG. 1B ). The nucleic acid sequence of the ROS repressor was examined and the coding region modified to optimize for expression of the gene in plants, using a procedure similar to that outlined by Sardana et al. (1996). A table of codon usage from highly expressed genes of dicotyledonous plants was compiled using the data of Murray et al. (1989). The ros nucleotide sequence was also modified (SEQ ID NO:2; FIG. 1B ) to ensure localization of the ROS repressor to the nucleus of plant cells, by adding a SV40 nuclear localization signal (Rizzo, P. et al., 1999; The nuclear localization signal resides at amino acid positions 126-132; accession number AAF28270). The ros gene is cloned from Agrobacterium tumefaciens by PCR. The nucleotide sequence encoding the ROS protein is expressed in, and purified from, E. coli , and the ROS protein used to generate an anti-ROS antiserum in rabbits using standard methods (Sambrook et al.). Example 2 Constructs Placing a Nucleic Acid Sequence of Interest Under Transcriptional Control of Regulatory Regions that Have Been Modified to Contain ROS Operator Sites, and Preparation of Reporter Lines p74-315: Construct for The Expression of GUS Gene Driven by a CaMV 35S Promoter Containing a ROS Operator Downstream of TATA Box ( FIG. 5(A) ). The BamHI-EcoRV fragment of CaMV 35S promoter in pBI121 is cut out and replaced with a similar synthesized DNA fragment in which the 25 bp immediately downstream of the TATA box were replaced with the ROS operator sequence: TATATTTCAATTTTATTGTAATATA.(SEQ ID NO: 7) Two complementary oligos, ROS-OPDS (SEQ ID NO:28) and ROS-OPDA (SEQ ID NO:29), with built-in BamHI-EcoRV ends, and spanning the BamHI-EcoRV region of CaMV35S, in which the 25 bp immediately downstream of the TATA box are replaced with the ROS operator sequence (SEQ ID NO: 7), are annealed together and then ligated into the BamHI-EcoRV sites of CaMV35S. ROS-OPDS:(SEQ ID NO:28)5′-ATC TCC ACT GAG GTA AGG GAT GAC GCA CAA TCC CACTAT CCT TCG CAA GAC CCT TCC TCT ATA TAA TAT ATTTCA ATT TTA TTG TAA TAT AAC ACG GGG GAC TCT AGAG-3′ROS-OPDA:(SEQ ID NO:29)5′-G ATC CTC TAG AGT CCC CCG TGT TAT ATT ACA ATAAAA TTG AAA TAT ATT ATA TAG AGG AAG GGT CTT GCGAAG GAT AGT GGG ATT GTG CGT CAT CCC TTA CGT CAGTGG AGA T-3′ The p74-315 sequence from the EcoRV site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box—lower case in bold; the synthetic ROS sequence—bold caps; a transcription start site—ACA, bold italics; BamHI site—GGA TCC; and the first of GUS, ATG, in italics; are also indicated): (SEQ ID NO:40)5′- GAT ATC TCC ACT GAC GTA AGG GAT GAC GCA CAA TCCCAC TAT CCT TCG CAA GAC CCT TCC TC t ata taA TATATT TCA ATT TTA TTG TAA TAT A AC ACG GGG GAC TCTAGA GGA TCC CCG GGT GGT CAG TCC CTT ATG-3′ p74-316: Construct for The Expression of GUS Driven by a CaMV 35 S Promoter Containing a ROS Operator Upstream of TATA Box ( FIG. 5(B) ). The BamH1-EcoRV fragment of CaMV 35S promoter in pBI121 is cut out and replaced with a similar synthesized DNA fragment in which the 25 bp immediately upstream of the TATA box are replaced with the ROS operator sequence (SEQ ID NO: 7). Two complementary oligos, ROS-OPUS (SEQ ID NO:30) and ROS-OPUA (SEQ ID NO:31), with built-in BamHI-EcoRV ends, and spanning the BamHI-EcoRV region of CaMV35S, in which the 25 bp immediately upstream of the TATA box were replaced with a ROS operator sequence (SEQ ID NO: 7), are annealed together and then ligated into the BamHI-EcoRV sites of CaMV35S. ROS-OPUS:(SEQ ID NO:30)5′-ATC TCC ACT GAC GTA AGG GAT GAC GCA CAA TCT ATATTT CAA TTT TAT TGT AAT ATA CTA TAT AAG GAA GTTCAT TTC ATT TGG AGA GAA CAC GGG GGA CTC TAG AG -3′ROS-OPUA:(SEQ ID NO:31)5′-G ATC CTC TAG AGT CCC CCG TGT TCT CTC CAA ATGAAA TGA ACT TCC TTA TAT AGT ATA TTA CAA TAA AATTGA AAT ATA GAT TGT GCG TCA TCC CTT ACG TCA GTGGAG AT-3′ The p74-316 sequence from the EcoRV site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box—lower case in bold; the synthetic ROS sequence—bold caps; a transcription start site—ACA, bold italics; BamHI site—GGA TCC; the first codon of GUS, ATG—italics, are also indicated): (SEQ ID NO:41)5′- GAT ATC TCC ACT GAC GTA AGG GAT GAC GCA CAA TC TATA TTT CAA TTT TAT TGT AAT ATA Cta tat a AG GAAGTT CAT TTC ATT TGG AGA GA A CA C GGG GGA CTC TAGA GG ATC C CC GGG TGG TCA GTC CCT T AT G-3′ p74-309: Construct for The Expression of GUS Driven by a CaMV 35 S Promoter Containing ROS Operators Upstream and Downstream of TATA Box ( FIG. 5(C) ). The BamH1-EcoRV fragment of CaMV 35S promoter in pBI121 is cut out and replaced with a similar synthesized DNA fragment in which the 25 bp immediately upstream and downstream of the TATA box were replaced with two ROS operator sequences (SEQ ID NO: 7). Two complementary oligos, ROS-OPPS (SEQ ID NO:32) and ROS-OPPA (SEQ ID NO:33), with built-in BamHI-EcoRV ends, and spanning the BamHI-EcoRV region of CaMV35S, in which the 25 bp immediately upstream and downstream of the TATA box are replaced with two ROS operator sequences, each comprising the sequence of SEQ ID NO: 7 (in italics, below), are annealed together and ligated into the BamHI-EcoRV sites of CaMV35S. ROS-OPPS:(SEQ ID NO:32)5′-atc tcc act gac gta agg gat gac gca caa tc t atattt caa ttt tat tgt aat ata cta tat aat ata tttcaa ttt tat tgt aat ata aca cgg ggg act cta gag-3′ROS-OPPA:(SEQ ID NO: 33)5′-g atc ctc tag agt ccc ccg tgt tat att acaata aaa ttg aaa tat att ata tag tat att aca ataaaa ttg aaa tat a ga ttg tgc gtc atc cct tac gtcagt gga gat-3′ The p74-309 sequence from the EcoRV site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box—lower case in bold; two synthetic ROS sequence—bold caps; a transcription start site—ACA, bold italics; BamHI site—GGA TCC; the first codon of GUS, ATG—italics, are also indicated): (SEQ ID NO:42)5′- GAT ATC TCC ACT GAC GTA AGG GAT GAC GCA CAA TCTATA TTT CAA TTT TAT TGT AAT ATA Cta tat aAT ATATTT CAA TTT TAT TGT AAT ATA ACA CGG GGG ACT CTAGA G GAT C CC CGG GTG GTC AGT CCC TT A TG -3′ p74-118 Construct for The Expression of GUS Driven by a CaMV 35S Promoter Containing three ROS Operators Downstream of TATA Box ( FIG. 5(D) ). The BamH1-EcoRV fragment of CaMV 35S promoter in pBI121 is cut out and replaced with a similar synthesized DNA fragment in which a region downstream of the TATA box was replaced with three ROS operator sequences (SEQ ID NO:43). The first of the three synthetic ROS operator sequences is positioned immediately of the TAT box, the other two ROS operator sequence are located downstream of the transcriptional start site (ACA). Two complementary oligos with built-in BamHI-EcoRV ends were prepared as describe above for the other constructs were annealed together and ligated into the BamHI-EcoRV sites of CaMV35S. The p74-118 sequence from the EcoRV site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box—lower case in bold; three synthetic ROS sequence—bold caps; a transcription start site—ACA, bold italics; BamHI site—GGA TCC; the first codon of GUS, ATG—italics, are also indicated): (SEQ ID NO:43)5′- GAT ATC TCC ACT GAC GTA AGG GAT GAC GCA CAATCC CAC TAT CCT TCG CAA GAC CCT TCC TC t ata taATAT ATT TCA ATT TTA TTG TAA TAT A AC ACG GGG GACTCT AGA GGA TCC TAT ATT TCA ATT TTA TTG TAA TATAGC TAT ATT TCA ATT TTA TTG TAA TAT A AT CGA TTTCGA ACC CGG GGT ACC GAA TTC CTC GAG TCT AGA GGATCC CCG GGT GGT CAG TCC CTT ATG -3′ p76-508: Construct for The Expression of The GUS Gene Driven by the tms2 Promoter Containing a ROS Operator ( FIG. 6(B) ). The tms2 promoter is PCR amplified from genomic DNA of Agrobacterium tumefaciens 33970 using the following primers: sense primer:(SEQ ID NO:36)5′-TGC GGA TGC ATA AGC TTG CTG ACA TTG CTA GAAAAG-3′anti-sense primer:(SEQ ID NO:37)5′-CGG GGA TCC TTT CAG GGC CAT TTC AG-3′ The 352 bp PCR fragment is cloned into the EcoRV site of pBluescript, and sub-cloned into pGEM-7Zf(+). Two complementary oligos, ROS-OP1 (SEQ ID NO:34) and ROS-OP2 (SEQ ID NO:35), containing two ROS operators (in italics, below), are annealed together and cloned into pGEM-7Zf(+) as a BamHI/ClaI fragment at the 3′ end of the tms2 promoter. This promoter/operator fragment is then sub-cloned into pBI121 as a HindIII/XbaI fragment, replacing the CaMV 35S promoter fragment. ROS-OP1:(SEQ ID NO:34)5′-gat cct ata ttt caa ttt tat tgt aat ata gc t atattt caa ttt tat tgt aat ata at-3′ROS-P2:(SEQ ID NO:35)5′-cga tta tat tac aat aaa att gaa ata tag c ta tattac aat aaa att gaa ata ta g-3′. As a control, p76-507 comprising a tms2 promoter (without any operator sequence) fused to GUS (FIG. 4 (A)), is also prepared. p74-501: Construct for The Expression of The GUS Gene Driven by The Actin2 Promoter Containing a ROS operator ( FIG. 7B )). The Actin2 promoter is PCR amplified from genomic DNA of Arabidopsis thaliana ecotype Columbia using the following primers: Sense primer:5′- AAG CTT ATG TAT GCA AGA GTC AGC-3′(SEQ ID NO:38)SpeIAnti-sense primer:5′- TTG ACT AGT ATC AGC CTC AGC CAT-3′(SEQ ID NO:39) The PCR fragment is cloned into pGEM-T-Easy. Two complementary oligos, ROS-OP1 (SEQ ID NO:34) and ROS-OP2 (SEQ ID NO:35), with built-in BamHI and ClaI sites, and containing two ROS operators, are annealed together and inserted into the Actin2 promoter at the BglII/ClaI sites replacing the BglII/ClaI fragment. This modified promoter is inserted into pBI121 vector as a HindIII/BamHI fragment. As a control, p75-101, comprising an actin2 promoter (without any operator sequence) fused to GUS (FIG. 7 (A)), is also prepared. The various constructs are introduced into Arabidopsis , as described above, and transgenic plants are generated. Transformed plants are verified using PCR or Southern analysis. FIG. 8(A) show Southern analysis of transgenic plants comprising a first genetic construct, for example, p74-309 (35S-ROS operator sequence-GUS, FIG. 5(C) ) Example 3 Crossing of Transgenic Lines Containing Fusion Constructs with Transgenic Lines Containing GUS Reporter Constructs Transgenic Arabidopsis lines containing fusion constructs (second genetic constructs) are crossed with lines containing appropriate reporter (GUS) constructs (first genetic constructs). To perform the crossing, open flowers are removed from plants of the reporter lines. Fully formed buds of plants of the repressor lines are gently opened and emasculated by removing all stamens. The stigmas are then pollinated with pollen from plants of the repressor lines and pollinated buds are tagged and bagged. Once siliques formed, the bags are removed, and mature seeds are collected. Plants generated from these seeds are then used to determine the level of reporter gene (GUS) repression by GUS staining. Levels of GUS expression in the hybrid lines are compared to those of the original reporter lines. Plants showing a modified GUS expression levels are further characterized using PCR, Southern and Northern analysis. Example 4 Preparation of a Chromatin Remodelling Factor HDAC was used as an example of a chromatin remodelling factor that may be isolated from an organism. Transcription factors that recruit histone deacetylase (HDAC) to target promoters in Brassica napus were identified in vivo by screening a yeast two-hybrid library using the Arabidopsis thaliana HDA19 as bait. A cDNA clone that encodes a novel protein, bnKCP1, containing a kinase-inducible domain (KID) was identified. Southern blot analysis indicated that the bnKCP1 gene belongs to a small gene family of at least three members, and northern blot analysis showed that it was strongly expressed in stems, flowers, roots and immature siliques seeds, but not in leaf blades. In vitro protein binding assays showed that the protein is able to interact with both HDA19 and histone acetyltransferase (HAT) and that the KID domain is required for this interaction with HDA19 and HAT in vitro. When assayed in vivo, bnKCP1 exerted modest activation of transcription of a reporter gene in yeast. The cAMP-responsive element (CRE) binding protein (CREB) binds to the CREB-binding protein (CBP) in response to extracellular stimuli that induce intracellular accumulation of secondary messengers Ca 2+ and cAMP. The KID domain is highly conserved in the CREB family proteins, CREB, CREM and ATF-1 (Montminy, 1997). Each protein in this family has a serine phosphorylation site (RRP S 133 ) within the KID domain, which is recognised by protein kinase A (PK-A) that phosphorylates S 133 . PK-A in turn is induced by outside stimuli that induce intracellular accumulation of Ca 2+ and cAMP. CREB binding activity is regulated through S 133 phosphorylation, which leads to interaction of CREB with CBP. The KIX domain of CBP is required for interaction with the KID domain of CREB having a phosphorylated S 133 (see review Montminy, 1997). Interestingly, CBP possesses intrinsic HAT activity (Bannister and Kouzarides, 1996; Ogryzko et al., 1996) suggesting that recruitment of CBP to target promoters by the transcription activator CREB may contribute to the transcriptional activation of CRE-dependent genes by the involvement of histone acetylation at the genetic loci of target genes. In Arabidopsis , a HAT gene encoding an ortholog of the yeast GCN5 was found to bind in vitro to two proteins similar to the yeast HAT-adaptor proteins ADA2, ADA2a and ADA2b (Stockinger et al., 2001). Moreover, the transcription activator CBF1 was found to bind to both HAT and ADA2, indicating that these proteins might be recruited to target cold-inducible genes by binding to CBF1 (Stockinger et al., 2001). The finding that the Arabidopsis ADA2 and GCN5 genes share similarity with their counterparts in yeast and humans suggests that chromatin remodelling complexes are conserved even among evolutionary distant organisms. Experimental Procedures Brassica napus L. cv Cascade (winter type), Westar (spring type) and DES010 (spring type) were used for the isolation of genomic DNA and total RNA. Leaves, flowers, stems, siliques and immature seeds were harvested from plants cultured in a controlled-environment greenhouse programmed for a photoperiod of 16 h day and 8 h night. Roots were obtained by culturing sterilized seeds in 0.8% agar plates containing ½ MS medium and 1% sucrose. For cold acclimation (4° C.), abscisic acid (250 μM), drought and high salt (850 mM NaCl) treatments, four-leaf stage seedlings were treated and fourth fully expanded leaf blades were harvested as described by Gao et al. (2002). LaCl3 and inomycin treatments were carried out by watering four-leaf stage plants with 20 mM LaCl 3 and 10 μM inomycin, respectively. Plants were covered with SARAN Wrap to slow evaporation. Yeast Two-Hybrid Screening and Cloning A yeast two-hybrid cDNA library (Dr. Isobel Parkin, Agriculture and Agri-Food Canada Research Centre, Saskatoon) was constructed from poly(A) mRNA isolated from the above-ground parts of the four-leaf stage seedlings of B. napus L. cv. DH12075 and cloned into a GAL4 AD (activation domain) vector pPC86 using the SUPERSCRIPT Plasmid System for cDNA Synthesis and Plasmid Cloning (GibcoL BRL). To generate the pDBLeu-HDA19 construct, the entire coding region of Arabidopsis thaliana RPD3-type HDA19 cDNA (Accession # AF195547) was PCR amplified using PWO DNA polymerase (Roche) with a forward primer: (SEQ ID NO:44)5′-GCGTCGACGATGGATACTGGCGGCAATTCGC-3′and a reverse primer:(SEQ ID NO:45)5′-AGGCGGCCGCTTATGTTTTAGGAGGAAACGCC-3′. The identity of the PCR product was confirmed by DNA sequence analysis and inserted into the SalI and NotI sites of the Gal4 DB (DNA binding domain) vector pDBLeu in-frame with the GAL4 sequence and used as a bait to screen the B. napus cDNA library using PROQUEST Two-Hybrid System (GibcoL BRL). Approximately 1×10 6 transformants were subjected to the two-hybrid selection on synthetic complete (SC) medium lacking leucine, tryptophan and histidine but containing 15 mM 3-amino-1,2,4-triazole (3AT®). The expression of the HIS3 reporter gene allowed colonies to grow on the selective medium and the putative His+(3AT®) positive transformants were tested for the induction of the two other reporter genes, URA3 and lacZ. The positive colonies were reassessed by retransformation assays and the cloned cDNAs were identified by PCR and DNA sequence analysis. Southern Blot Analysis Total genomic DNA was isolated from the leaves of B. napus L. cv Westar using a modified CTAB (cetyltriethylammonium bromide) extraction method (Gao et al., 2002). Briefly, 10 μg of total genomic DNA was digested with EcoRI, XbaI, HindIII, PstI, EcoRV and KpnI restriction endonucleases, separated on a 0.8% agarose gel, transferred to HYBOND-XL membranes (Amersham Phamacia) and hybridized with the bnKCP1 open reading frame (ORF) labeled with [α- 32 P]dCTP using random primer labeling procedure. The DNA fragment to be used as a probe was isolated from a 0.8% agarose gel and purified with a QIAQUICK Gel Extraction Kit (Qiagen), and the probe was purified with a PROBEQUANT G-50 Micro Column (Amersham Phamacia). Hybridization was performed under high stringency conditions (Gao, M.-J. et al., 2002). Northern Blot Analysis Total RNA was isolated from the tissues of B. napus L. cv DES010. These included leaves and stems of four-leaf stage seedlings, flowers, immature siliques of adult plants, and roots of cultured seedlings as described by Gao et al. (2001). Probe labelling, hybridization, washing and membrane stripping were performed as described above in the Southern blot analysis Section. Expression and Purification of Recombinant Gcn5 and HDA19 The full coding regions of the Arabidopsis HAT, Gcn5 (Dr. M. Thomashow, Michigan State University, MI), and HDA19 (Accession # AF195547) were PCR amplified, sequence analyzed and inserted in-frame with the GST (glutathione s-transferase) into the SalI and NotI sites of vector pGEX-6P-2 (Amersham Pharmacia). The forward used for the amplification of Gcn5 was: (SEQ ID NO: 46)5′-GCGTCGACGATGGACTCTCACTCTTCCCACC-3′and the reverse primer for Gcn5 was:(SEQ ID NO: 47)5′-GCGCGGCCGCCTATTGAGATTTAGCACCAGA-3′ The forward primer for HDA19 was SEQ ID NO: 44, as listed above, and the reverse primer was: (SEQ ID NO:48)5′-GCGCGGCCGCTTATGTTTTAGGAGGAAACGC-3′. Recombinant pGEX-6P-2 plasmids were used to transform E. coli BL21-CodonPlus (DE3)-RP competent cells (Stratagene). Expression and purification under non-denaturing conditions were carried out as described by Gao et al. (Gao, M.-J. et al., 2002). The GST-Gcn5 and GST-HDA19 fusion proteins were analyzed by 7.5% SDS-PAGE (SDS-polyacrylamide gel electrophoresis) and western blotting with rabbit anti-GST-Pi polyclonal antibody (Chemicon) using ECL Western blotting analysis system (Amersham Pharmacia). Generation of Deletion Mutants of bnKCP1 The two fragments, bnKCP1 1-160 and bnKCP1 1-80 , and the entire coding region of bnKCP1 DNA encoding amino acids 1-80, 1-160 and 1-215, respectively, were amplified by PCR and cloned into the HindIII and XhoI sites of pET-28-b vector (Novagen, Madison, Wis.). The primers used for the amplification were as follows: bnKCP1 1–160 (240 bp): forward primer:(SEQ ID NO:49)5′-GCAAGCTTATGGCAGGAGGAGGACCAACT-3′,reverse primer:(SEQ ID NO:50)5′-CGCTCGAGCTCCTCCTCATCATTGTCTTC-3′;bnKCP1 1–80 (480 bp): forward primer:(SEQ ID NO:49)5′-GCAAGCTTATGGCAGGAGGAGGACCAACT-3′,reverse primer(SEQ ID NO:51)5′-CGCTCGAGATGAACAGGCAAAAGAGGCAT-3′;bnKCP1 (645 bp): forward primer:(SEQ ID NO:49)5′-GCAAGCTTATGGCAGGAGGAGGACCAACT-3′,reverse primer(SEQ ID NO:52)5′-CGCTCGAGCTCaTCTTCTTCTTCTTCTTC-3′. In Vitro Protein Interaction Assays Full-length bnKCP1 and truncated mutant bnKCP1 1 -160 and bnKCP1 1-80 proteins labeled with [ 35 S]methionine were produced using TNT-Quick Coupled Transcription/Translation System (Promega) according to the manufacture's instructions, with some modifications. A total of 1 μl of RNase inhibitor (GibcoL BRL) and 1 μl of protease inhibitors set (Roche) were added to the lysate reaction. After incubation for 90 min at 30° C., RNase A was added to the reaction to a final concentration of 0.2 mg/ml and incubated for 5 min at the same temperature. In vitro protein interaction was detected with GST pulldown affinity assays as described by Ahmad et al. (1999) with some modifications. Briefly, 6 μg of GST or 4 μg of GST-fusion protein was incubated with 5 μl of [ 35 S]Met-labeled translation mixture in 200 μl of bead-binding buffer (50 mM K-phosphate, pH 7.6, 450 mM KCl, 10 mM MgCl 2 , 10% glycerol, 1% Triton X-100, 1% BSA and 1 μl of diluted 1:12 protease inhibitors set) for 1 h at room temperature. After incubation, 20 μl of 50% slurry of glutathione-Sepharose beads containing 10 mg/ml of BSA and 4 μg of EtBr was mixed with the reaction mixture followed by gentle rotation for 1 h at 4° C. After washing six times with 1.2 ml of bead-binding buffer without BSA and EtBr but containing 12 μl of protease inhibitors set (Roche), the bound proteins were eluted with 30 μl of 2×SDS loading buffer, boiled for 2 min and analyzed by 12% SDS-PAGE. After electrophoresis, the gels were dried, treated with Amplify (Amersham Pharmacia) and subjected to fluorography. In Vivo Protein Assays The entire region of bnKCP1 and the two fragments, bnKCP1 1-160 and bnKCP1 1-80 , were PCR amplified and cloned into the SalI and NotI sites of pPC86 vector (GibcoL BRL) in-frame with the GAL4 AD sequences to generate constructs pPC86-bnKCP1, pPC86-bnKCP1 1-160 and pPC86-bnKCP1 1-80 . The oligonucleotide primers used in PCR amplification were as follows: bnKCP1, bnKCP1 1–160 and bnKCP1 1–80 forward primer(SEQ ID NO:53)5′- GCGTCGACGATGGCAGGAGGAGGACCAACT-3′bnKCP1 reverse primer(SEQ ID NO:54)5′- GCGCGGCCGCCTCATCTTCTTCTTCTTCCTC-3′bnKCP1 1–160 reverse primer(SEQ ID NO:55)5′- GCGCGGCCGCATGAACAGGCAAAAGAGGCAT-3′bnKCP1 1–80 reverse primer(SEQ ID NO: 56)5′- GCGCGGCCGCCTCCTCCTCATCATTGTCTTC-3′ For in vivo protein interaction assays, the MaV203 yeast cells carrying the reporter gene lacZ and the construct pDBLeu-HDA19, in which the HDA19 was fused in-frame with GAL4 DB, were transfected with either of the plasmids pPC86-bnKCP1, pPC86-bnKCP1 1-160 and pPC86-bnKCP1 1-80 or the vector alone. The expression of lacZ reporter gene was quantified by measuring the β-galactosidase activity using chlorophenol red-β-D-galactopyranoside (CPRG) according to the manufacturer's instructions (GibcoL BRL). Two yeast control strains A and B (GibcoL BRL) were used as negative and positive controls, respectively. Site-Directed Mutagenesis (SDM) The QuickChange site-directed mutagenesis kit (Stratagene) was used to replace the serine residue in the PK-A phosphorylation site (RRPS 188 ) within the KID domain with a glycine residue to generate bnKCP1G 188 according to the manufacturer's instructions. The two oligonucleotide primers used in SDM were as follows: forward primer:(SEQ ID NO:57)5′- GATGTTCTTGCGAGGAGACCAGGATTCAAGAACAGAGCATTGAAG-3′,reverse primer:(SEQ ID NO:58)5′- CTTCAATGCTCTGTTCTTGAATCCTGGTCTCCTCGCAAGAACATC-3′, The introduced mutation was confirmed by DNA sequencing, and the mutated bnKCP1G 188 was cloned into the HindIII and XhoI sites of pET-28b vector to generate pET-bnKCP1G 188 , which was then used for in vitro protein interaction assays as described above. Transactivation Assay Using Yeast One-Hybrid System Effector plasmids pDBLeu-bnKCP1 1-160 , pDBLeu-bnKCP1 1-80 , pDBLeu-bnKCP1 81-215 and pDBLeu-bnKCP1 were constructed by ligating the PCR-amplified fragments ΔbnKCP1 1-160 , ΔbnKCP1 1-80 , ΔbnKCP1 81-215 and the coding region of bnKCP1 into the SalI/NotI sites of pDBLeu vector (GibcoL BRL) in-frame with the GAL4 DB sequence. The oligonucleotide primers for PCR amplification were as follows: bnKCP1 forward primer(SEQ ID NO: 53)5′-GCGTCGACGATGGCAGGAGGAGGACCAACT-3′,,bnKCP1 reverse primer(SEQ ID NO: 54)5′-GCGCGGCCGCCTCATCTTCTTCTTCTTCCTC-3′,bnKCP1 1–160 forward primer(SEQ ID NO: 53)5′-GCGTCGACGATGGCAGGAGGAGGACCAACT-3′,,bnKCP1 1–160 reverse primer(SEQ ID NO:55)5′-GCGCGGCCGCATGAACAGGCAAAAGAGGCAT-3′,bnKCP1 1–80 forward primer(SEQ ID NO: 53)5′-GCGTCGACGATGGCAGGAGGAGGACCAACT-3′,,bnKCP1 1–80 reverse primer(SEQ ID NO:56)5′-GCGCGGCCGCCTCCTCCTCATCATTGTCTTC-3′,bnKCP1 81–215 forward primer(SEQ ID NO:59)5′-GCGTCGACGCTAGGGTTGGCTTCATTGAGA-3′,bnKCP1 81–215 reverse primer(SEQ ID NO: 54)5′-GCGCGGCCGCCTCATCTTCTTCTTCTTCCTC-3′, The three reporter genes, lacZ, HIS3 and URA3, which were chromosomally integrated in the genome of MaV203 yeast cells were driven by unrelated promoters containing GAL4 DNA binding sites (GibcoL BRL). For transient assays, the effector constructs or the negative control vector pDBLeu were transferred to the MaV203 yeast cells. The β-galactosidase activity was measured using CPRG (chlorophenol red-β-D-galactopyranoside) according to the manufacturer's instructions (GibcoL BRL). The MaV203 cells containing plasmids pDBLeu-HDA19 and pPC86-bnKCP1 were used as the positive control. In addition, we used three yeast control strains A, B, and C (GibcoL BRL), which were developed to contain plasmid pairs expressing fusion proteins with none, weak and moderately strong protein-protein interaction strength, respectively. Transient Expression of the GUS-bnCKP1 Fusion Protein The oligonucleotide primers for PCR amplification of the entire coding region of bnKCP1 were as follows: forward primer5′-GCGAATTCATGGCAGGAGGAGGACCAACT-3′,(SEQ ID NO:60)reverse primer5′-CGGAGCTCCTCaTCTTCTTCTTCTTCTTC-3′.(SEQ ID NO:61) The amplified sequence was cloned into the EcoRI and ScaI sites of the binary vector p79-637, a derivative of the vector CB301, to generate construct p77-132, which contains GUS-bnKCP1 fusion under control of the CaMV35S promoter. The onion epidermal layers were transformed with Agrobacterium culture prepared as described by Kapila et al (1997) with a few modifications. Briefly, the onion inner epidermal layers were peeled, placed into a culture of Agrobacterium tumefaciens strain GV3101 pMP90 containing either p79-637, for GUS expression only, or p77-132 and subjected to continuous vacuum of −85 kPA for 20 min. After incubation at 22° C. under 16 h light condition for 7 days the tissues were placed into GUS staining solution [100 mM potassium phosphate buffer (pH 7.4), 1 mM EDTA, 0.5 mM K 3 Fe(CN) 6 , 0.5 mM K 4 Fe(CN) 6 , 0.1% Triton X-100, 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-gluc)], vacuum infiltrated for 20 min at −85 kPa and incubated overnight at 37° C. To determine the intercellular location of nuclei, tissues were stained with the nucleus-specific 4′,6-diamidino-2-phenylindole (DAPI) solution (14 μg/ml DAPI, 0.1×PBS, 90% glycerol) (Varagona et al, 1991) and viewed under a ZEISS microscope using both fluorescence and bright-field optics. Cloning of the B. napus KCP Protein To identify proteins that interact with HDA19 in B. napus , the ORF of Arabidopsis HDA19 fused to the yeast Gal4 DNA binding domain was used as bait in a yeast two-hybrid screening of a B. napus cDNA library linked to the yeast Gal4 activation domain. Several positive clones were obtained on the basis of the induction of three yeast reporter genes, HIS3, URA3 and lacZ and DNA sequence analysis. One of these clones (963 bp), pPC86-bnKCP1, encodes a 23.5 kDa protein that contains a putative kinase-inducible domain (KID)-like motif, and hence was designated bnKCP1 ( B. napus KID-containing protein 1). Alignment of deduced amino acid sequences indicated that bnKCP1 shares an 82% amino acid identity with atKCP, an Arabidopsis unknown 26.6 kDa protein (AY088175, At5g24890). It also shares high similarity in the conserved region of approximately 55 amino acids (GKSKS domain) with other two other atKCP-like Arabidopsis unknown proteins, atKCL1 (CAB45910, At4g31510) and atKCL2 (AAD23890, At2g24550) ( FIG. 10A ). To estimate the bnKCP1 gene copy number in Brassica napus we carried out Southern blot analysis on of total genomic DNA digested with restriction endonucleases using the entire open reading frame of bnKCP1 for probing under high stringency conditions ( FIG. 12 ). Digestion with EcoRI (EI), HindIII (H), PstI (P), EcoRV (EV) and KpnI, none of which has a cutting site within bnKCP1, resulted in the detection of three bands, whereas digestion with XbaI generated six bands, because of the existence of an internal cutting site for XbaI in the bnKCP1 gene. This result indicates that bnKCP1 belongs to a small gene family of three members in the Brassica. napus genomes. Structural Features of the bnKCP1 Protein The ORF of bnKCP1 gene codes for a 215 amino acid polypeptide product of polypeptide with several functional motifs ( FIG. 11 ). Based on a search of protein localization sites using PSORT program (see URL: psort.nibb.ac.jp; Nakai and Kanehisa, 1992), bnKCP1 appears to be is a nuclear protein containing a pat7 nuclear localization signal (NLS) PLNKKRR (SEQ ID NO: 62; FIG. 10A , residues 127-133). Three acidic motifs (I, II and III) and a serine-rich (S-rich) region (residues 34-58) may function in transcription activation by bnKCP1 (Johnson et al., 1993). The charged motif GKSKS (residues 88-143), which is conserved in all four protein orthologs ( FIG. 10A ), is rich in basic residues and encompasses the NLS. This suggests that this domain serve the may function of a DNA-binding motif ( FIG. 11 ). In addition, bnKCP1 is extremely hydrophilic ( FIG. 11 ) suggesting bnKCP1 is an active element in the nuclear matrix. Amino acid sequence analysis also revealed that bnKCP1 has a KID-like motif (residues 161-215, FIG. 10A ) with alpha structure at its C-terminal region ( FIG. 11 ). The KID is highly conserved in mammalian CREB protein family and functions in transactivation and protein binding (Montminy et al., 1997). The KID in bnKCP1 has a high similarity to the CREB family member ATF-1 ( FIGS. 10B , C) and contains a protein kinase A (PK-A) phosphorylation site (RRPS) that is conserved in the CREB family of proteins ( FIG. 10B ). Interaction of bnKCP1 with HDA19 and Gcn5 To confirm the interaction detected in the yeast two-hybrid system between the bnKCP1 protein and HDA19, GST pulldown assays were performed using in vitro translated bnKCP1 labeled with [ 35 S]Methionine. The bnKCP1 protein was tested for its ability to interact with recombinant GST-HDA19 or GST-Gcn5 fusions expressed in E. coli. As shown in FIG. 13B , bnKCP1 bound to both GST-HDA19 and GST-Gcn5 fusion proteins, but not to GST alone. To reassess the interaction of bnKCP1 with Gcn5 in vivo, the ORF of the Arabidopsis Gcn5 was fused to the yeast Gal4 DNA binding domain in pDBLeu vector and then used to transform yeast MaV203 cells expressing bnKCP1 fused to the yeast Gal4 activation domain in pPC86 vector. The transformants showed induction of the three reporter genes, HIS3, URA3 and lacZ at a relatively lower level when compared with the induction levels in transformants with bnKCP1 and HDA19 (data not shown). This result suggests that bnKCP1 has a preference for binding to HDA19 in vivo. To map the protein binding domain of the bnKCP1 protein, two C-terminal truncated mutants of bnKCP1 lacking the KID domain were constructed. These are ΔbnKCP1 1-160 (residues 1-160) and ΔbnKCP1 1-80 (residues 1-80) as shown in FIG. 13A . These truncated mutants were assayed for in vitro interaction with the recombinant GST-HDA19 or GST-Gcn5 fusion proteins. The two mutant proteins, ΔbnKCP1 1-160 and ΔbnKCP1 1-160 , exhibited no interaction with either GST-HDA19 or GST-Gcn5 indicating that the KID domain of bnKCP1 protein is essential for binding to HDA19 and Gcn5. The importance of the KID domain for protein binding was also determined in vivo using the yeast two-hybrid system. MaV203 yeast cells were co-transformed with pDBLeu-HDA19, and either pPC86-bnKCP1, pPC86-bnKCP1 1-160 , pPC86-bnKCP1 1-80 or pPC86 alone ( FIG. 13C ). β-galactosidase activity was reduced by at least 50% when pDBLeu-expressing cells were transformed with plasmids expressing either ΔbnKCP1 1-160 or ΔbnKCP1 1-80 , both of which lacked KID, as compared to the full-length bnKCP1. This finding demonstrates that KID is critical for bnKCP1 interaction with HDA19 in vivo. To investigate the importance of S 188 for bnKCP1 interaction with HDA19, the S 188 residue in bnKCP1 was mutated to G 188 using site-directed mutagenesis to obtain bnKCPG 188 protein ( FIG. 14 ). This mutated protein was then tested for binding to HDA19 in vitro. When compared to bnKCP1, the mutated protein, bnKCPG 188 , has significantly reduced binding to HDA19 ( FIG. 14 ). This confirms that S 188 is essential for optimal interaction between bnKCP1 and HDA19. Expression Pattern of the bnKCP1 Gene The expression pattern of the bnKCP1 gene was analyzed by Northern blot analysis of total RNA extracted from various organs of B. napus . As shown in FIG. 15 , two transcripts of similar sizes appear to hybridize to bnKCP1, indicating the existence of two homologs of bnKCP1 mRNAs in B. napus . These transcripts accumulated at high levels in flowers, roots, stems and immature siliques, and at low levels in leaves with petioles, but were undetectable in leaf blades ( FIGS. 15 , 16 ). To investigate the pattern of bnKCP1 expression in response to environmental stress conditions, total RNA was isolated from leaf blades of four-leaf stage B napus seedlings that were exposed to low temperature (4° C.), drought, high salt (NaCl), and ABA treatment, and used for northern blot analysis using a bnKCP1 probe. Transcripts of both bnKCP1 homologs accumulated in leaves in response to cold treatment. The lower size (˜0.9 kb) transcript appears to be induced within 4 h of cold treatment and about 4 h earlier than the higher molecular weight (1.1 kb) one ( FIG. 16A ). The bnKCP1 transcript appears to accumulate in response to low temperature (4° C.), but expression was not detected in leaf blades of plants grown under drought condition for up to 4 days, high salt stress for up to 11 days, or upon exogenous application of ABA for up to 8 hours (data not shown). Expression of bnKCP1 in the stems, was repressed upon cold treatment ( FIG. 16A ), suggesting the response of bnKCP1 transcript to low temperature or the recruitment of HDA19 and HAT to the promoters of cold responsive genes is organ specific. Since cold acclimation is known to be associated with elevated levels of intracellular concentrations of Ca 2+ , tests to determine whether Ca +2 has any effect on bnKCP1 expression were performed. Northern blot analysis was performed using total RNA isolated from leaves of seedlings treated with Ca 2+ channel blocker LaCl 3 and the Ca 2+ ionophore inomycin at room temperature. Induction of bnKCP1 expression upon treatment with inomycin was rapid (2 hrs) but short-lived. The bnKCP1 transcript was undetectable in leaves of seedlings treated with the LaCl 3 ( FIG. 16B ). Transcription Activation by bnKCP1 To determine whether bnKCP1 functions as a transcription activator, transactivation experiments were carried out in yeast. A yeast strain carrying three reporter genes, lacZ, HIS3 and URA3, driven by promoters fused to GAL4 DNA binding sites and independently integrated into the yeast genome were transfected with the effector plasmid pDBLeu-bnKCP1 comprising bnKCP1 fused to the GAL4 DB under the control of ADH promoter. The effector stimulated β-galactosidase activity about 8-fold relative to either GAL4 DB alone or yeast control strain A that contains plasmid pairs expressing fusion proteins without protein-protein interaction. A similar result was obtained when the yeast cells were co-transformed with the positive control plasmids pDBLeu-HDA19 and pPC86-bnKCP1 identified by the two-hybrid selection ( FIG. 17A ). Reporter genes HIS3 and URA3 were also modestly activated by bnKCP1 (data not shown). Based on these findings, it can be concluded that bnKCP1 exerts transactivation of target genes in Brassica napus. These data demonstrate the isolation of a plant protein that contains a putative KID domain, which interacts with both GCN5 (HAT) and HDA19. bnKCP1 was highly expressed in all organs tested, except leaf blades, where it was induced in response to cold acclimation, which also resulted in repressing its expression in stems. Furthermore, bnKCP1 exerts transcription activation of a reporter gene when tested in yeast, indicating the function of bnKCP1 as a transcription factor. To map the transactivation domain of the bnKCPP1 protein, one N-terminal truncated mutant of bnKCP1, ΔbnKCP1 81-215 , and two C-terminal truncated mutants, ΔbnKCP1 1-160 and ΔbnKCP1 1-80 ( FIG. 17B ) were generated and used in in vivo transactivation assays in yeast. As shown in FIG. 17C , deletion of the KID or GKSKS domains had no significant influence on β-galactosidase activity, whereas deletion of the N-terminus resulted in approximately 65% reduction in β-galactosidase activity. Nuclear Localization of the bnKCP1 Protein Structural and functional analyses showed bnKCP1 to have features typical of transcription factors. To confirm that bnKCP1 is a nuclear proteins, onion epidermal cell layers were transformed with constructs for the expression of either a GUS-bnKCP1 fusion or GUS alone ( FIG. 18 ). Using an Agrobacterium -mediated transformation method (Kapila et al, 1997). As shown in FIG. 18 , GUS activity was visualized exclusively in the cytoplasm of control onion cell layers. In contrast, a blue precipitate was localized in the nuclei of cell layers transformed with GUS-bnKCP1 fusion construct, although there was still a certain amount of cytoplasm staining, indicating that at least some targeting to the nucleus occurs with the fusion protein. Expression of bnKCP1 is Organ-Specific The bnKCP1 gene appears to be part of a multigene family of three members based on Southern blot hybridization. Northern blot analyses showed that two members of this gene family are of similar transcript sizes and expression patterns. This is consistent with information about bnKCP1 orthologs in Arabidopsis , where there are one atKCP (At5g24890) and two atKCP-like members (At4g31510 and At2g24550) of similar sizes ranging from 1 kb to 1.2 kb. Northern blot analysis revealed that bnKCP1 mRNA was expressed in flowers, roots, stems and immature siliques ( FIG. 14 ). The transcript accumulation, however, was undetectable in leaf blades of B. napus seedlings, suggesting tissue/organ-specific expression of the bnKCP1 gene. However, cold treatment induced bnKCP1 expression in leaves, but repressed it in stems. The KID Domain is Conserved in bnKCP1 Structural analysis of the bnKCP1 protein revealed that it was a strongly hydrophilic protein (23.5 kDa, pI 4.2) and had characteristic features of a transcription factor, including a putative nuclear localization signal (NLS), a putative basic DNA binding domain, putative acidic activation domains and a protein-protein interaction domain. An important structural feature of bnKCP1 is the presence of a putative kinase-inducible domain (KID) with alpha secondary structure at the C-terminal region. The KID domain was first identified in mammalian CREB family members CREB, CREM and ATF-1. The KID domain in mammalian CREB is involved in at least two functions, interaction with CBP/p300 and the site for protein kinase A (PK-A) phosphorylation of S 133 (Montminy et al., 1997; Gonzalez et al., 1991; Quinn, 1993; Chrivia et al., 1993; Shaywitz et al., 2000). Similar to its counterpart in CREB, which is involved in protein binding, the KID domain of bnKCP1 is required for binding to both HDA19 and GCN5 in vitro and in vivo. The ability of bnKCP1 to interact with HDA19 indicates that bnKCP1-mediated transcription control requires direct or indirect recruitment of these transcription regulators to promoter regions of target genes regulated by bnKCP1. Phosphorylation of CREB at Ser 133 is required for the interaction of CREB via its KID with CBP and for CREB to activate transcription in response to some extracellular stimuli (Gonzalez et al, 1989; Chrivia et al., 1993). The KID domain in bnKCP1 also contains a putative PK-A phosphorylation site (RRPS 188 ), which corresponds to the RRPS 133 in mammalian CREB. Intracellular Level of Ca +2 Affect bnKCP1 Expression In mammalian cells, outside stimuli that increase intracellular concentrations of Ca 2+ or cAMP induce the expression of not only PK-A, but also the CREB gene (Meyer et al., 1993). Therefore, tests to determine whether conditions that increase intracellular concentrations of Ca 2+ would induce bnKCP1 expression were done. B. napus seedlings were subjected to one of two treatments, cold or inomycin. Cold acclimation is known to increase intracellular Ca 2+ concentrations (Monroy and Dhindsa, 1995; Knight et al., 1996), and inomycin is a known calcium ionophore that increases Ca 2+ influx (Hurley et al., 1996). These treatments resulted in the induction of bnKCP1 expression to varying degrees ( FIG. 16 ), which indicated that bnKCP1 is induced by high intracellular Ca +2 concentrations. These results suggest a molecular mechanism by which bnKCP1 functions as a transcription factor to regulate gene expression by recruiting HDAC to the promoter regions of target genes. Example 5 Characterization of the Recruitment Factor SCL1 and Its Interaction with the Chromatin Remodelling Factor HDA19 To search for transcription factors additional that recruit histone deacetylase (HDAC) to target promoters in Brassica napus , a yeast two-hybrid library was screened using the Arabidopsis thaliana HDA19 as bait. This screening resulted in the isolation of a cDNA clone that encodes a SCARECROW-like protein, BnSCL1, which contains a number of putative functional motifs typical of the GRAS family of transcription factors. Southern blot analysis indicated that the BnSCL1 gene belongs to a small gene family of about three members. In vitro and in vivo protein interaction assays revealed that BnSCL1 interacts physically with HDA19 through the VHIID domain. BnSCL1 also exerted strong transactivation of the lacZ reporter gene in yeast, and both N- and C-terminal regions are critical for the transient expression. Quantitative RT-PCR and RNA gel blot analysis showed that BnSCL1 was expressed at relatively high level in roots, moderate level in flowers, weak in mature leaves and stems, and barely detectable in immature siliques. The accumulation of BnSCL1 transcript was regulated by 2,4-D in shoots, roots and matured leaves. Furthermore, the response of BnSCL1 to 2,4-D was modulated by histone deacetylase HDA19. These results strongly suggest a molecular mechanism by which BnSCL1 functions as a transcription factor to regulate gene expression by recruiting HDAC to the promoter regions of auxin-responsive genes. Plant Materials Brassica napus L. cv. DH12075 was used for DNA and total RNA isolation. Leaves, flowers, stems, siliques and immature seeds were harvested from plants cultured in a controlled-environment greenhouse programmed for a photoperiod of 16 h day and 8 h night. Roots were obtained by culturing sterilized seeds in 0.8% agar plates containing ½ MS medium (Murashige and Skoog, 1962) and 1% sucrose. Tissue Treatment In exogenous applied auxin treatments, four-leaf stage seedlings grown at 20° C. were treated with a foliar spray containing 1 mM 2,4-D and 50 mM sodium phosphate, pH 7.5. The four leaves were collected at 30 min, 60 min and 180 min after the first foliar application of 2,4-D. For the measurement of response of shoots and roots to auxin, sterilized seeds were germinated on plates in a growth chamber with continuous light at 20° C., and 10 dpg seedlings were supplied with varied concentration of 2,4-D. In the auxin transport inhibition experiments, 9 dpg seedlings were incubated in the medium supplemented with 50 μM NPA dissolved in 0.1% DMSO for 24 h before the 2,4-D treatment. For the HDAC inhibitor treatments, 10 mM sodium butyrate was added onto the growth medium and incubated for 24 h followed by exogenous 2,4-D application at varied concentrations. Yeast Two-Hybrid Screening and Cloning A yeast two-hybrid cDNA library was constructed from seedlings of B. napus L. cv. DH12075 and screened using a Arabidopsis thaliana RPD3-type HDAC (HDA19) as bait, with the methods of ProQuest Two-Hybrid System (GibcoL-BRL) as previously described by Gao et al. (2003). The positive colonies were reassessed with retransformation experiments and confirmed with in vitro protein interaction assays, and the cloned cDNAs were identified by PCR and DNA sequence analysis. Gel Blot Analysis Total genomic DNA was extracted from the leaves of four-leaf stage B. napus using a modified CTAB (cetyltriethylammonium bromide) extraction method, and DNA gel blots were prepared and hybridized with the BnSCL1 open reading frame labeled with [α- 32 P]dCTP using random primer labeling procedure as described by Gao et al. (2003). Total RNA was isolated using hot phenol method with the first extraction for 30 sec at 80° C. as previously described (Gao et al. 2002). RNA was isolated from various tissues, including leaves and stems of four-leaf stage seedlings, flowers, immature seeds and siliques of adult plants, and roots of cultured seedlings. Quantitative RT-PCR Total RNA extracted as described above was treated with Amplification Grade Deoxyribonuclease I (GibcoL BRL) following the manufacture's instructions. The RNA samples were then directly used for reverse transcription prior to amplification without purification. The RT-PCR was quantitatively performed and completed in a one-step reaction using SUPERSCRIPT One-Step RT-PCR System (GibcoL BRL) as described by Gao et al. (2002). Gene-specific sense and anti-sense primers used to generate a 960 bp fragment of Brassica napus Actin, as an internal standard, were as described in Gao et al., (2002). Gene-specific primers for the generation of BnSCL1, BnIAA1 and BnIAA12 fragments were as follows: BnSCL1 (435 bp)sense:5′-GATGGACGAACATGCCATGCGTTCCA-3′(SEQ ID NO:84)anti-sense:5′-CGCTCGGATCTTCTGAACAAT-3′(SEQ ID NO:85)BnIAA1 (537 bp)sense:5′-CCACGCGTCCGGTACGATGAT-3′(SEQ ID NO:86)anti-sense:5′-GAAGTTGAGAAATGGTTTATGA-3′(SEQ ID NO:87)BnIAA12 (659 bp)sense:5′-ACGCTGGTGCTTCTCCTCCTC-3′(SEQ ID NO:88)anti-sense:5′-AAAACCCATTAGAAGAACCAAGAA-3′(SEQ ID NO:89) BnIAA1 and BnIAA12 are clones ML2798 and ML4744, which are homologs of Arabidopsis IAA1 and IAA12, respectively, and were identified in a database of Brassica napus ESTs that were generated at the Saskatoon Research Centre of Agriculture and Agri-Food Canada (www.brassica.ca). Expression and Purification of Recombinant HDA19 The open reading frame (ORF) of the HDA19 was PCR amplified, sequence analyzed, inserted in-frame with the GST (glutathione s-transferase) into the vector pGEX-6P-2 (Amersham Pharmacia), and transformed into E. coli BL21-CodonPlus (DE3)-RP competent cells (Stratagene) as previously described (Gao et al., 2003). The recombinant HDA19 protein was expressed and purified under non-denaturing conditions as described by Gao et al, 2002). The GST-HDA19 fusion protein was analyzed by western blotting with rabbit anti-GST-Pi polyclonal antibody (Chemicon) using ECL Western blotting analysis system (Amersham Pharmacia). In Vitro Protein Interaction Assays The entire coding region of BnSCL1 and four fragments, BnSCL1 1-358 , BnSCL1 1-261 , BnSCL1 1-217 , and BnSCL1 1-145 encoding amino acids 1-434, 1-358, 1-261 and 1-217, respectively, were amplified by PCR and cloned into the HindIII and XhoI sites of the expression vector pET-28b (Novagen) in-frame with the His-Tag sequence. The primers used for amplification were as follows: Forward primer for BnSCL1, BnSCL1 1–358 ,BnSCL1 1–261 , BnSCL1 1–217 and BnSCL1 1–145 :(SEQ ID NO:90)5′- GCAAGCTTATGGACGAACATGCCATGCGTTCCA-3′Reverse primer for BnSCL1:(SEQ ID NO:91)5′- CGCTCGAGAAAGCGCCACGCTGACGTGGC-3′Reverse primer for BnSCL1 1–358 :(SEQ ID NO:92)5′- CGCTCGAGCGCGGAGATCTTCGGAGGTAA-3′Reverse primer for BnSCL1 1–261 :(SEQ ID NO:93)5′- CGCTCGAGCCTAATCGCCTTGAAAGATAA-3′Reverse primer for BnSCL1 1–217 :(SEQ ID NO:94)5′- CGCTCGAGCGCCACAACCGCCGTGACTCT-3′Reverse primer for BnSCL1 1–145 :(SEQ ID NO:95)5′- CGCTCGAGCGCTGGGATCTTCTGAACAAT-3′. The TnT-Quick Coupled Transcription/Translation System (Promega) was used to produce the full-length BnSCL1 protein and the truncated mutants ΔBnSCL1 1-358 , ΔBnSCL1 1-261 , ΔBnSCL1 1-217 and ΔBnSCL1 1-145 labeled with [ 35 S]methionine as previously described (Gao et al., 2003). In vitro protein interaction was detected with GST pulldown affinity assays as described by Ahmad et al. (1999) and Gao et al., (2003). In Vivo Protein Interaction Assays The six DNA fragments, BnSCL1 1-358 , BnSCL1 1-261 , BnSCL1 1-217 , BnSCL1 1-145 , BnSCL1 146-358 and BnSCL1 218-435 and the ORF of BnSCL1 encoding amino acids acids 1-358, 1-261, 1-217, 1-415, 146-358, 218-434 and 1-434, respectively, were PCR amplified and cloned into the SalI and NotI sites of pPC86 vector (GibcoL BRL) in-frame with the GAL4 AD sequences to generate constructs pPC86-BnSCL1 1-358 , pPC86-BnSCL1 1-261 , pPC86-BnSCL1 1-217 , pPC86-BnSCL1 1-145 , pPC86-BnSCL1 146-358 , pPC86-BnSCL1 218-438 and pPC86-BnSCL1. PCR amplification was carried out using the following primers: Forward primer for BnSCL1, BnSCL1 1–358 ,BnSCL1 1–261 , BnSCL1 1–217 and BnSCL1 1–145 :(SEQ ID NO:96)5′- GCGTCGACGATGGACGAACATGCCATGCGTTCCA-3′Forward primer for BnSCL1 146–358 :(SEQ ID NO:97)5′- GCGTCGACGATTAAGGAGTTTTCCGGTATA-3′Forward primer for BnSCL1 218–434 :(SEQ ID NO:98)5′- GCGTCGACGGAGGATTGCGCCGTCGAGACG-3′Reverse primer for BnSCL1 and BnSCL1 218–434 :(SEQ ID NO:99)5′- GCGCGGCCGCAAAGCGCCACGCTGACGTGGC-3′Reverse primer for BnSCL1 1–358 :(SEQ ID NO:100)5′- GCGCGGCCGCCGCGGAGATCTTCGGACGTAA-3′Reverse primer for BnSCL1 1–261 :(SEQ ID NO:101)5′- GCGCGGCCGCCCTAATCGCCTTGAAAGATAA-3′Reverse primer for BnSCL1 1–217 :(SEQ ID NO:102)5′- GCGCGGCCGCCGCCACAACCGCCGTGACTCT-3′Reverse primer for BnSCL1 1–145 :(SEQ ID NO:103)5′- GCGCGGCCGCCGCTCGGATCTTCTGAACAAT-3′Reverse primer for BnSCL1 146–358 :(SEQ ID NO:100)5′- GCGCGGCCGCCGCGGAGATCTTCGGACGTAA-3′. For in vivo protein interaction assays, the MaV203 yeast competent cells carrying the lacZ reporter gene were co-transfected with the construct pDBLeu-HDA19, in which the HDA19 was fused in-frame with GAL4 DB and either of the plasmids pPC86-BnSCL1, pPC86-BnSCL1 1-358 , pPC86-BnSCL1 1-261 , pPC86-BnSCL1 1-217 , pPC86-BnSCL1 1-145 , pPC86-BnSCL1 146-358 , pPC86-BnSCL1 218-438 and or the vector pPC86 alone. The expression of lacZ reporter gene was quantified by measuring the β-galactosidase activity using CPRG (chlorophenol red-β-D-galactopyranoside) according to the manufacturer's instructions (GibcoL BRL). Three yeast control strains A, B, and C (GibcoL BRL) that contain plasmid pairs expressing fusion proteins with none, weak and moderately strong interaction strengths, respectively, were used as controls. Transactivation Assay MaV203 yeast cells expressing the lacZ reporter gene driven by a promoter containing GAL4 DNA binding sites (GibcoL BRL) were transformed with the pDBLeu-bnKCP1 1-160 , pDBLeu-bnKCP1 1-80 , pDBLeu-bnKCP1 81-215 and pDBLeu-bnKCP1. These vectors were constructed by ligating the PCR-amplified fragments, ΔBnSCL1 1-358 , ΔBnSCL1 1-261 , ΔBnSCL1 1-217 , ΔBnSCL1 1-145 , ΔBnSCL1 146-358 and ΔBnSCL1 218-434 and the entire coding region of BnSCL1, respectively, into the SalI and NotI sites of the vector pDBLeu (GibcoL BRL) in-frame with the GAL4 DB sequence. The oligonucleotide primers for the amplification were the same as those used for the in vivo protein interaction assays. The β-galactosidase activity was measured using CPRG according to the manufacturer's instructions (GibcoL BRL). In addition to the yeast strains A, B and C, the yeast strains D (GibcoL BRL) that contain plasmid pairs expressing fusion protein with strong interaction strength was used as controls. Cloning and Sequence Analysis of the BnSCL1 Gene HDAC or HAT is recruited to specific loci by large protein complexes made up of transcription activators/co-activators and repressors/co-repressors, respectively (See reviews Kuo and Allis, 1998; Meyer, 2001). Identification of these transcription regulatory proteins that interact with HDAC or HAT is a direct approach to defining nuclear factors that recruit these chromatin remodelling regulators to their target promoters and hence affect the expression of the target genes. To isolate proteins that bind to HDAC in B. napus , the ORF of Arabidopsis thaliana HDA19 fused to the yeast Gal4 DNA binding domain was used as bait in a yeast two-hybrid screening of a B. napus cDNA library linked to the yeast Gal4 activation domain. A number of positive clones were obtained on the basis of the induction of three yeast reporter genes HIS3, URA3 and lacZ followed by retransformation and sequencing analysis. One of these clones encodes a 51.2 kDa protein with pI 5.1, designated BnSCL1 ( Brassica napus SCARECROW-like protein 1; SEQ ID NO:81). As shown in FIG. 20 , BnSCL1 contains several domains of the SCARECROW (SCR) family of transcription factors (Laurenzio et al., 1996). Sequence analysis revealed that BnSCL1 cDNA (2781 bp) contains two open reading frames (ORFs). The first ORF (ORF1) encodes BnSCL1, a polypeptide of 461 amino acid residues starting at 82 bp from the 5′ end, and ORF2 codes for a polypeptide of 281 amino acids starting at 1687 bp from the 5′ end. The linking region of the two ORFs is a short sequence of 200 bp. Database search using NCBI blast program (Altschul et al., 1997) indicated that the deduced amino acid sequence encoded by ORF2 was similar to the human polyposis coli region hypothetical protein DP1 (accession number A39658), which contains a TB2_DP1_HVA22 domain. However, the GENESCAN program (Burge and Karlin, 1997) predicts that the 2781 bps of BnSCL1 cDNA encodes one polypeptide only, i.e. the deduced amino acid sequence of ORF1. Comparison of the deduced BnSCL1 amino acid sequence to the NCBI (see URL: www.ncbi.nlm.nih.gov) and TAIR (arabidopsis.org) databases results in a list of proteins with considerable similarity ( FIG. 21 ). According to the NTI computer program (InforMax, Inc.), BnSCL1 shares an 89% amino acid identity with AtSCL15 (Pysh et al., 1999) or VHS5 (Silverstone et al., 1998), an Arabidopsis SCARECROW-like protein (accession number Z99708, At4g36710), while it is 37% identical to AtSCR (accession number U62797). Interestingly, it also shares high similarity (66% sequence identity) with a tomato ( Lycopersicon esculentum ) protein (accession number AF273333), a member of the GRAS/VHIID protein family, encoded by the Lateral suppressor gene (Ls) (Schumacher et al., 1999) ( FIG. 20 ). Consistent with these data, phylogenetic analysis using either NTI Vector or DNA Star program classified BnSCL1, AtSCL15 and LsSCL (Ls) in the same subgroup ( FIG. 21 ). The BnSCL1 copy number in B. napus was estimated using DNA gel blot analysis on total genomic DNA digested with restriction endonucleases and hybridized with the ORF of BnSCL1 under high stringency conditions ( FIG. 22 ). Digestion with EcoRI, XbaI, HindIII, PstI and KpnI resulted in the detection of about three bands, whereas digestion with EcoRV generated approximately six bands due to the existence of an internal cutting site for EcoRV within the BnSCL1 gene. This result indicates that BnSCL1 belongs to a small gene family of approximately three members in the B. napus genomes. BnSCL1 is a Member of GRAS/VHIID Family The BnSCL1 gene encodes a polypeptide of 461 amino acids with several suggestive functional domains or motifs ( FIG. 20 ). It has two MAT α2-like nuclear localization signals (NLSs) (residues 169-173 and 436-440) (Raikhel, 1992). It also has a LXXLL motif ( 148 LGSLL 152 (SEQ ID NO:104)) that was shown to mediate interaction of transcription coactivators with nuclear receptors (Heery et al., 1997). Amino acid sequence analysis also revealed that BnSCL1 has the characteristic structure for GRAS/VHIID regulatory proteins (Pysh et al., 1999), including a VHIID motif that encompasses a putative NLS, two leucine heptad repeats (LHRs) that surround the conserved VHIID motif, a PFYRE motif and a C-terminal SAW motif that encompasses a putative NLS ( FIG. 20 ). The LHRI-VHIID-LHRII region has been thought to function in protein-protein and DNA-protein interactions (Pysh et al., 1999). BnSCL1 Interacts Physically with HDA19 In Vitro and In Vivo To confirm the interaction of BnSCL1 protein with HDA19 that was detected in the yeast two-hybrid system, GST pulldown affinity assays were carried out using in vitro-translated BnSCL1 labeled with [ 35 S]Methionine. The BnSCL1 protein was tested for its binding ability to GST-HDA19 fusion protein that was expressed in Escherichia coli and purified under non-denaturing conditions. As shown in FIG. 23 , BnSCL1 bound to recombinant HDA19 protein, while it did not bind to GST alone (data not shown). To map the protein binding domain of the BnSCL1 protein, four C-terminal truncated mutants of BnSCL1 lacking either of the SWA, PFYRE, LHRII or VHIID motif ( FIG. 23 a ) were constructed. These truncated mutants were assayed for in vitro interaction with the recombinant HDA19 protein. As shown in FIG. 23 b , the mutant proteins exhibited interaction with GST-HDA19 fusion protein with the truncation from C-terminal end until the VHIID region was deleted, indicating that the VHIID domain is essential for BnSCL1 protein binding to HDA19. The requirement of the VHIID domain for protein-protein interaction was also demonstrated in vivo using the yeast two-hybrid system ( FIG. 24 ). MaV203 yeast cells were co-transformed with plasmid pDBLeu-HDA19 and either pPC86-BnSCL1, pPC86-BnSCL1 1-358 , pPC86-BnSCL1 1-261 , pPC86-BnSCL1 1-217 , pPC86-BnSCL1 1-145 , pPC86-BnSCL1 146-358 , pPC86-BnSCL1 218-438 and or the vector pPC86 alone. Although β-galactosidase activity was reduced by at least 50% when pDBLeu-expressing cells were transformed with plasmids expressing either of the six mutants of BnSCL1 protein, as compared to the wild type BnSCL1, the transformants with plasmids expressing either pPC86-BnSCL1 1-145 or pPC86-BnSCL1 218-438 , both of which lacked VHIID motif, showed a further at least 50% reduction in β-galactosidase activity as compared to the other mutants. This finding indicates that VHIID domain is critical for BnSCL1 interaction with HDA19 in vivo. BnSCL1 Activates Transcription of a Reporter Gene in Yeast To further characterize the biological function of BnSCL1, its functions as a transcription activator was investigated. Transactivation experiments were performed in yeast ( FIG. 25 ), whereby a yeast strain carrying three reporter genes, lacZ, HIS3 and URA3, driven by promoters fused to GAL4 DNA binding sites and independently integrated into the yeast genome were transfected with the effector plasmid pDBLeu-BnSCL1 comprising BnSCL1 fused to the GAL4 DB under the control of the ADH promoter. Transformation with the effector plasmid resulted in increasing β-galactosidase activity similar with yeast strain D that contains plasmid pairs expressing fusion proteins with strong protein-protein interaction and approximately 20-fold relative to either vector pDBLeu alone or yeast control strain A, which contains plasmid pairs expressing fusion proteins without protein-protein interaction ( FIG. 25 ). Reporter genes HIS3 and URA3 were also strongly transactivated by BnSCL1 protein (data not shown). These results indicate that BnSCL1 significantly exhibits transcription activator activity in yeast. To map the transactivation domain of the BnSCL1 activator, a series of deletion mutants of BnSCL1 protein were generated ( FIG. 25 a ) and used in in vivo transactivation assays in yeast. As shown in FIG. 6 b , either of the deletions from C-terminal of BnSCL1 or any truncation from the N-treminal resulted in a decrease of at least 85% in β-galactosidase activity relative to the wild type BnSCL1 protein. This demonstrates that the transactivation domain of bnKCP1 may reside in both the N- and C-terminal regions. BnSCL1 Gene is Expressed Mainly in Roots The expression pattern of the BnSCL1 gene was analyzed by RNA gel blot analysis and quantitative RT-PCR using total RNA extracted from various organs of B. napus ( FIG. 26 ). As shown in FIG. 26 a , there were two bnSCL1 transcripts of 1.6 kb and 2.8 kb in the RNA blot probed with the ORF of BnSCL1, suggesting the existence of either two species of BnSCL1 cDNA produced by alternative splicing in B. napus genome or a BnSCL1 homologue cross-hybridizing to the probe. Both of them accumulated at highest levels in roots, whereas its expression was weak in flowers and stems, and undetectable in leaves and siliques. Results obtained using quantitative RT-PCR analysis ( FIG. 26 b ) were consistent with those obtained with northern blotting. In addition, RT-PCR analysis revealed strong expression in seedling shoots ( FIG. 26 b ). This expression pattern is similar to that of Arabidopsis SCR gene (Laurenzio et al., 1996) and to those of most SCLs (Pysh et al., 1999). This suggests that BnSCL1 and SCR may share similar functions in the regulation of root development. BnSCL1 Responds to Auxin Treatment The plant hormone auxin plays an important role in cell division, cell elongation, cell differentiation, lateral root initiation and gravitropism (Davies, 1995; Berleth and Sachs, 2001; Liscum and Stowe-Evans, 2000). Recent studies have demonstrated that auxin distribution organizes the pattern and polarity in the root meristem (Sabatini et al., 1999). To determine whether the dominant role of SCARECROW-like proteins (SCLs) in root biology is associated with auxin, quantitative RT-PCR was used to examine the expression of BnSCL1 gene in four-leaf stage- and 10 dpg-seedlings treated with the synthetic auxin 2,4-D. As shown in FIG. 27 , BnSCL1 mRNA accumulation increased by approximately 50% within 30 min of application of 1 mM 2,4-D, and then decreased rapidly to a lower level, when compared to untreated plants ( FIG. 27 ). Auxin levels are known to modulate the degradation rate of Aux/IAA (auxin/indole-3-acetic acid protein) family members through a proteolytic regulation mechanism (Zenser et al., 2001). To examine whether auxin levels also influences the expression pattern of BnSCL1 gene, quantitative RT-PCR was used to analyse total RNA isolated from shoots and roots of 10 dpg seedlings treated with variable concentrations of 2,4-D ranging from 1 pM to 1 mM ( FIG. 28 ). Expression of BnSCL1 in shoots was rapidly downregulated by auxin even at the lowest level (1 pM) of 2,4-D, indicating that BnSCL1 response to auxin is very sensitive ( FIG. 28 a ). BnSCL1 expression in roots, however, was upregulated by auxin although application of a higher concentration (100 μM) of auxin was required to produce an effect ( FIG. 28 b ). To determine whether response of BnSCL1 gene to auxin was due to the exogenous application rather than the intercellular auxin synthesis, seedlings were treated for 24 h with 50 μM of naphthylphthalamic acid (NPA), a polar auxin transport inhibitor, and the expression of BnSCL1 in response to auxin was analysed using quantitative One-Step RT-PCR. As can be seen in FIG. 28 c , the BnSCL1 mRNA accumulation profiles were not changed both in shoots and in roots after NPA treatment followed by the application of auxin at different concentrations. These results suggest that the response of BnSCL1 to the application of exogenous auxin was tissue-specific, or the expression of BnSCL1 may be regulated by auxin distribution in plants. Expression of SCR in apical meristems was found to be controlled by chromatin assembly factor-1 (CAF-1) (Kaya et al., 2001), and auxin gene expression mutations to be located within an Arabidopsis RPD3-like histone deacetylase gene, HDA6, using map-based cloning approach (Murfett et al., 2001). However, no alterations in gene expression of endogenous auxin response genes were detected in the mutants and no effect of auxin-inducible GUS expression was found after seedlings were treated with HADC inhibitor sodium butyrate at concentration up to 1 mM for 24 h (Murfett et al., 2001). To determine whether BnSCL1 response to auxin is modulated by HDA19, 9 dpg seedlings were treated with 2,4-D at concentrations ranging from 10 −6 to 10 3 μM or treated with 50 mM of sodium phosphate buffer as control after sodium butyrate treatment for 24 h at a concentration of 10 mM. Relative expression was investigated using quantitative One-Step RT-PCR to analyze RNA extracted from shoots and roots of seedlings. As shown in FIG. 28 , although the expression pattern of BnSCL1 in response to auxin in shoots was different from that in roots, the inhibition of histone deacetylase led to the expression profiles of BnSCL1 in shoots were similar to those in roots, i.e. the expression was upregulated by auxin at concentration of 1 pM and downregulated by auxin at higher concentrations. The fact that HDAC inhibition led to the alteration of BnSCL1 expression in response to auxin suggests that the response of BnSCL1 to auxin is modulated by histone deacetylase. These results suggest a molecular mechanism by which BnSCL1 functions as a transcription factor to regulate gene expression by recruiting HDAC to the promoter regions of target genes. Example 6 Modulation of Activity of a Gene of Interest Using a Recruitment Factor Two constructs are prepared: 1) an activator+reporter construct ( FIG. 29B ) carrying the lacZ reporter gene downstream from a Tet operator sequence (Tet-7X), and the BnSCL1 and VP16 genes encoding a VP16-SCL fusion protein that is able to bind the Tet operator sequence; and 2) an effector construct carrying the HDA19 gene ( FIG. 29B ). The activator+report construct is introduced and expressed in yeast cells, for example MaV203 cells as described in Example 4, to produce a reporter yeast. Activity of lacZ product is quantified by measuring the β-galactosidase activity using chlorophenol red-β-D-galactopyranoside (CPRG) (GibcoL BRL). In the reporter yeast, expression of the activator+reporter construct results in the expression of the VP16-SCL fusion protein that binds to the Tet operator sequence, thereby activating expression of the LacZ reporter gene due to VP16. The reporter yeast expressing the activator+reporter construct is treated with tetracycline. Expression of lacZ reporter gene is quantified by measuring the β-galactosidase activity using chlorophenol red-β-D-galactopyranoside (CPRG). The expression of the activator+reporter construct in the presence of tetracycline in yeast cells produces a baseline level of LacZ activity. The effector construct is then introduced into the reporter yeast so that the activator+reporter and the effector constructs are both expressed, and the activity of the LacZ product determined as indicated above. Results demonstrate that LacZ activity is reduced in the yeast expressing both the activator+reporter and the effector constructs, when compared to LacZ activity determined in the reporter yeast expressing only the activator+reporter construct, and approximates the level of activity of LacZ activity produced by the reporter yeast when treated with tetracycline. This result indicate that the expression of a gene of interest (in this case LacZ) may be reduced by targeting a recruitment factor, for example SCL1, to the nucleotide sequence encoding the gene of interest, and permitting the recruitment factor to bind an HDAC. A similar set of assays is carried out comprising three constructs: 1) a reporter construct carrying the lacZ reporter gene, 2) an activator construct carrying the BnSCL1 and VP16 genes, and 3) an effector construct carrying the HDA19 gene (see FIG. 29A ). The constructs are expressed in yeast cells, for example MaV203 cells as described above in Example 4, in the following combinations: reporter construct alone,reporter and activator constructs,reporter, activator and effector constructs. The expression of lacZ reporter gene is quantified by measuring the β-galactosidase activity using chlorophenol red-β-D-galactopyranoside (CPRG) (GibcoL BRL). The expression of the reporter construct alone in yeast cells produces a baseline level of β-galactosidase activity. Expression of both the reporter and activator constructs yields an elevated level of β-galactosidase activity, when compared with the activity observed in the presence of the reporter construct alone, while the reporter, activator and effector constructs together results in approximately background levels of β-galactosidase activity. Example 7 Transient Expression Assay in a Plant To determine whether BnSCL1 can recruit histone deacetylase HDA19 to target promoters in plants to repress the expression of associated genes, transient expression assays were carried out using tobacco leaves. As hereinbefore described in detail in Example 5, BnSCL1 is a SCARECROW-like protein which contains a number of putative functional motifs typical of the GRAS family of transcription factors. The constructs used in the transient expression assays are shown diagrammatically in FIG. 30 . Effector plasmid GAL4-BnSCL1 contained BnSCL1 coding region fused in-frame to GAL4BD coding region and driven by CaMV 35S promoter. GAL4BD is the DNA binding domain of the yeast transcription factor GAL4. Control effector plasmid GAL4 contained the GAL4BD coding region alone driven by CaMV 35S promoter. Reporter plasmid UAS GAL4 -tCUP-GUS contained GUS coding region under the control of strong constitutive tCUP promoter fused to two copies of GAL4 binding elements (UAS GAL4 ) (Wu et al. 2000). The reporter and effector plasmids were co-bombarded into tobacco leaves and transient GUS gene expression was analysed. Contructs The reporter plasmid UAS GAL4 -tCUP-GUS was made by replacing the CaMV 35S promoter of pBI221 with a truncated tCUP promoter and ligating two upstream activating sequences of the yeast GAL4 protein (UAS GAL4 ) upstream of the −394tCUP promoter, which controls the GUS gene expression (Wu et al. 2000, Plant Mol. Biol. 44:167). To construct the effector plasmids, fragments encoding GAL4BD and the ORF of BnSCL1 were amplified separately. GAL4BD was amplified by PCR using: forward primer (GAL4F)(SEQ ID NO: 105)5′-GC GGATCC ATGAAGCTACTGTCTTCTATCGAACAAG-3′and reverse primer(SEQ ID NO: 106)5′- ACCTCCACCTCCACC CCTCGACGATACAGTCAACTGTC-3′ with termini encoding five glycine residues (underlined). The ORF of BnSCL1 was amplified using forward primer (SEQ ID NO: 107)5′- GGTGGAGGTGGAGGT ATGAAACTCCAAGCTTCATCTCCTCAAG-3′and reverse primer (SCL1R)(SEQ ID NO: 108)5′-GC GAGCTC GACCTTACGCTTCTTTTTTGG AAAGCGCCACGCTGACG-3′, with termini encoding either five glycine residues or a nuclear localization signal (bolded), respectively. The in-frame fusion of GAL4BD and BnSCL1 was then assembled by PCR amplification using GAL4F and SCL1R primers and a mixture of GAL4BD and BnSCL1 PCR products as template. The GAL4BD-BnSCL1 fragment was then cloned between the BamHI and SacI sites of the plant transformation vector p79-103, a derivative of vector CB301 (Schäfer, unpublished) Transient Assay Tobacco plants were germinated and maintained in vitro in Magenta boxes containing 0.5 strength MS medium, 1% sucrose and 0.8% agar, and kept at 25° C. in a growth chamber programmed for a photoperiod of 16 h light and 8 h dark. After germination for three weeks, uniform-sized leaves were used for particle gun delivery assays with a particle inflow gun as described by Wu et al. (2000). The reporter plasmid was co-bombarded into the tobacco leaves with either: (i) effector plasmid GAL4-BnSCL1; or(ii) effector plasmid GAL4; or(iii) a control plasmid pUC19 (control). GUS gene expression was determined by fluorometric assay and the GUS activity was reported as pmol 4-methylumbelliferone per mg protein per minute, and expressed as % of GUS activity in the control ( FIG. 31 ). Results FIG. 31 shows a graph of the relative GUS activity (% of control) for each of the effector plasmids and the control, with bars indicating standard deviations. The graph of FIG. 31 indicates that GUS gene expression decreased by approximately 50% in the presence of the GAL4-BnSCL1 effector plasmid compared with the GAL4 effector plasmid or the expression of the reporter plasmid alone (control). This result suggests BnSCL is able to recruit the tobacco ortholog of the transcription repressor HDA19 to the UAS GAL4 -tCUP promoter to repress the expression the GUS reporter gene. Without wishing to be bound by theory, the transcription and translation of GAL4-BnSCL1 plasmid produces GAL4BD-BnSCL1 fusion protein which is capable of binding to UAS GAL4 in the reporter plasmid and to HDA19. Duel bonding of HDA19 to GAL4BD-BnSCL1 fusion protein and of GAL4BD-BnSCL1 fusion protein to UAS GAL4 facilitates enzymatic deacetylation of histones (via HDA19) in proximity of the GUS gene thereby causing repression of expression of the GUS reporter gene. All citations are herein incorporated by reference. The present invention has been described with regard to preferred embodiments. However, it will be obvious to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as described herein. REFERENCES Ahmad, A., Takami, Y. and Nakayama, T. (1999) WD repeats of the p48 subunit of chicken chromatin assembly factor-1 required for in vitro interaction with chicken histone deacetylase-2. J Biol. Chem. 274, 16646-16653.An, Y. Q., McDowell, J. M., Huang S., McKinney, E. C., Chambliss S. and Meagher, R. B. (1996) Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J., 10: 107-121Aoyama, T. and Chua, N. H., 1997, Plant J. 2, 397-404Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.Archdeacon, J., Bouhouche, N., O'Connell, F., Kado, C. I. (2000) A single amino acid substitution beyond the C2H2-zinc finger in Ros derepresses virulence and T-DNA genes in Agrobacterium tumefaciens . FEMS Microbiol Let. 187, 175-178Bannister, A. J. and Kouzarides, T. (1996) The CBP co-activator is a histone acetyltransferase. Nature, 384, 641-643Beetham, P. R., Kipp, P. B., Sawycky, X. L., Amtzen, C. J., May, G. D. (1999) A tool for functional plant genomics: chimeric RNA/DNA oligonucleotides cause in vivo gene-specific mutations. Proc. Natl. Acad. Sci. USA, 96: 8774-8778Berleth T, Sachs T. (2001) Plant morphogenesis: long-distance coordination and local patterning. Curr Opin Plant Biol, 4:57-62.Bittinger, M. A., Milner, J. L., Saville, B. J., Handelsman, J. (1997) rosR, a determinant of nodulation competitiveness in Rhizobium etli . Mol. Plant Microbe Interact. 10: 180-186Boyle, B. and Brisson, N. (2001) Repression of the defense gene PR-10a by the single-stranded DNA binding protein SEBF. Plant Cell 13, 2525-2537.Brandstatter, I. and Kieber, J. J. (1998) Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis . Plant Cell 10, 1009-1019Brightwell, G., Hussain, H., Tiburtius, A., Yeoman, K. H., Johnston, A. W. (1995) Pleiotropic effects of regulatory ros mutants of Agrobacterium radiobacter and their interaction with Fe and glucose. Mol. Plant Microbe Interact. 8: 747-754Burge, C. and Karlin, S. (1997) Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268, 78-94.Caddick, M. X., Greenland, A. J., Jepson, I., Krause, K. P., Qu, N., Riddell, K. V., Salter, M. G., Schuch, W., Sonnewald, U., Tomsett, A. B. (1998) An ethanol inducible gene switch for plants used to manipulate carbon metabolism. Nature Biotech. 16, 177-180Carrington, J. C., Freed, D. D., Leinicke, A. J. (1991) Bipartite signal sequence mediates nuclear translocation of the plant potyviral NIa protein. Plant Cell, 3: 953-962Chou, A. Y., Archdeacon, J., Kado, C. I. (1998) Agrobacterium transcriptional regulator Ros is a prokaryotic zinc finger protein that regulates the plant oncogene ipt. Proc. Natl. Acad. Sci., 95: 5293Chrivia, J. C., Kwok, R. P., Lamb, N., Hagiwara, M., Montminy, M. R. and Goodman, R. H. (1993) Photophorylated CREB binds specifically to the nuclear protein CBP. Nature 365, 855-859.Clough, S. J. and Bent, A. F. (1998) Floral dip: a simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana . Plant J. 16, 735-743Cooley, M. B., D'Souza, M. R., Kado, C. I. (1991) The virC and virD operons of the Agrobacterium Ti plasmid are regulated by the ros chromosomal gene: analysis of the cloned ros gene. J. Bacteriol. 173: 2608-2616Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646Davies, P. J. (1995) Plant Hormones (Dordrecht, The Netherlands: Kluwer Academic Publishers).D'Souza-Ault, M. R., Cooley, M. B. and Kado, C. I. (1993) Analysis of the Ros repressor of Agrobacterium virC and virD operons: molecular intercommunication between plasmid and chromosomal genes. J Bacteriol 175: 3486-3490Eisner et al., 1998, Ther. Appl. Genet., 97: 801Emiliani S., Fischle, W., Van Lint, C., Al-Abed, Y., Verdin, E. (1998) Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci USA. 95, 2795-800.Fischle, W., Emiliani, S., Hendzel, M. J., Nagase, T., Nomura, N., Voelter, W., Verdin, E. (1999) A new family of human histone deacetylases related to Saccharomyces cerevisiae HDA1p. J Biol. Chem. 274, 11713-20.Fukaki, H., Wysocka-Diller, J., Kato, T., Fujisawa, H., Benfey, P. N. and Tasaka, M. (1998) Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis thaliana. Plant J, 14: 425-430.Gao, M.-J., Allard, G., Byass, L., Flanagan, A. M. and Singh, J. (2002) Regulation and characterization of four CBF transcription factors from Brassica napus. Plant Mol. Biol. 49: 459-471.Gao, M.-J. Schäfer, U. A., Parkin, I. A. P., Hegedus, D. D., Lydiate, D. J. and Hannoufa, A. (2003) A novel protein from Brassica napus has a putative KID-domain and responds to low temperature. Plant J. 33: 1073-1086.Gao, M.-J., Dvorak, J. and Travis, R. L. (2001) Expression of the extrinsic 23-kDa protein photosystem II in response to salt stress is associated with the K + /Na + discrimination locus Kna1 in wheat. Plant Cell Rep. 20, 774-778.Gatz, C., 1997) Ann. Rev. Plant Physiol. Plant Mol. Biol. 48, 89-108Gatz, C. and Lenk, I. R. P., 1998, Trends Plant Sci. 3, 352-358Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988)Gelmetti, V., Zhang, J., Fanelli, M., Minucci, S., Pelicci, P. G., Lazar, M. A. (1998) Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO. Mol Cell Biol. 18, 7185-91.Gonzalez, G. A., Menzel, P. Leonard, J., Fischer, W. H. and Montminy, M. R. (1991) Characterization of motifs which are critical for activity of the cyclic AMP-responsive transcription factor CREB. Mol. Cell Biol. 11, 1306-1312.Gonzalez, G. A. and Montminy, M. R. (1989) Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59, 675-680.Grunstein, M. (1997) Histone acetylation in chromatin structure and transcription. Nature, 389,349-352.Hart, C. M., Nagy, F., Meins, F. Jr. (1993) A 61 bp enhancer element of the tobacco beta-1,3-glucanase B gene interacts with one or more regulated nuclear proteins. Plant Molec. Bio 21:121-131Hassig, C. A. and Schreiber, S. L. (1997) Nuclear histone acetylases and deacetylases and transcriptional regulation: HATs off to HDACs. Curr Opin Chem Biol. 1, 300-8.ORHassig, C. A., Fleischer, T. C., Billin, A. N., Schreiber, S. L., Ayer, D. E. (1997) Histone deacetylase activity is required for full transcriptional repression by mSin3A. Cell 89, 341-7.Hassig, C. A., Tong, J. K., Fleischer, T. C., Owa, T., Grable, P. G., Ayer, D. E., Schreiber, S. L. (1998) A role for histone deacetylase activity in HDAC1-mediated transcriptional repression. Proc Natl Acad Sci USA. 95, 3519-24.Helariutta, Y., Fukaki, H., Wysocka-Diller. J., Nakajima, K., Jung, J., Sena, G., Hauser, M.-T. and Benfey, P. N. (2000) The SHORT-ROOT gene controls radial patterning of the Arabidopsis root through radial signaling. Cell, 101: 555-567.Holtorf, S., Apel, K. and Bohlmann, H. (1995) Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana . Plant Mol. Biol. 29: 637-646Hurley, T. W., Ryan, M. P. and Moore, W. C. (1996) Regulation of changes in cytosolic Ca 2+ and Na + concentrations in rat submandibular gland acini exposed to carbachol and ATP. J. Cell Physiol., 168: 229-238Jofuku, K. D., den Boer, B. G., Van Montagu, M., Okamuro, J. K. (1994) Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell. 6, 1211-25.Johnson, C. and Turner, B. M. (1998) Histone deacetylases: complex transducers of nuclear signals. Cell Dev. Biol. 10, 179-188.Johnson, P. F., Stemeck, E. and Williams, S. C. (1993) Activation domains of transcriptional regulatory proteins. J. Nutr. Biochem. 4, 386-398.Kadosh, D. and Struhl, K. (1997) Repression by Ume6 involves recruitment of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to target promoters. Cell 89, 365-71.Kakimoto, T. (1996) CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science 274, 982-985Kapila, J., Rycke, R. D., Montagu, M. V. and Angenon, G. (1997) An Agrobacterium -mediated transient gene expression system for intact leaves. Plant. Sci. 122, 101-108.Kaya, H., Shibahara, K., Taoka, K., Iwabuchi, M., Stillman, B. and Araki, T. (2001) FASCIATA genes for chromatin assembly factor-1 in Arabidopsis maintain the cellular organization of apical meristem. Cell, 104: 131-142.Keller, M., Roxlau, A., Weng, W. M., Schmidt, M., Quandt, J., Niehaus, K., Jording, D., Arnold, W., Puhler, A. (1995) Molecular analysis of the Rhizobium meliloti mucR gene regulating the biosynthesis of the exopolysaccharides succinoglycan and galactoglucan. Mol. Plant Microbe Interact. 8: 267-277Khochbin, S. and Wolffe, A. P. (1997) The origin and utility of histone deacetylases. FEBS Lett. 419, 157-60.Knight, H., Trewavas, A. J., Knight, M. R. (1996) Cold calcium signaling in Arabidopsis involves two cellular pools and a change in calcium signature after acclimation. Plant Cell, 8, 489-503.Kohno-Murase, J., Murase, M., Ichikawa, H., Imamura, J. (1994) Effects of an antisense napin gene on seed storage compounds in transgenic Brassica napus seeds. Plant Mol. Biol., 26: 1115-24Kolle, D., Sarg, B., Lindner, H., Loidl, P. (1998) Substrate and sequential site specificity of cytoplasmic histone acetyltransferases of maize and rat liver. FEBS Lett. 421: 109-114Kuo, M. H. and Allis, C. D. (1998) Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays, 20, 615-626.Laurenzio, L. D., Wysocka-Diller, J., Malamy, J. E., Pysh, L., Helariutta, Y., Freshour, G., Hahn, M. G., Feldmann, K. A. and Benfey, P. N. (1996) The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell, 86: 423-433.Liscum E, Stowe-Evans E L. (2000) Phototropism: a “simple” physiological response modulated by multiple interacting photosensory-response pathways. Photochem Photobiol, 72:273-282.Lotan, T., Ohto, M., Yee, K. M., West, M. A., Lo, R., Kwong, R. W., Yamagishi, K., Fischer, R. L., Goldberg, R. B., Harada, J. J. (1998) Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells. Cell 93, 1195-1205Lusser, A., Kolle, D., Loidl, P. (2001) Histone acetylation: lessons from the plant kingdom. Trends in Plant Sci. 6:59-65Mandel, T., Fleming, A. J., Krahenbuhl, R., Kuhlemeier, C. (1995) Definition of constitutive gene expression in plants: the translation initiation factor 4A gene as a model. Plant Mol. Biol. 29: 995-1004Meyer, T. E., Waeber, G., Lin, J., Beckmann, W. and Habener, J. F. (1993) The promoter of the gene encoding-3′,5′-cyclic adenosine monophosphate (camp) response element binding protein contains camp response elements: evidence for positive autoregulation of gene transcription. Endocrinology, 132, 770-780Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. D T. Dennis, D H Turpin, D D Lefebrve, D B Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997)Monroy and Dhindsa (1995) Annu. Rev. Biochem. 66, 807-822Montminy, M. R. (1997) Transcriptional regulation by cyclic AMP. Annu. Rev. Biochem. 66, 807-822Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant. 15: 473-495.Murashige and Skoog, 1962Murfett, J., Wang, X. J., Hagen, G. and Guilfoyle, T. J. (2001) Identification of Arabidopsis histone deacetylase HDA6 mutants that affect transgene expression. Plant Cell, 13: 1047-1061.Murray, E. E., Lotzer, J., Eberle, M. (1989) Codon usage in plant genes. Nuc Acids Res. 17:477-498.Nagy et al., 1997;Nakai, K. and Kanehisa, M. (1992) A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 14, 897-911.Nakajima K, Sena G, Nawy T, Benfey P N. (2001) Intercellular movement of the putative transcription factor SHR in root patterning. Nature, 20: 413:307-11.Odell, J. T., Nagy, F., Chua, N. H. (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313, 810-812Ogas, J., Cheng, J. C., Sung, Z. R., Somerville, C. (1997) Cellular differentiation regulated by gibberellin in the Arabidopsis thaliana pickle mutant. Science 277, 91-94Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H. and Nakatani, Y. (1996) The transcriptional coactivators p300 and CBP are hstone acetyltransferases. Cell, 87, 953-959Pazin, M. J. and Kadonaga, J. T. (1997) What's up and down with histone deacetylation and transcription? Cell 89, 325-8.Pysh, L. D., Wysocka-Diller, J. W., Camilleri, C., Bouchez, D. and Benfey, P. (1999) The GRAS gene family in Arabidopsis : sequence characterization and basic expression analysis of the SCARECROW-LIKE genes. Plant J., 18: 111-119.Quinn, P. G. (1993) Distinct activation domains within camp response element-binding protein (CREB) mediate basal and camp-stimulated transcription. J. Biol. Chem. 268, 16999-117009.Ridgeway, P. and Almouzni, G. (2000) CAF-1 and the inheritance of chromatin states: at the crossroads of DNA replication and repair. J. Cell Sci., 113: 2647-2658.Rizzo, P., Di Resta, I., Powers, A., Ratner, H. and Carbone, M. (1999) Unique strains of SV40 in commercial poliovaccines from 1955 not readily identifiable with current testing for SV40 infection. Cancer Res. 59, 6103-6108.Robbins, J., Dilworth, S. M., Laskey, R. A., Dingwall, C. (1991) Two interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell, 64: 615-623Rundlett, S. E., Carmen, A. A., Kobayashi, R., Bavykin, S., Turner, B. M., Grunstein, M. (1996) HDA1 and RPD3 are members of distinct yeast histone deacetylase complexes that regulate silencing and transcription. Proc Natl Acad Sci USA. 93, 14503-8.Salter, M. G., et al, 1998, Plant Journal 16, 127-132Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual (1989), Cold Spring HarborSardana et al. (Plant Cell Reports 15:677-681; 1996).Scheres, B., Di Laurenzio, L., Willemsen, V., Hauser, M.-T., Janmaat, K., Weisbeek, P. and Benfey, P. N. (1995) Mutations affecting the radial organization of the Arabidopsis root display specific defects throughout the radial axis. Development, 121: 53-62.Schumacher, K., Schmitt, T., Rossberg, M., Schmitz, G. and Theres, K. (1999) The lateral suppressor (Ls) gene of tomato encodes a new member of the VHIID protein family. Proc. Natl. Acad. Sci . USA, 96: 290-295.Shaywitz, A. J., Dove, S. L., Kornhauser, J. M., Hochschild, A., Greenberg, M. E. (2000) Magnitude of the CREB-dependent transcriptional response is determined by the strength of the interaction between the kinase-inducible domain of CREB and the KIX domain of CREB-binding protein. Mol. Cell. Biol. 20, 9409-9422Silverstone, A., Ciampaglio, C. N. and Sun T. (1998) The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway. Plant Cell, 10: 155-169.Stockinger, E. J., Gilmour, S. J. and Thomashow, M. F. (1997) Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. USA 94, 1035-1040.Stockinger, E. J., Mao, Y., Regier, M. K., Triezenberg, S. J. and Thomashow, M. F. (2001) Transcriptional adaptor and histone acetyltransferase proteins in Arabidopsis and their interaction with CBF1, a transcriptional activator involved in cold-regulated gene expression. Nucleic Acids Res. 29, 1524-1533.Struhl, K. (1998) Histone acetylation and transcriptional regulatory mechanisms. Genes Dev. 12, 599-606.Tian, L. and Chen, Z. J. (2001) Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development. Proc. Natl. Acad. Sci. USA, 98: 200-205.Tian, Q., Uhlir, N. J. and Reed, J. W. (2002) Arabidopsis SHY2/IAA3 inhibits auxin-regulated gene expression. Plant Cell, 14: 301-319.Ulmasov, T., Murfett, J., Hagen, G., Guilfoyle, T. J. (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9, 1963-1971van der Krol, A. R. and Chua, N. H. (1991) The basic domain of plant B-ZIP proteins facilitates import of a reporter protein into plant nuclei. Plant Cell, 3: 667-675Varagona, M. J., Schmidt, R. J., Raikhel, N. V. (1992) Nuclear localization signal(s) required for nuclear targeting of the maize regulatory protein Opaque-2. Plant Cell, 4: 1213-1227.Varagona, M. J., Schmidt, R. J. and Raikhel, N. V. (1991) Monocot regulatory protein Opaque-2 is localized in the nucleus of maize endosperm and transformed tobacco plants. Plant Cell 3, 105-113.Verbsky, M. and Richards, E. J. (2001) Chromatin remodeling in plants. Curr. Opin. Plant Biol. 4, 494-500.Verdel, A. and Khochbin, S. (1999) Identification of a new family of higher eukaryotic histone deacetylases. Coordinate expression of differentiation-dependent chromatin modifiers. J Biol. Chem. 274, 2440-5.Vidal, M. and Gaber, R. F. (1991) RPD3 encodes a second factor required to achieve maximum positive and negative transcriptional states in Saccharomyces cerevisiae . Mol Cell Biol. 11, 6317-27.Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pp. 421-463 (1988)Wu, K., Malik, K., Tian, L., Brown, D. and Miki, B. (2000a) Functional analysis of a RPD3 histone deacetylase homologue in Arabidopsis thaliana. Plant Mol. Biol. 44:167-176.Wu, K., Tian L., Malik K., Brown D. and Miki B. (2000b) Functional analysis of HD2 histone deacetylase homologues in Arabidopsis thaliana . Plant J. 22: 19-27.Xu, Y., Yu, H., Hall, T. C. (1994) Rice Triosephosphate Isomerase Gene 5[prime] Sequence Directs [beta]-Glucuronidase Activity in Transgenic Tobacco but Requires an Intron for Expression in Rice. Plant Physiol. 106: 459-467.Yanovsky et al., 1990, Nature, 346: 35-39Zenser, N., Ellsmore, A., Leasure, C. and Callis, J. (2001) Auxin modulates the degradation rate of Aux/IAA proteins. Proc. Natl. Acad. Sci . USA, 98: 11795-11800.Zhang, W., McElroy, D., Wu, R. (1991) Analysis of rice Act1 5′ region activity in transgenic rice plants. Plant Cell, 3: 1155-1165Zhu, T., Peterson, D. J., Tagliani, L., St Clair, G., Baszczynski, C. L., Bowen, B. (1999) Targeted manipulation of maize genes in vivo using chimeric RNA/DNA oligonucleotides. Proc. Natl. Acad. Sci. USA, 96: 8768-73.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}},"description_lang":["en"],"has_description":true,"has_docdb":true,"has_inpadoc":true,"has_full_text":true,"biblio_lang":"en"},"jurisdiction":"US","collections":[],"usersTags":[],"lensId":"006-576-968-901-581","publicationKey":"US_7553667_B2","displayKey":"US 7553667 B2","docAssets":{"lensId":"006-576-968-901-581","pdfUrl":"https://www.lens.org/images/patent/US/7553667/B2/US_7553667_B2.pdf","images":[{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000001.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000001.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000002.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000002.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000003.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000003.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000004.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000004.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000005.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000005.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000006.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000006.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000007.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000007.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000008.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000008.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000009.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000009.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000010.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000010.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000011.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000011.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000012.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000012.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000013.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000013.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000014.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000014.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000015.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000015.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000016.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000016.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000017.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000017.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000018.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000018.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000019.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000019.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000020.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000020.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000021.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000021.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000022.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000022.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000023.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000023.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000024.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000024.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000025.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000025.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000026.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000026.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000027.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000027.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000028.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000028.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000029.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000029.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000030.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000030.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000031.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000031.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000032.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000032.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000033.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000033.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000034.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000034.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000035.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000035.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000036.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000036.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000037.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000037.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000038.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000038.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000039.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000039.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000040.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000040.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000041.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000041.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000042.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000042.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000043.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000043.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000044.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000044.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000045.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000045.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000046.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000046.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000047.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000047.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000048.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000048.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000049.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000049.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000050.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000050.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000051.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000051.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000052.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000052.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000053.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000053.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000054.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000054.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000055.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000055.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000056.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000056.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000057.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000057.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000058.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000058.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000059.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000059.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000060.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000060.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000061.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000061.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000062.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000062.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000063.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000063.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000064.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000064.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000065.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000065.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000066.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000066.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000067.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000067.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000068.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000068.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000069.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000069.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000070.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000070.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000071.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000071.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000072.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000072.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000073.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000073.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000074.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000074.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000075.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000075.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000076.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000076.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000077.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000077.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000078.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000078.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000079.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000079.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000080.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000080.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000081.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000081.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000082.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000082.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000083.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000083.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000084.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000084.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000085.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000085.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000086.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000086.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000087.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000087.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000088.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000088.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000089.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000089.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000090.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000090.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000091.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000091.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000092.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000092.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000093.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000093.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000094.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000094.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000095.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000095.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000096.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000096.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000097.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000097.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000098.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000098.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000099.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000099.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000100.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000100.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000101.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000101.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/10pc/00000102.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/B2/7553/7553667/image/page/full/00000102.png"}],"fallover":false},"countryName":"USA","inventorModel":{"inventors":[{"name":{"value":"HANNOUFA ABDELALI","valueNormalised":"Hannoufa Abdelali"},"inventorship":null},{"name":{"value":"LYDIATE DEREK J","valueNormalised":"Lydiate Derek J"},"inventorship":null},{"name":{"value":"GAO MING-JUN","valueNormalised":"Gao Ming-jun"},"inventorship":null}],"inventorships":[],"unmatchedInventorships":[],"activeUserHasInventorship":false},"simpleFamilyId":217020985,"citesPatentCount":8,"countrySpec":{"countryName":"USA","description":"GRANTED PATENT AS SECOND PUBLICATION [FROM 2001 ONWARDS]","rule":"pubdate:AFTER:01-01-2001","docType":"GRANTED_PATENT"},"pageTitle":"US 7553667 B2 - Regulation of gene expression using chromatin remodelling factors","documentTitle":"Regulation of gene expression using chromatin remodelling factors"},"claims":{"source":"xml_claims","claims":[{"lines":["A method to regulate expression of a nucleic acid sequence of interest comprising:\n
i) providing a eukaryote having:\n\n1) a first nucleotide sequence comprising,\n\na) said nucleic acid sequence of interest operatively linked to a first regulatory region,\nb) an operator sequence capable of binding a fusion protein, and;\n2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding said fusion protein, said fusion protein comprising,\n\na) a DNA binding protein, or a portion thereof, capable of binding said operator sequence, and;\nb) a recruitment factor protein, or a portion thereof, capable of binding a chromatin remodeling protein, wherein said recruitment factor protein comprises SEQ ID NO:81 or a fragment thereof, wherein said fragment is capable of binding to HDA19; and\n
ii) growing said eukaryote, wherein expression of said second nucleotide sequence produces said fusion protein that regulates expression of said nucleic acid sequence of interest."],"number":1,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein the eukaryote is a plant."],"number":2,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein said operator sequence is selected from the group consisting of a ROS operator, a Tet operator, Sin3, VP16, GAL4, Lex A, UMe6, ERF, SEBF, CBF and a DNA binding domain of a transcription factor."],"number":3,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein the recruitment factor is characterized as having a histone deacetylase binding domain or a histone acetylase binding domain."],"number":4,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 2, wherein said first, second, or both said first an second nucleotide sequences are incorporated into said plant by crossing."],"number":5,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 5, wherein said crossing comprises crossing a first plant comprising said first nucleotide sequence with a second plant comprising said second nucleotide sequence, to obtain progeny."],"number":6,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 2, wherein said first, second, or both said first and second nucleotide sequences are incorporated into said plant by transformation."],"number":7,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid sequence encoding the sequence of BnSCL1 (SEQ ID NO:81)."],"number":8,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid sequence encoding amino acids 1 to 358 of SEQ ID NO:81."],"number":9,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid sequence encoding amino acids 1 to 261 of SEQ ID NO:81."],"number":10,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid sequence encoding amino acids 1 to 217 of SEQ ID NO:81."],"number":11,"annotation":false,"title":false,"claim":true},{"lines":["An isolated nucleic acid sequence encoding amino acids 146 to 358 of SEQ ID NO:81."],"number":12,"annotation":false,"title":false,"claim":true},{"lines":["The method of claim 1, wherein the recruitment factor protein comprises SEQ ID NO:81."],"number":13,"annotation":false,"title":false,"claim":true},{"lines":["A method to regulate expression of a nucleic acid of interest in a plant comprising:\n
i) introducing into said plant:\n\n1) a first nucleotide sequence comprising,\n\na) said nucleic acid sequence of interest operatively linked to a first regulatory region,\nb) an operator sequence capable of binding a fusion protein, and;\n2) a second nucleotide sequence comprising a second regulatory region in operative association with a nucleotide sequence encoding said fusion protein, said fusion protein comprising,\n\na) a DNA binding protein, or a portion thereof, capable of binding said operator sequence, and;\nb) the polypeptide of SEQ ID NO:81 or a fragment of SEQ ID NO:81 wherein said fragment is capable of binding to HDA19; and\n
ii) growing said plant, wherein expression of said second nucleotide sequence produces said fusion protein that regulates expression of said nucleic acid sequence of interest."],"number":14,"annotation":false,"title":false,"claim":true}]}},"filters":{"npl":[],"notNpl":[],"applicant":[],"notApplicant":[],"inventor":[],"notInventor":[],"owner":[],"notOwner":[],"tags":[],"dates":[],"types":[],"notTypes":[],"j":[],"notJ":[],"fj":[],"notFj":[],"classIpcr":[],"notClassIpcr":[],"classNat":[],"notClassNat":[],"classCpc":[],"notClassCpc":[],"so":[],"notSo":[],"sat":[]},"sequenceFilters":{"s":"SEQIDNO","d":"ASCENDING","p":0,"n":10,"sp":[],"si":[],"len":[],"t":[],"loc":[]}}