Antibody Producing Non-human Mammals

  *US09951124B2*
  US009951124B2                                 
(12)United States Patent(10)Patent No.: US 9,951,124 B2
  et al. (45) Date of Patent:*Apr.  24, 2018

(54)Antibody producing non-human mammals 
    
(75)Inventor: MERUS N.V.,  Utrecht (NL) 
(73)Assignee:MERUS N.V.,  Utrecht (NL), Type: Foreign Company 
(*)Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 175 days. 
  This patent is subject to a terminal disclaimer. 
(21)Appl. No.: 13/750,753 
(22)Filed: Jan.  25, 2013 
(65)Prior Publication Data 
 US 2013/0145484 A1 Jun.  6, 2013 
 Related U.S. Patent Documents 
(63) .
Continuation of application No. 12/589,181, filed on Oct.  19, 2009 , which is a continuation of application No. 12/459,285, filed on Jun.  29, 2009, now abandoned .
 
(60)Provisional application No. 61/133,274, filed on Jun.  27, 2008.
 
Jan.  1, 2013 C 07 K 16 1282 F I Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 67 027 L I Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 67 0278 L I Apr.  24, 2018 US B H C Jan.  1, 2013 C 07 K 14 47 L I Apr.  24, 2018 US B H C Jan.  1, 2013 C 07 K 16 248 L I Apr.  24, 2018 US B H C Jan.  1, 2013 C 12 N 15 8509 L I Apr.  24, 2018 US B H C Jan.  1, 2013 C 12 P 21 00 L I Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2207 15 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2217 052 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2217 075 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2217 15 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2217 206 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2227 105 L A Apr.  24, 2018 US B H C Jan.  1, 2013 A 01 K 2267 01 L A Apr.  24, 2018 US B H C Jan.  1, 2013 C 07 K 2317 24 L A Apr.  24, 2018 US B H C
(51)Int. Cl. A01K 067/027 (20060101); C12P 021/08 (20060101); C07K 016/12 (20060101); C07K 014/47 (20060101); C07K 016/24 (20060101); C12N 015/85 (20060101); C12P 021/00 (20060101)
(58)Field of Search  800/18, 13, 6

 
(56)References Cited
 
 U.S. PATENT DOCUMENTS
 5,565,332  A  10/1996    Hoogenboom et al.     
 5,614,396  A  3/1997    Bradley et al.     
 5,770,429  A  6/1998    Lonberg et al.     
 5,789,215  A  8/1998    Berns et al.     
 5,939,598  A  8/1999    Kycherlapati et al.     
 6,069,010  A  5/2000    Choi     
 6,114,598  A  9/2000    Kucherlapati et al.     
 6,596,541  B2  7/2003    Murphy et al.     
 7,105,348  B2  9/2006    Murphy et al.     
 7,262,028  B2  8/2007    Van Berkel et al.     
 7,329,530  B2  2/2008    Houtzager et al.     
 7,429,486  B2  9/2008    Van Berkel et al.     
 7,579,446  B2  8/2009    Bakker et al.     
 7,696,330  B2  4/2010    ter Meulen et al.     
 7,740,852  B2  6/2010    Bakker et al.     
 7,777,010  B2  8/2010    Logtenberg     
 7,858,086  B2  12/2010    Geuijen et al.     
 7,901,919  B2  3/2011    Houtzager et al.     
 7,919,257  B2  4/2011    Hoogenboom et al.     
 7,927,834  B2  4/2011    Van Berkel et al.     
 7,932,360  B2  4/2011    Van Berkel et al.     
 7,960,518  B2  6/2011    Throsby et al.     
 7,968,092  B2  6/2011    Throsby et al.     
 8,052,974  B2  11/2011    Throsby et al.     
 8,106,170  B2  1/2012    ter Meulen et al.     
 8,148,497  B2  4/2012    Bakker et al.     
 8,192,927  B2  6/2012    van den Brink et al.     
 8,211,431  B2  7/2012    Throsby et al.     
 8,241,631  B2  8/2012    Throsby et al.     
 8,268,756  B2  9/2012    Logtenberg et al.     
 8,502,018  B2  8/2013    Murphy et al.     
 9,248,182  B2  2/2016    De Kruif et al.     
 2002//0138857  A1  9/2002    Ghayur     
 2003//0093820  A1  5/2003    Green et al.     
 2003//0096225  A1  5/2003    Logtenberg     
 2005//0170398  A1  8/2005    Van Berkel     
 2006//0015949  A1  1/2006    Lonberg et al.     
 2006//0015957  A1*1/2006    Lonberg et al. 800/18
 2006//0205077  A1  9/2006    Schwenk et al.     
 2006//0257397  A1  11/2006    Throsby et al.     
 2007//0280945  A1  12/2007    Stevens et al.     
 2008//0070799  A1  3/2008    Bakker et al.     
 2009//0054254  A1  2/2009    Throsby et al.     
 2009//0130652  A1  5/2009    Throsby et al.     
 2009//0181855  A1  7/2009    Vasquez et al.     
 2010//0069614  A1  3/2010    Houtzager et al.     
 2010//0146647  A1  6/2010    Logtenberg et al.     
 2010//0172917  A1  7/2010    ter Meulen et al.     
 2010//0297153  A1  11/2010    Geuijen et al.     
 2010//0310572  A1  12/2010    Bakker et al.     
 2010//0310586  A1  12/2010    Dolcetti et al.     
 2010//0331527  A1  12/2010    Davis et al.     
 2011//0177073  A1  7/2011    Van Berkel et al.     
 2011//0195454  A1  8/2011    McWhirter     
 2011//0268739  A1  11/2011    Throsby et al.     
 2012//0021409  A1  1/2012    McWhirter     
 2012//0039898  A1  2/2012    Throsby et al.     
 2012//0058907  A1  3/2012    Logtenberg et al.     
 2012//0076794  A1  3/2012    Throsby et al.     
 2012//0093823  A1  4/2012    van den Brink et al.     
 2012//0141493  A1  6/2012    Throsby et al.     
 2012//0177637  A1  7/2012    Hoogenboom et al.     
 2012//0192300  A1  7/2012    Babb     
 2012//0276115  A1  11/2012    van den Brink et al.     
 2012//0315278  A1  12/2012    Throsby et al.     

 
 FOREIGN PATENT DOCUMENTS 
 
       EP       0 814 159                         8/1991      
       EP       0 469 025                         8/1995      
       EP       0814159       A2                12/1997      
       EP       1 204 740                         5/2002      
       EP       1349234       A2                10/2003      
       EP       1 399 575                         3/2004      
       EP       1 439 234                         7/2004      
       EP       1 439 234       A1                7/2004      
       EP       2 147 594                         1/2010      
       JP       2004-008218                         1/2004      
       JP       2006-109711                         4/2006      
       WO       WO-9/0/04036                         4/1990      
       WO       WO-9/0/12878                         11/1990      
       WO       WO-9/1/00906                         1/1991      
       WO       WO-9/2/03918                         3/1992      
       WO       94/02602       A1                2/1994      
       WO       WO-9/4/02602                         2/1994      
       WO       WO-9/4/04667                         3/1994      
       WO       WO-9/6/30498                         10/1996      
       WO       WO-9/8/24893                         6/1998      
       WO       WO-9/8/50431                         11/1998      
       WO       WO 98/ 50431                         11/1998      
       WO       WO 98/52976                         11/1998      
       WO       WO-9/9/45962                         9/1999      
       WO       WO-0/2/36789                         5/2002      
       WO       02/066630       A1                8/2002      
       WO       WO-0/2/066630                         8/2002      
       WO       WO-0/3/47336                         6/2003      
       WO       2004/009618       A2                1/2004      
       WO       2004106375       A1                5/2004      
       WO       20040106375       A1                12/2004      
       WO       WO-0/4/106375                         12/2004      
       WO       WO 20/04/106375       A1                12/2004      
       WO       WO 20/05/068622       A2                7/2005      
       WO       WO-0/6/68953                         6/2006      
       WO       WO 02/066630                *       8/2006      
       WO       2006117699       A2                11/2006      
       WO       20060117699       A2                11/2006      
       WO       WO-0/6/117699                         11/2006      
       WO       2008/054606       A2                5/2008      
       WO       WO-0/8/54606                         5/2008      
       WO       2008/076379       A2                6/2008      
       WO       WO-0/8/76379                         6/2008      
       WO       WO-0/9/18411                         2/2009      
       WO       WO-0/9/23540                         2/2009      
       WO       WO 20/09/157771       A2                12/2009      
       WO       WO-1/1/014469                         2/2011      
       WO       WO 20/11/097603       A1                8/2011      
       WO       WO-1/2/141798                         10/2012      
       WO       WO-1/6/081923                         5/2016      

 OTHER PUBLICATIONS
  
  de Wildt et al. (1999) J. Mol. Biol., vol. 285, 895-901. *
  O'Brien et al. (1987) Nature, vol. 326, 405-409. *
  Peled et al.(2008) Annu. Rev. Immunol., vol. 26, 481-511. *
  Davies, Nicholas P. et al., “Creation of Mice Expressing Human Antibody Light Chains by Introduction of a Yeast Artificial Chromosome Containing the Core Region of the Human Immunoglobulin kappa Locus,” Bio/Technology, vol. 11:911-914 (1993).
  Lonberg, Nils et al., “Antigen-specific human antibodies from mice comprising four distinct genetic modificaitons,” Nature, vol. 368:856-859 (1994).
  Taylor, Lisa D. et al., “A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins,” Nucleic Acids Research, vol. 20(23):6287-6295 (1992).
  Taylor, Lisa D. et al., “Human immunoglobulin transgenes undergo rearrangement, somatic mutation and class switching in mice that lack endogenous IgM,” International Immunology, vol. 6(4):579-591 (1994).
  Attaelmannan, Mohammed et al., “Understanding and Identifying Monoclonal Gammopathies,” Clinical Chemistry, vol. 46(8B):1230-1238 (2000).
  Carter, Paul, “Bispecific human IgG by design,” Journal of Immunological Methods, vol. 248:7-15 (2001).
  Dechiara, Thomas M. et al., “VelociMouse: Fully ES Cell-Derived F0-Generation Mice Obtained from the Injection of ES Cells into Eight-Cell-Stage Embryos,” Gene Knockout Protocols: Second Edition, Ralf Kuhn (Ed.), Humana Press, vol. 530, Chapter 16, pp. 311-324 (2009).
  Fecteau, Jessie F. et al., “A New Memory CD27 IgG+ B Cell Population in Peripheral Blood Expressing VH Genes with Low Frequency of Somatic Mutation,” The Journal of Immunology, vol. 177:3728-3736 (2006).
  GenBank Accession No. DQ187586-1, Protein ID ABA26122.1, Rabquer, B.J. et al., “Differential variable gene usage between pneumococcal polysaccharide specific B cells isolated 5-10 days and 4-6 weeks post-vaccination,” 1 page (2005).
  Kling, Jim, “Big Pharma vies for mice,” Nature Biotechnology, vol. 25 (6):613 (2007).
  Lie, Y.S. et al., “Advances in quantitative PCR technology: 5′ nuclease assays,” Curr. Opin. Biotechnol., vol. 9 (1):43-48 (1998).
  Logtenberg, Ton, “Antibody cocktails: next-generation biopharmaceuticals with improved potency,” Trends in Biotechnology, vol. 25(9):390-394 (2007).
  Merus, “MeMo—the ingenious mouse, for improved antibody therapeutics,” www.merus.nl, 3 pages (2011).
  Murphy, Kenneth, “The Development and Survival of Lymphocytes,” Janeway's Immunobioloby, 8th Edition, Taylor & Francis, Chapter 8, pp. 275-290 (2011).
  Nagle, Mike, “Regeneron helps make Sanofi VelocImmune to its ‘weak’ pipeline,” Outsourceing-Pharma.com, 2 pages (2007).
  Nemazee, David, “Receptor editing in lymphocyte development and central tolerance,” Nature, vol. 6(10):728-740 (2006).
  Retter, Marc W. et al., “Receptor Editing Occurs Frequently during Normal B Cell Development,” J. Exp. Med., vol. 188(7):1231-1238 (1998).
  Sasaki, Yoshiteru et al., “Canonical NF-kB Activity, Dispensable for B Cell Development, Replaces BAFF-Receptor Signals and Promotes B Cell Proliferation upon Activation,” Immunity, vol. 24:729-739 (2006).
  Scott, Christopher Thomas, “Mice with a human touch,” Nature Biotechnology, vol. 25:1075-1077 (2007).
  Stevens, Sean, “Human Antibody Discovery, VelocImmune—A novel platform,” Pharma Focus Asia, Issue 8, pp. 72-74 (2008).
  Torres, Raul M. et al., Laboratory Protocols for Conditional Gene Targeting, Oxford University Press, Oxford, Chapters 10-11, pp. 42-53 (1997).
  Van Doorn, S.T., Additional post-filing data and letter filed by the patentee, 1 page, dated Jun. 13, 2013.
  Yang, X.W. et al., “Homologous recombination based modification in Escherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome,” Nat. Biotechnol., vol. 15(9):859-865 (1997).
  Australian Office Action for Application No. 2009263082, 8 pages, dated Mar. 18, 2014.
  Canadian Protest and Submission of Prior Art for Application No. 2,729,095, 16 pages, dated Apr. 8, 2014.
  International Preliminary Report on Patentability and Written Opinion for Application No. PCT/NL2009/050381, 11 pages, dated Jan. 5, 2011.
  Third Party Observation for Application No. 09075279.1, 12 pages, dated Sep. 12, 2013.
  Third Party Observation for Application No. 09075279.1, 4 pages, dated Oct. 10, 2013.
  Third Party Observation for Application No. 2009263082, 25 pages, dated Oct. 28, 2013.
  Third Party Observation for Application No. EP20090075279, 12 pages (2013).
  Third Party Observations Against European Parent Application No. 09075279.1 in the Name of Merus BV, 3 pages, dated Jul. 1, 2013.
  Statement of Facts and Arguments in Support of Opposition, Patent No. EP2147594 B1, 46 pages, dated Aug. 11, 2014.
  Aucouturier et al., Monoclonal Ig L Chain and L Chain V Domain Fragment Crystallization in Myeloma-Associated Fanconi's Syndrome, The Journal of Immunology, Apr. 15, 1993, pp. 3561-3568, vol. 150, No. 8.
  de Wildt et al., Analysis of Heavy and Light Chain Pairings Indicates that Receptor Editing Shapes the Human Antibody Repertoire, J. Mol. Biol., 1999, pp. 895-901, vol. 285.
  Gonzales-Fernandez et al., Analysis of somatic hypermutation in mouse Peyer's patches using immunoglobulin κlight-chain transgenes, Proc. Natl. Acad. Sci., Nov. 1993, pp. 9862-9866, vol. 90.
  Goyenechea et al., Modifying the sequence of an immunoglobulin V-gene alters the resulting pattern of hypermutation, Proc. Natl. Acad. Sci, 1996, pp. 13979-13984, vol. 93.
  Hengstschlager et al., A λ1 transgene under the control of a heavy chain promoter and enhancer does not undergo somatic hypermutation, Eur. J. Immunol. 1994, pp. 1649-1656, vol. 24.
  Jolly et al., Rapid methods for the analysis of immunoglobulin gene hypermutation: application to transgenic and gene targeted mice, Nucleic Acids Research, 1997, pp. 1913-1919, vol. 25, No. 10.
  Klotz et al., Somatic Hypermutation of a λ2 Transgene Under the Control of the λ Enhancer or the Heavy Chain Intron Enhancer, The Journal of Immunology, 1996, pp. 4458-4463, vol. 157.
  Kong et al., A λ 3′ Enhancer Drives Active and Untemplated Somatic Hypermutation of a λ1 Transgene, The Journal of Immunology, 1998, pp. 294-301, vol. 161.
  Mendez et al., Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice, Nature Genetics, 1997, pp. 146-156, vol. 15.
  Nissim et al., Antibody fragments from a ‘single pot’ phage display library as immunochemical reagents, The EMBO Journal, 1994, pp. 692-698, vol. 13. No. 3.
  Odegard et al., Targeting of somatic hypermutation, Nature Reviews, Immunology, Aug. 2006, pp. 573-583, vol. 6, No. 8.
  Sharpe et al., Somatic hypermutation of immunoglobulin κ may depend on sequences 3′ of Cκ and occurs on passenger transgenes, The EMBO Journal, 1991, pp. 2139-2145, vol. 10, No. 8.
  Sirac et al., Role of the monoclonal κ chain V domain and reversibility of renal damage in a transgenic model of acquired Fanconi syndrome, Blood, Jul. 15, 2006, pp. 536-543, vol. 108, No. 2.
  De Kruif et al., Human Immunoglobulin Repertoires against Tetanus Toxoid Contain a Large and Diverse Fraction of High-Affinity Promiscuous VH Genes, J. Mol. Biol., 2009, pp. 548-558, vol. 387.
  Homig-Holzel et al., Constitutive CD40 signaling in B cells selectively activates the noncanonical NF-κB pathway and promotes lymphomagenesis, J. Exp. Med., 2008, pp. 1317-1329, vol. 205, No. 6.
  ImMunoGeneTics Information System, for analysed sequence CHEB VK, http://www.imgt.org/IMGT_vquest/vquest, at least as early as Apr. 25, 2012.
  Jakobovits et al., From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice, Nature Biotechnology, Oct. 2007, pp. 1134-1143, vol. 25, No. 10.
  Kwaks et al., Employing epigenetics to augment the expression of therapeutic proteins in mammalian cells, Trends in Biotechnology, Mar. 1, 2006, pp. 137-142, vol. 24, No. 3, Elsevier Publications, Cambridge, GB.
  Lonberg et al., Human antibodies from transgenic animals, Nature Biotechnology, Sep. 1, 2005, pp. 1117-1125, vol. 23, No. 9, Nature Publishing Group, New York, NY, US.
  NCBI, Aucouturier et al., Monoclonal IgL Claim and L chain V domain fragment crystallization in myeloma-associated Fanconi's syndrome, <http://www.ncbi.nlm.nib/gov/nuccore/M87478, at least as early as Apr. 25, 2012.
  PCT International Preliminary Report on Patentability, PCT/NL2009/050381 dated Jan. 5, 2011.
  PCT International Search Report, PCT/NL2009/050381 dated Dec. 7, 2009.
  Third Party Observations Under Article 115 EPC Against European Parent Application No. 09075279.1 in the name of Merus B.V., dated Oct. 25, 2012.
  Third Party Observations Under Article 115 EPC Against European Parent Application No. 09075279.1 in the name of Merus B.V., dated Apr. 25, 2012.
  European Patent Office Communication for Application No. 09075279.1 dated Nov. 5, 2012.
  European Patent Office Communication for Application No. 09075279.1 dated May 8, 2012.
  Bruggemann et al., A Repertoire of Monoclonal Antibodies with Human Heavy Chains from Transgenic Mice, Proc. Natl. Acad. Sci., Sep. 1989, pp. 6709-6713, vol. 86, USA.
  Hochedlinger et al., Nature, 2002, pp. 1035-1038, vol. 415.
  Meyer et al., N.A.R., 1990, 5609-15, vol. 18, No. 19.
  Pelanda et al., A prematurely expressed Ig(kappa) transgene, but not V(kappa)J(kappa) gene segment targeted into the Ig(kappa) locus, can rescue B cell development in lambda5-deficient mice, Immunity, Sep. 1996, pp. 229-239, vol. 5, No. 3.
  Popov et al., J. Exp. Med, 1999, pp. 1611-1619, vol. 189, No. 10.
  Presta et al., Engineering of therapeutic antibodies to minimize immunogenicity and optimize function, Advanced Drug Delivery Reviews, Aug. 7, 2006, pp. 640-656, vol. 58, No. 5-6, Elsevier BV, Amsterdam, NL.
  Smith-Gill et al., Contributions of immunoglobulin heavy and light chains to antibody specificity for lysozyme and two haptens, Journal of Immunology, Dec. 15, 1987, pp. 4135-4144, vol. 139, No. 12., Baltimore, MD, US.
  Storb et al., J. Exp. Ed., 1986, pp. 627-641, vol. 164.
  Weiner, et al., Abstract, Fully human therapeutic monoclonal antibodies, Journal of Immunotherapy, Jan. 1, 2006, pp. 1-9, vol. 29, No. 1, Lippincott Williams & Wilkins, Hagerstown, MD, US.
  Winter et al., Insertion of 2 kb of bacteriophage DNA between an immunoglobulin promoter and leader exon stops somatic hypermutation in a kappa transgene, Molecular Immunology, Apr. 1997, pp. 359-366, vol. 34, No. 5.
  Xiang et al., The Downstream Transcriptional Enhancer, Ed, positively regulates mouse Ig kappa gene expression and somatic hypermutation, Journal of Immunology, May 15, 2008, pp. 6725-6732, vol. 180, No. 10, Baltimore, MD.
  U.S. Appl. No. 13/488,628, filed Jun. 5, 2012.
  U.S. Appl. No. 14/266,540, filed Apr. 30, 2014, Ton Logtenberg.
  U.S. Appl. No. 14/265,046, filed Apr. 29, 2014, Ton Logtenberg.
  U.S. Appl. No. 12/589,181, Ton Logtenberg, filed Oct. 19, 2009, dated Sep. 24, 2014.
  U.S. Appl. No. 14/266,540, Ton Logtenberg, filed Apr. 30, 2014, dated Aug. 29, 2014.
  U.S. Appl. No. 14/265,046, Ton Logtenberg, filed Apr. 29, 2014, dated Aug. 29, 2014.
  U.S. Appl. No. 12/589,181, filed Oct. 19, 2009, Ton Logtenberg.
  U.S. Appl. No. 12/589,181, dated Jan. 17, 2014.
  U.S. Appl. No. 12/589,181, dated Aug. 21, 2013.
  U.S. Appl. No. 12/589,181, dated May 13, 2013.
  U.S. Appl. No. 12/589,181, dated Apr. 16, 2012.
  U.S. Appl. No. 12/589,181, dated Dec. 22, 2011.
  U.S. Appl. No. 12/589,181, dated Oct. 31, 2011.
  Bogen, Bjarne et al., “A rearranged lambda 2 light gene chain retards but does not exclude kappa and lambda 1 expression,” Eur. J. Immunol., vol. 21:2391-2395 (1991).
  Esposito, Gloria et al., “Phage display of a human antibody against Clostridium tetani toxin,” Gene, vol. 148:167-168 (1994).
  Goyenechea, Beatriz et al., “Cells strongly expressing Igk transgenes show clonal recruitment of hypermutation: a role for both MAR and the enhancers,” The EMBO Journal, vol. 16(13):3987-3994 (1997).
  Klohn, Peter-Christian et al., “IBC's 23rd Annual Antibody Engineering, 10th Annual Antibody Therapeutics International Conferences and the 2012 Annual Meeting of the Antibody Society,” mAbs, vol. 5(2):178-201 (2013).
  Mao, Xiaohong et al., “Activation of EGFP expression by Cre-mediated excision in a new ROSA26 reporter mouse strain,” Blood, vol. 97(1):324-326 (2001).
  Neuberger, M.S. et al., “Isotype exclusion and transgene down-regulation in immunoglobulin-lambda transgenic mice,” Nature, vol. 338:350-352 (1989).
  Peled, Jonathan U. et al., “The Biochemistry of Somatic Hypermutation,” Annu. Rev. Immunol., vol. 26:481-511 (2008).
  Rickert, Robert C. et al., “B lymphocyte-specific, Cre-mediated mutagenesis in mice,” Nucleic Acids Research, vol. 25(6):1317-1318 (1997).
  Roitt, A. , Immunology, Mir, Moscow, pp. 134, 214 (2000).
  Singer, Maxine et al., “Transcription: The Transfer of DNA Sequence Information to RNA,” Genes & Genomes, University Science Books, CA, Chapter 3.2, pp. 134-145 (1991).
  Yarilin, A.A., Osnovy Immunologii, [Fundamentals of Immunology], Meditsina, Moscow, p. 194 (1999).
  Yarilin, A.A., Osnovy Immunologii, [Fundamentals of Immunology], Meditsina, Moscow, p. 195 (1999).
  Third Party Observations Against European Parent Application No. 09075279.1 in the Name of Merus BV, 8 pages, dated May 16, 2013.
  Third Party Observation for Application No. EP20090075279, 16 pages, dated Jun. 14, 2013.
  U.S. Appl. No. 12/589,181, dated Oct. 23, 2013.
  Declaration of Robert Brink, Apr. 30, 2015, 34 pages.
  Declaration of Anthony L. DeFranco, Dec. 21, 2014, 56 pages.
  Declaration of Peter Hudson, May 1, 2015, 52 pages.
  Declaration of Andrew Murphy, Dec. 19, 2014, 18 pages.
  Declaration of David Tarlinton, Dec. 21, 2014, 40 pages.
  Second Declaration of Robert Brink, Jun. 2, 2015, 38 pages.
  Second Delaration of Peter Hudson, Jun. 2, 2015, 81 pages.
  Pokorna et al., “DNA-vaccination via tattooing induces stronger humoral and cellular immune responses than intramuscular delivery supported by molecular adjuvants,” Genetic Vaccines and Therapy (2008) 6:4.
  Third Party Observations against EP 12186010.0, dated Mar. 13, 2017, 8 pages.
  Mead et al., “Detection of Bence Jones myeloma and monitoring of myeloma chemotherapy using immunoassays specific for free immunoglobulin light chains,” Clinical Laboratory (2003) 49(1-2):25-27.
  Roebroek et al., “Mutant Lrp1 Knock-in mice generated by recombinase-mediated cassette exchange reveal differential importance of the NPXY motifs in the intracellular domain on LRP1 for normal fetal development,” Molecular and Cellular Biology (2006) 26(2):605-616.
  Shmerling et al., “Strong and ubiquitous expression of transgenes targeted into the beta-actin locus by Cre/lox cassette replacement,” Genesis (2005) 42(4):229-235.
  Toledo et al., “RMCE-ASAP: a gene targeting method for ES and somatic cells to accelerate phenotype analyses,” Nucleic Acids Research (2006) 34(13):e92.
  Protest under 37 CFR § 1.291 in Re-issue U.S. Appl. No. 15/158,543, filed Oct. 14, 2016, 45 pages.
  Amendment for U.S. Appl. No. 12/932,719, filed Oct. 8, 2013, 12 pages.
  Amendment under AFCP 2.0 for U.S. Appl. No. 12/932,719, filed Jun. 11, 2014, 12 pages.
  Amendment for U.S. Appl. No. 12/932,719, filed Feb. 27, 2012, 10 pages.
  Teaching of U.S. Appl. No. 12/589,181, presented May 24, 2012, 30 pages.
  Notice of Opposition to a European Patent in EP 1360287 from Kymab Limited, filed Jun. 12, 2013, 8 pages.
  Notice of Opposition to a European Patent in EP 1360287 from Merus B.V, filed Jun. 12, 2013, 8 pages.
  Notice of Opposition to a European Patent in EP 1360287 from Merus B.V, filed Jun. 12, 2013, 4 pages.
  Communication of a notice of opposition in EP 02709544.7, dated Jun. 12, 2013, 1 page.
  Payment of fees and expenses in EP 02709544.7, filed Jun. 12, 2013, 1 page.
  Authorisation for filing an opposition in EP 02709544.7, filed Jun. 11, 2013, 1 page.
  Third party observations filed during prosecution (D12) in EP 02709544.7, filed Jun. 12, 2013, 20 pages.
  Thykjaer et al., “Gene targeting approaches using positive-negative selection and large flanking regions,” Plant Molecular Biology (1997) 35:523-530.
  Deng et al., “Reexamination of gene targeting frequency as a function of the extent of homology between the targeting vector and the target locus,” Mol Cell Biol (1992) 12(8):3365-3371.
  Taki et al., “Targeted insertion of a variable region gene into the immunoglobulin heavy chain locus,” Science (1993) 262:1268.
  Zhang et al., “A new logic for DNA engineering using recombination in Escherichia coli,” Nature Genetics (1998) (20):123-128.
  Houldsworth et al., “Comparative genomic hybridization: an overview,” AJP (1994) 145(6):1253-1260.
  Shi et al., “The mapping of transgenes by fluorescence in situ hybridization on G-branded mouse chromosomes,” Mammalian Genome (1994) 5:337-341.
  Wilke et al., “Diagnosis of haploidy and triploidy based on measurement of gene copy number by real-time PCR,” Human Mutation (2000) 16:431-436.
  Bruggemann et al., “Strategies for expressing human antibody repertoires in transgenic mice,” Immunol Today (1996) 17(8):391-397.
  Zou et al., “Cre-loxP-mediated gene replacement: a mouse strain producing humanized antibodies,” Current Biology (1994) 4:1099-1103.
  Jessen et al., “Modification of bacterial artificial chromosomes through Chi-stimulated homologous recombination and its application in zebrafish transgenesis,” Proc Natl Acad Sci USA (1998) 95:5121-5126.
  IMGT Repertoire (IG and TR) Locus representation: Human (Homo sapiens) IGH, retrieved from http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGH on Apr. 2, 2012, 6 pages.
  IMGT Repertoire (IG and TR) Locus representation: Human (Homo sapiens) IGL, retrieved from http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGL on Apr. 4, 2012, 3 pages.
  Narayanan et al., “Efficient and precise engineering of a 200kb β-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system,” Gene Therapy (1999) 6:442-447.
  Muyrers et al., “Rapid modification of bacterial artificial chromosomes by ET-recombination,” Nucleic Acids Research (1999) 27(6):1555-1557.
  Schlake et al., “Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci,” Biochemistry (1994) 33:12746-12751.
  Waterhouse et al., “Combinatorial infection and in vivo recombination: a strategy for making large phage antibody repertoires,” Nucleic Acids Research (1993) 21(9):2265-2266.
  Gu et al., “Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-Mediated gene targeting,” Cell (1993) 73:1155-1164.
  Mendez et al., “Functional transplant of megabase human immunoglobulin loci recapitulates human antibody response in mice,” Nature Genetics (1997) 15:146-156.
  Neuberger et al., “Isotype exclusion and transgene down-regulation in immunoglobulin-λ transgenic mice,” Nature (1989) 338:350-352.
  Bogen et al., “A rearranged λ2 light gene chain retards but does not exclude χ and λ1 expression,” Eur J Immunol (1991) 24:2391-2395.
  Davies et al., “Creation of mice expressing human antibody light chains by introduction of a yeast artificial chromosome containing the core region of the human immunoglobulin κ locus,” Biotechnology (1993) 11:911-914.
  Takeda et al., “Construction of chimaeric processed immunoglobulin genes containing mouse variable and human constant region sequences,” Nature (1985) 314(4):452-454.
  Taylor et al., “Human immunoglobulin transgenes undergo rearrangement, somatic mutation and class switching in mice that lack endogenous IgM,” Int Immunol (1994) 6(4):579-591.
  Bruggemann, “Human antibody expression in transgenic mice,” Archivum Immunologiae et Therapiae Experimentalis (2001) 49:203-208.
  Statement of Sean Stevens, PHD in EP 02709544.7, filed Aug. 7, 2009, 14 pages.
  U.S. Appl. No. 09/732,234, filed Dec. 7, 2000, 57 pages.
  U.S. Appl. No. 60/244,665, filed Oct. 31, 2000, 51 pages.
  Appendix 1: The claims of the patent, dated Jun. 12, 2013, 5 pages.
  List of evidence, dated Jun. 12, 2013, 2 pages.
  Opposition against EP 1360287, dated Jun. 12, 2013, 2 pages.
  Statement of facts and arguments, dated Jun. 12, 2013, 22 pages.
  Statement of facts and arguments against EP 1360287, dated Jun. 12, 2013, 40 pages.
  Acknowledgment of receipt for EP 1360287, dated Jun. 12, 2013, 2 pages.
  Acknowledgment of receipt for EP 1360287, dated Jun. 12, 2013, 3 pages.
  Submission in opposition proceedings in EP 1360287, dated Jun. 20, 2013, 2 pages.
  Brief communication in EP1360287, dated Jun. 20, 2013, 1 page.
  Smith et al., “Genomic analysis of transgenic animals,” Methods in Molecular Biology (1993) 18:323-327.
  Letter regarding the opposition procedure in EP 02709544.7, filed Jun. 14, 2013, 1 page.
  Acknowledgment of receipt for EP 1360287, dated Jun. 20, 2013, 2 pages.
  Communication of notices of opposition in EP 1360287, dated Jul. 18, 2013, 1 page.
  Communication of further notices of opposition pursuant to Rule 79(2) EPC in EP 1360287, dated Jul. 18, 2013, 1 page (Stephen, Robert John).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC in EP 1360287, dated Jul. 18, 2013, 1 page (EP&C).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Sep. 16, 2013, 1 page.
  Acknowledgment of receipt in EP 02709544.7, dated Sep. 16, 2013, 1 page.
  Request for extension of time limit in EP 02709544.7, dated Sep. 16, 2013, 1 page.
  Brief communication for EP 02709544.7, dated Sep. 17, 2013, 1 page (Stephen, Robert John).
  Brief communication for EP 02709544.7, dated Sep. 17, 2013, 1 page (EP&C).
  Grant of extension of time limit pursuant to Rule 132 EPC, dated Sep. 17, 2013, 1 page.
  Submission in opposition proceedings in EP 02709544.7, dated Oct. 11, 2013, 2 pages.
  Opposition proceedings for EP 1360287, dated Oct. 11, 2013, 1 page.
  Acknowledgment of receipt in EP 02709544.7, dated Oct. 11, 2013, 1 page.
  Brief communication for EP 02709544.7, dated Oct. 14, 2013, 1 page (Bentham, Andrew).
  Brief communication for EP 02709544.7, dated Oct. 14, 2013, 1 page (EP&C).
  Submission in opposition proceedings for EP 02709544.7, dated Jan. 28, 2014, 2 pages.
  Letter accompanying subsequently filed items in EP 02709544.7, dated Jan. 28, 2014, 2 pages.
  Brief communication for EP 02709544.7, dated Jan. 28, 2014, 1 page (Bentham, Andrew).
  Brief communication for EP 02709544.7, dated Jan. 28, 2014, 1 page (Stephen, Robert John).
  Bruggemann, “Human monoclonal antibodies from translocus mice,” Molecular Biology of B Cells (2004) Chapter 34 pp. 547-561.
  Honjo et al., “Molecular Biology of B Cells,” 1st Edition (2004) 1 page.
  Open Monoclonal Technology, Inc, “OmniRat, OmniMouse and OmniFlic, Natually optimized human antibodies,” (2013) 3 pages.
  Ma et al., “Human antibody expression in transgenic rats: Comparison of chimeric IgH loci with human VH, D and JN but bearing different rat C-gene regions,” J Immunol Methods (2013) 400-401:78-86.
  Green et al., “Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs,” Nature Genetics (1994) 7:13-21.
  Green et al., “Regulation of B cell development by variable gene complexity in mice reconstituted with human immunoglobulin yeast artificial chromosomes,” J Exp Med (1998) 188(3):483-495.
  Hansen, “Kymab: More mAb diversity,” BioCentury (2012) 2 pages.
  McCallister, “Still on the lookout,” (2013) 21(48) pp. A1 and A13.
  News in Brief , “Big Pharma vies for mice,” Nature Biotechnology (2007) 25(6):613-614.
  Nagle, “Regeneron helps make Sanofi VelocImmune to its “weak” pipeline,” (2007) Retrieved on http://www.outsourcing-pharma.com/Preclinical-Research/Regeneron-helps-make-Sanofi-VelocImmune-to-its-weak-pipeline. Retrieved on Oct. 11, 2013.
  “AstraZeneca licenses Regeneron's VelocImmune technology for discovering human monoclonal antibodies,” (2007) Retrieved on https://www.drugs.com/news/astrazeneca-licenses-regeneron-s-velocimmune-technology-discovering-human-monoclonal-antibodies-5221.html. Retrieved on Jan. 23, 2014.
  The Barnes Report, “A new target and technology have Regeneron's future looking bright,” (2007) 1(4):1-2.
  Business Wire, “Astellas licenses Regeneron's VelocImmune technology for discovering human monoclonal antibodies,” (2007) Retrieved on http://www.businesswire.com/news/home/20070329006182/en/Astellas-Licenses-Regenerons-Velocimmune-Technology-Discovering-Human. Retrieved on Dec. 16, 2016.
  Business Wire, “Regeneron and Columbia University enter into a strategic VelocImmune agreement to discover human monoclonal antibodies,” (2008) Retrieved on http://www.businesswire.com/news/home/20080916005336/en/Regeneron-Columbia-University-Enter-Strategic-VelocImmune-Agreement. Retrieved on Jan. 23, 2014.
  “Regeneron partners VelocImmune with University of Texas,” Elsevier Business Intelligence (2009) 1 page.
  Statement of Sue Klapholz, M.D., Ph.D, dated Jan. 27, 2014, 14 pages.
  Jakobovits, “Production of fully human antibodies by transgenic mice,” Current Opinion in Biotechnology (1995) 6:561-566.
  Glanville et al., “Niave antibody gene-segment frequencies are heritable and unaltered by chronic lymphocyte ablation,” PNAS (2011) 108(50):20066-20071.
  Tomizuka et al., “Double trans-chromosomic mice: Maintenance of two individual human chromosome fragments containing Ig heavy and κ loci and expression of fully human antibodies,” PNAS (2000) 97(2):722-727.
  Green, “Antibody engineering via genetic engineering of the mouse: XenoMouse strains are a vehicle for the facile generation of therapeutic human monoclonal antibodies,” Journal of Immunological Methods (1999) 231:11-23.
  Statement of Andrew Murphy, dated Jan. 27, 2014, 33 pages.
  First auxiliary request, dated Jan. 28, 2014, 8 pages.
  Second auxiliary request, dated Jan. 28, 2014, 8 pages.
  Amended claims (First auxiliary request), dated Jan. 28, 2014, 8 pages.
  Amended claims (Second auxiliary request), dated Jan. 28, 2014, 8 pages.
  Patentee's response to Oppositions in EP 1360287, dated Jan. 28, 2014, 1 page.
  Patentee's response to Opposition in EP 1360287, dated Jan. 28, 2014, 47 pages.
  Letter regarding Opposition proceedings in EP 1360287, dated Jan. 28, 2014, 1 page.
  Acknowledgment of receipt in EP 02709544.7, dated Jan. 28, 2014, 1 page.
  Acknowledgment of receipt in EP 02709544.7 by Andrew Bentham, dated Jan. 28, 2014, 2 pages.
  Brief Communication in EP 027099544.7, dated Jan. 29, 2014, 1 page (Stephen, Robert & John).
  Brief Communication in EP 027099544.7, dated Jan. 29, 2014, 1 page (EP&C).
  Submission in opposition proceedings in EP 02709544.7, dated Feb. 10, 2014, 2 pages.
  Tan et al., “A human-mouse chimeric immunoglobulin gene with a human variable region is expressed in mouse myeloma cell,” The Journal of Immunology (1985) 135(5):3564-3567.
  Kouskoff et al., “Cassette vectors directing expression of T cell receptor genes in transgenic mice,” J Immunological Methods (1995) 180:273-280.
  Fleischer et al., “Reactivity of mouse T-cell hybridomas expressing human Vbeta gene segments with staphylococcal and streptococcal superantigens,” Infect Immun (1996) 64(3):987.
  Vollmer et al., “Antigen contacts by Ni-reactive TCR: typical αβ chain cooperation versus α chain-dominated specificity,” International Immunology (2000) 12(12):1723-1731.
  Opposition against EP 1360287, dated Feb. 10, 2014, 6 pages.
  Acknowledgment of receipt in EP 02709544.7, dated Feb. 10, 2014, 2 pages.
  Brief Communication in EP 02709544.7, dated Feb. 11, 2014, 1 page (Bentham, Andrew).
  Brief Communication in EP 02709544.7, dated Feb. 13, 2014, 1 page (EP&C).
  Submission in opposition proceedings in EP 1360287, dated Feb. 11, 2014, 2 pages.
  Letter accompanying subsequently filed items in EP 02709544.7, dated Feb. 12, 2014, 1 page.
  Baker et al., “Adaptation of TCR expression vectors for the construction of mouse-human chimeric MBP-Specific TCR transgenes,” Journal of Neuroscience Research (1996) 45:487-491.
  Opposition against EP 1360287, dated Feb. 11, 2014, 1 page.
  Request for acceleration of the opposition procedure in EP 1360287, dated Feb. 12, 2014, 2 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 12, 2014, 2 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 12, 2014, 1 page (James Nicholls).
  Designation of inventor in EP 02709544.7, dated Feb. 24, 2014, 2 pages (Margaret Karow).
  Designation of inventor in EP 02709544.7, dated Feb. 24, 2014, 2 pages (Lynn Macdonald).
  Designation of inventor in EP 02709544.7, dated Feb. 24, 2014, 2 pages (Aris Economides).
  Designation of inventor in EP 02709544.7, dated Feb. 24, 2014, 2 pages (Sean Stevens).
  Designation of inventor in EP 02709544.7, dated Feb. 24, 2014, 2 pages (David Valenzuela).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Feb. 26, 2014, 1 page.
  Letter concerning the inventors in EP 02709544.7, dated Feb. 26, 2014, 1 page.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 26, 2014, 2 pages.
  Preparation for oral proceedings in EP 02709544.7, dated Feb. 18, 2014, 2 pages.
  Information concerning oral proceedings in EP 02709544.7, dated Apr. 30, 2014, 3 pages.
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Feb. 28, 2014, 1 page (Stephen, Robert John).
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Feb. 28, 2014, 1 page (EP&C).
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Feb. 28, 2014, 1 page (Bentham, Andrew).
  Facts and Submissions in EP 02709544.7, dated Feb. 28, 2014, 7 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 28, 2014, 1 page (Stephen, Robert John).
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 28, 2014, 1 page (Andrew Bentham).
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 28, 2014, 1 page (EP&C).
  Notification of the data mentioned in Rule 19(3) EPC in EP 02709544.7, dated Mar. 5, 2014, 1 page (Sean Stevens).
  Notification of the data mentioned in Rule 19(3) EPC in EP 02709544.7, dated Mar. 5, 2014, 1 page (Margaret Karow).
  Notification of the data mentioned in Rule 19(3) EPC in EP 02709544.7, dated Mar. 5, 2014, 1 page (David Valenzuela).
  Notification of the data mentioned in Rule 19(3) EPC in EP 02709544.7, dated Mar. 5, 2014, 1 page (Lynn Macdonald).
  Notification of the data mentioned in Rule 19(3) EPC in EP 02709544.7, dated Mar. 5, 2014, 1 page (Aris Economides).
  Bibliographical data of European patent application No. 02709544.7, dated Feb. 28, 2014, 1 page.
  Brief Communication in EP 02709544.7, dated Mar. 5, 2014, 1 page (Stephens, Robert John).
  Brief Communication in EP 02709544.7, dated Mar. 5, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Mar. 5, 2014, 1 page (Andrew Bentham).
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Feb. 28, 2014, 1 page (Stephen, Robert John).
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Feb. 28, 2014, 1 page (EPC).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Mar. 10, 2014, 1 page.
  Letter concerning inventor's name in EP 02709544.7, dated Mar. 10, 2014,1 page.
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 10, 2014, 1 page.
  Bibliographical data of European patent application No. 02709544.7, dated Mar. 11, 2014, 1 page.
  Brief Communication in EP 02709544.7, dated Mar. 14, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Mar. 14, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Mar. 14, 2014, 1 page (Stephens, Robert John).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Mar. 18, 2014, 1 page.
  Letter concerning inventor's address in EP 02709544.7, dated Mar. 18, 2014, 1 page.
  Advice of delivery in EP 02709544.7, dated Feb. 28, 2014, 2 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 18, 2014, 1 page.
  Bibliographical data of European patent application No. 02709544.7, dated Mar. 19, 2014, 1 page.
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Feb. 28, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Mar. 24, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Mar. 24, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Mar. 24, 2014, 1 page (EPC).
  Notice of Opposition to a European patent in EP 02709544.7, dated Apr. 3, 2014, 4 pages.
  Cover sheet for fax transmission in EP 02709544.7, dated Apr. 3, 2014, 1 page.
  Online fee payment in EP 02709544.7, dated Apr. 2, 2014, 1 page.
  Notice of Intervention by Novo Nordisk in EP 02709544.7, dated Apr. 3, 2014, 13 pages.
  Particulars of Infringement in EP 02709544.7, dated Apr. 3, 2014, 8 pages.
  Soukharev et al., “Segmental genomic replacement in embryonic stem cells by double lox targeting,” (1999) 27(18):e21.
  Letter regarding Notice of Intervention in EP 02709544.7, dated Apr. 3, 2014, 1 page.
  Notice of opposition to a European patent in EP 02709544.7, dated Apr. 4, 2014, 4 pages.
  Brief Communication in EP 02709544.7, dated Apr. 10, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Apr. 10, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Apr. 10, 2014, 1 page (EP&C).
  Maintenance of oral proceedings in EP 02709544.7, dated Apr. 7, 2014, 2 pages.
  Brief Communication in EP 02709544.7, dated Apr. 22, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Apr. 22, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Apr. 22, 2014, 1 page (Andrew Bentham).
  Preparation for oral proceedings in EP 02709544.7, dated Apr. 17, 2014, 2 pages.
  Information concerning oral proceedings in EP 02709544.7, dated Jul. 16, 2014, 3 pages.
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Apr. 24, 2014, 1 page (Stephen, Robert John).
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Apr. 24, 2014, 1 page (EP&C).
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Apr. 24, 2014, 1 page (Bentham, Andrew).
  Summons to attend oral proceedings pursuant to Rule 115(1) in EP 02709544.7, dated Apr. 24, 2014, 1 page (Thomas, Philip John Duval).
  Facts and Submissions in EP 02709544.7, dated Apr. 24, 2014, 3 pages.
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Apr. 24, 2014, 1 page (Andrew Bentham).
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Apr. 24, 2014, 1 page (Stephen, Robert John).
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Apr. 24, 2014, 1 page (EP&C).
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated Apr. 24, 2014, 1 page (Thomas, Philip John Duval).
  Advice of delivery in EP 02709544.7, dated Apr. 24, 2014, 2 pages (Thomas, Philip John Duval).
  Letter accompanying subsequently filed items in EP 02709544.7, dated May 2, 2014, 1 page.
  Acknowledgement of receipt of the document 2310 in EP 02709544.7, dated May 2, 2014, 1 page.
  Opposition to EP 1360287, dated Jul. 15, 2014, 3 pages.
  Authorisation of representative in EP 1360287, dated Jul. 15, 2014, 1 page.
  Letter accompanying subsequently filed items in EP 02709544.7, dated Jul. 16, 2014, 1 page.
  First auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Second auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Third auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Fourth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Fifth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Sixth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Seventh auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Eighth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Ninth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Tenth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Eleventh auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Twelfth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Thirteenth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  Fourteenth auxiliary request in EP 1360287, dated Jul. 16, 2014, 7 pages.
  McMurry et al., “Enhancer control of local accessibility to V(D)J recombinase,” Molecular and Cellular Biology (1997) 17(8):4553-4561.
  Johnston et al., “Complete sequence assembly and characterization of the C57BL/6 mouse Ig heavy chain V region,” J Immunol (2006) 176:4221-4234.
  Xu et al., “Deletion of the Igκ light chain intronic enhancer/matrix attachment region impaires but does not abolish VκJκ Rearrangement,” Immunity (1996) 4:377-385.
  Meier et al., “Short DNA sequences inserted for gene targeting can accidentally interfere with off-target gene expression,” The FASEB Journal (2010) 24:1714-1724.
  Ren et al., “Targeted insertion results in a rhombomere 2-specific Hoxa2 knockdown and ectopic activation of Hoxa1 expression,” Developmental Dynamics (2002) 225:305-315.
  Tucker et al., “Mouse IgA heavy chain gene sequence: Implications for evolution of immunoglobulin hinge exons,” Proc Natl Acad Sci USA (1981) 78(12):7684-7688.
  Blankenstein et al., “Immunoglobulin VH region genes of the mouse are organized in overlapping clusters,” Eur. J. Immunol. 1987.17: 1351-1357.
  Rathbun et al., “Organization and expression of the mammalian heavy-chain variable-region locus,” (1989) Chapter 4, 9 pages.
  Amended claims (First auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Second auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Third auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Fourth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Fifth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Sixth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Seventh auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Eighth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Ninth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Tenth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Eleventh auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Twelfth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Thirteenth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Amended claims (Fourteenth auxiliary request), dated Jul. 16, 2014, 8 pages.
  Witness statement of Nicole Helen Dagg, dated Jan. 31, 2014, 5 pages.
  Office action (third-party submission), dated Apr. 3, 2014, 17 pages.
  Statement of Victor L J Tybulewicz, dated Jul. 15, 2014, 26 pages.
  Statement of Daniel J. Capon, dated Jul. 7, 2014, 4 pages.
  Documents list (D78-D107), dated Jul. 16, 2014, 1 page.
  Curriculum Vitae Hidde L. Ploegh, dated Jul. 16, 2014, 33 pages.
  Statement of Craig H. Bassing, dated Jul. 16, 2014, 34 pages.
  Document 89, dated Jul. 16, 2014, 1 page.
  Document 93 (ANNEX—MOA), dated Jul. 16, 2014, 6 pages.
  Document 95a (Statement of Prof. Dr. Hendriks), dated Jul. 16, 2014, 21 pages.
  Curriculum Vitae Prof. Dr. Rudi W. Hendriks, dated Jul. 16, 2014, 24 pages.
  Response to substantive Examination Report in EP 02709544.7, dated Dec. 22, 2008, 6 pages.
  D80 (Examination in EP 02709544.7), dated Jul. 16, 2014, 2 pages.
  Kingzette et al., “Trans-chromosomal recombination within the Ig heavy chain switch region in B lymphocytes,” Proc Natl Acad Sci USA (1998) 95:11840-11845.
  Karu et al., “Recombinant antibody technology,” ILAR Journal (1995) 37(3):132-141.
  Giusti et al., “Hypermutation is observed only in antibody H chain V region transgenes that have recombined with endogenous immunoglobulin H DNA: Implications for the location of cis-acting elements required for somatic mutation,” J Exp Med (1993) 177:797-809.
  Bruggemann et al., “The immunogenicity of chimeric antibodies,” J Exp Med (1989) 170:2153-2157.
  Seidl et al., “Position-dependent inhibition of class-switch recombination by PGK-neor cassettes inserted into the immunoglobulin heavy chain constant region locus,” Proc. Natl. Acad. Sci. USA (1999) 96:3000-3005.
  Jakobovits, “The long-awaited magic bullets: therapeutic human monoclonal antibodies from transgenic mice,” Exp Opin Invest Drugs (1998) 7(4):607-614.
  Jakobovits et al., “From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice,” Nature Biotechnology (2007) 25(10):1134-1143.
  Gavilondo et al., “Antibody engineering at the millennium,” BioTechniques (2000) 29:128-145.
  Clark, “IgG effector mechanisms,” Chem Immunol Basel Karger (1997) 65:88-110.
  Yang et al., “Homologous recombination based modification in Esherichia coli and germline transmission in transgenic mice of a bacterial artificial chromosome,” Nature Biotechnology (1997) 15:859-865.
  Thomas et al., “Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells,” Cell (1987) 51:503-512.
  Spanopoulou et al., “Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1-deficient mice,” Genes & Development (1994) 8:1030-1042.
  Monaco et al., “YACs, BACs, PACs and MACs: artificial chromosomes as research tools,” TIB Tech (1994) 12:280-286.
  Giraldo et al., “Size matters: use of YACs, BACs and PACs in transgenic animals,” Transgenic Research (2001) 10:83-103.
  Clark,“Antibody humanization: a case of the ‘Emperor's new clothes’?” Immunology Today (2000) 21(8):397-402.
  D82 (Summary of product characteristics), dated Jul. 16, 2014, 39 pages.
  D83 (Summary of product characteristics), dated Jul. 16, 2014, 29 pages.
  D84 (Summary of product characteristics), dated Jul. 16, 2014, 63 pages.
  Muller et al., “Ten years of gene targeting: targeted mouse mutants, from vector design to phenotype analysis,” Mechanisms of Development (1999) 82:3-21.
  D86 (Gene Targeting), dated Jul. 16, 2014, 98 pages.
  D78 (Datasheet for the decision of the Enlarged Board of Appeal of Apr. 6, 2009 for EP 94115175.5), dated Jul. 16, 2014, 25 pages.
  U.S. Appl. No. 09/784,859, filed Feb. 16, 2001, 69 pages.
  D91 (Datasheet for the decision of Sep. 12, 2012), dated Jul. 16, 2014, 28 pages.
  D92 (European patent specification for EP 1 399 575), dated Jul. 16, 2014, 26 pages.
  Opposition against EP 1360287, dated Jul. 16, 2014, 34 pages.
  Letter regarding references part 1 dated Jul. 16, 2014, 1 page.
  Letter regarding references part 2, dated Jul. 16, 2014, 1 page.
  Letter regarding references part 3, dated Jul. 16, 2014, 1 page.
  Submission in opposition proceedings in EP 1360287, dated Jul. 16, 2014, 2 pages (Olswang).
  Submission in opposition proceedings in EP 1360287, dated Jul. 16, 2014, 2 pages (EPC).
  Letter regarding Merus' written submission, dated Jul. 16, 2014, 2 pages, 2 pages.
  The alleged invention, dated Jul. 16, 2016, 79 pages.
  Response to the Summons to oral proceedings, dated Jul. 16, 2014, 24 pages.
  Acknowledgement of receipt in EP 1360287, dated Jul. 16, 2014, 2 pages (Jane Hollywood).
  Acknowledgement of receipt in EP 1360287, dated Jul. 16, 2014, 2 pages (Groeneveld).
  Acknowledgement of receipt in EP 1360287, dated Jul. 16, 2014, 3 pages (Andrew Bentham).
  Joyner, “Gene targeting”, dated Jul. 17, 2014, 196 pages.
  Letter regarding references part 4, dated Jul. 17, 2014, 1 page.
  Letter regarding refereneces part 5, dated Jul. 17, 2014, 1 page.
  Brief communication in EP 02709544.7, dated Jul. 21, 2014, 1 page (Andrew Bentham).
  Brief communication in EP 02709544.7, dated Jul. 21, 2014, 1 page (Stephen, Robert John).
  Brief communication in EP 02709544.7, dated Jul. 21, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7 (Letter from the opponent 01 of Jul. 16, 2014 with non patent literature only), dated Jul. 21, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Jul. 25, 2014, 1 page (Thomas, Philip John Duval).
  Brief Communication in EP 02709544.7, dated Jul. 25, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Jul. 25, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Jul. 28, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Jul. 28, 2014, 1 page (Thomas, Philip John Duval).
  Brief Communication in EP 02709544.7, dated Jul. 28, 2014, 1 page (Stephen, Robert John).
  Submission in opposition proceedings in EP 1360287, dated Aug. 12, 2014, 2 pages.
  Consolidated document list for EP 1360287, dated Aug. 12, 2014, 11 pages.
  Letter regarding consolidated document list for EP 1360287, dated Aug. 12, 2014, 1 page.
  Acknowledgement of receipt for EP 1360287, dated Aug. 12, 2014, 2 pages.
  Brief Communication in EP 02709544.7, dated Aug. 19, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Aug. 19, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Aug. 19, 2014, 1 page (Thomas, Philip John Duval).
  Authorisation in EP 1360287, dated Aug. 12, 2014, 1 page.
  Submission in opposition proceedings in EP 1360287, dated Aug. 20, 2014, 2 pages.
  Acknowledgement of receipt for EP 1360287, dated Aug. 20, 2014, 1 page (Jane Hollywood).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Aug. 22, 2014, 1 page.
  Murphy et al., “Mice with megabase humanization of their immunoglobulin genes generate antibodies as efficiently as normal mice,” PNAS (2014) 111(14):5153-5158.
  MacDonald et al., “Precise and in situ genetic humanization of 6 Mb of mouse immunoglobulin genes,” 111(14):5147-5152.
  Letter with scientific publications, dated Aug. 22, 2014, 2 pages (Olswang).
  Acknowledgement of receipt for EP 1360287, dated Aug. 22, 2014, 1 page (Jane Hollywood).
  Brief Communication in EP 02709544.7, dated Aug. 28, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Aug. 28, 2014, 1 page (Thomas, Philip John Duval).
  Brief Communication in EP 02709544.7, dated Aug. 28, 2014, 1 page (Andrew Bentham).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Sep. 2, 2014, 1 page.
  Submission in opposition proceedings in EP 1360287, dated Sep. 2, 2014, 2 pages.
  Practising Certificate (Dr James Richard Cleland Whyte), dated Apr. 1, 2014, 1 page.
  Letter regarding practicing certificate, dated Sep. 2, 2014, 1 page.
  Wuerffel et al., “S-S synapsis during class switch recombination is promoted by distantly located transcriptional elements and activation-induced deaminase,” Immunity (2007) 27:711-722.
  Seidl et al., “An expressed neor cassette provides required functions of the ly2b exon for class switching,” International Immunology (1998) 10(11):1683-1692.
  Kenter et al., “Three-dimensional architecture of the IgH locus facilitates class switch recombination,” Ann N.Y. Acad Sci (2012) 1267:86-94.
  Kitamura et al., “A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin μ chain gene,” Nature (1991) 350:423-426.
  Scapini et al., “Myeloid cells, BAFF, and IFN-γ, establish an inflammatory loop that exacerbates autoimmunity in Lyn-deficient mice,” J Exp Med (2010) 207(8):1757-1773.
  Geuijen, “Full length human IgG bispecific antibodies for cancer therapy,” Merus-RABs and Bispecific Antibodies (2013) 33 pages.
  Merus, “MeMo—the ingenious mouse for improved antibody therapeutics,” Retrieved on Oct. 2011. Retrieved on www.merus.nl.
  Merus, “MeMo transgenic mouse for improved antibody therapeutics,” Retrieved on Sep. 2012. Retrieved on www.merus.nl.
  Lee et al., “Complete humanization of the mouse immunoglobulin loci enables efficient therapeutic antibody discovery,” Nature Biotechnology (2014) 32:356-363.
  Second statement of Craig H. Bassing Ph.D., dated Sep. 2, 2014, 5 pages.
  Written submissions in response to the summons to attend oral proceedings, dated Apr. 23, 2013, 24 pages.
  Statement of Prof. Dr. Anthony Defranco, dated Sep. 2, 2014, 19 pages.
  Letter regarding submissions made by opponents, dated Sep. 2, 2014, 8 pages.
  Acknowledgement of receipt for EP 1360287, dated Sep. 2, 2014, 1 page (Jane Hollywood).
  Acknowledgement of receipt for EP 1360287, dated Sep. 2, 2014, 1 page (Andrew Bentham).
  Submission in opposition proceedings, dated Sep. 5, 2014, 2 pages.
  Consolidated documents list for EP 1360287, dated Sep. 3, 2014, 12 pages.
  Letter regarding consolidated documents, dated Sep. 5, 2014, 1 page.
  Acknowledgement of receipt for EP 1360287, dated Sep. 5, 2014, 2 pages.
  Brief Communication in EP 02709544.7, dated Sep. 8, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Sep. 8, 2014, 1 page (Thomas, Philip John Duval).
  Brief Communication in EP 02709544.7, dated Sep. 8, 2014, 1 page (EP&C).
  Submission in opposition proceedings, dated Sep. 9, 2014, 2 pages.
  Practising Certificate (Justin John Turner QC), dated Apr. 1, 2014, 1 page.
  Letter regarding practicing certificate, dated Sep. 9, 2014, 1 page.
  Acknowledgement of receipt for EP 1360287, dated Sep. 9, 2014, 2 pages.
  Brief Communication in EP 02709544.7, dated Sep. 10, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Sep. 10, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Sep. 10, 2014, 1 page (Thomas, Philip John Duval).
  Letter accompanying subsequently filed items in EP 02709544.7, dated Sep. 11, 2014, 1 page.
  Letter regarding attending oral proceedings, dated Sep. 11, 2014, 1 page.
  Acknowledgement of receipt for EP 1360287, dated Sep. 11, 2014, 1 page.
  Letter accompanying subsequently filed items in EP 02709544.7, dated Sep. 12, 2014, 1 page.
  Brief Communication in EP 02709544.7, dated Sep. 15, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Sep. 15, 2014, 1 page (EP&C).
  Brief Communication in EP 02709544.7, dated Sep. 15, 2014, 1 page (Thomas, Philip John Duval).
  Brief Communication in EP 02709544.7, dated Sep. 18, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Sep. 18, 2014, 1 page (Bentham, Andrew).
  Brief Communication in EP 02709544.7, dated Sep. 18, 2014, 1 page (Thomas, Philip John Duval).
  Letter regarding Opposition proceedings, dated Sep. 15, 2014, 2 pages.
  Acknowledgement of receipt for EP 1360287, dated Sep. 15, 2014, 1 page.
  Information regarding oral proceedings, dated Sep. 18, 2014, 1 page.
  Brief Communication in EP 02709544.7, dated Sep. 17, 2014, 1 page (Stephen, Robert John).
  Brief Communication in EP 02709544.7, dated Sep. 17, 2014, 1 page (Andrew Bentham).
  Brief Communication in EP 02709544.7, dated Sep. 17, 2014, 1 page (Thomas, Philip John Duval).
  Letter regarding Notice of Appeal, dated Sep. 18, 2014, 2 pages.
  Payment of fees and costs, dated Sep. 18, 2014, 1 page.
  Communication for EP 02709544.7, dated Nov. 28, 2014,1 page.
  Provision of the minutes in accordance with Rule 124(4) EPC, dated Nov. 28, 2014, 1 page.
  Minutes of the oral proceedings before the opposition division, dated Nov. 28, 2014, 1 page.
  Minutes of the oral proceedings before the opposition division sheet 2, dated Nov. 28, 2014, 1 page.
  Decision revoking the European Patent (Art 101(3)(b) EPC), dated Nov. 28, 2014, 2 pages.
  Revocation of the European Patent (Art 101(3)(b) EPC), dated Nov. 21, 2014, 1 page.
  Appeal against the decision, dated Nov. 28, 2014, 2 pages.
  Annex to the communication in EP 02709544.7, dated Nov. 28, 2014, 17 pages.
  Facts and submissions in EP 02709544.7, dated Nov. 28, 2014, 25 pages.
  Acknowledgement of receipt of the document 2331 in EP 02709544.7, dated Nov. 28, 2014, 1 page (Thomas, Philip John Duval).
  Acknowledgement of receipt of the document 2331 in EP 02709544.7, dated Nov. 28, 2014, 1 page (EP&C).
  Acknowledgement of receipt of the document 2331 in EP 02709544.7, dated Nov. 28, 2014, 1 page (Andrew Bentham).
  Acknowledgement of receipt of the document 2331 in EP 02709544.7, dated Nov. 28, 2014, 1 page (Stephen, Robert John).
  New sixth auxiliary request, dated Sep. 17, 2014, 11 pages.
  New sixth auxiliary request (Annex), dated Sep. 17, 2014, 12 pages.
  Advice of payment in EP 02709544.7, dated Apr. 12, 2014, 2 pages.
  Letter accompanying subsequently filed items, dated Dec. 9, 2014, 1 page.
  Acknowledgement of receipt for EP 1360287, dated Dec. 9, 2014, 1 page.
  Commencement of proceedings before the Board of Appeal, dated Dec. 10, 2014, 4 pages.
  Advice of payment in EP 02709544.7, dated Mar. 12, 2014, 2 pages (EP&C).
  Appeal order for T2220/14-3.3.08, dated Dec. 12, 2014, 1 page.
  Letter accompanying subsequently filed items, dated Dec. 23, 2016, 1 page.
  Trial for 2015 from the Patents Court, dated Dec. 18, 2014, 15 pages.
  Request for accelerated processing, dated Dec. 23, 2014, 5 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Dec. 9, 2014, 1 page.
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 9, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 9, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 9, 2015, 1 page (EP&C).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 20, 2015, 1 page (Andrew Bentham).
  Letter accompanying subsequently filed items, dated Jan. 22, 2015, 1 page (Andrew Bentham).
  Letter accompanying subsequently filed items, dated Jan. 22, 2015, 1 page (Jane Hollywood).
  Letter in response to Communication, dated Jan. 22, 2015, 1 page (Andrew Bentham).
  Letter in response to Communication from the Board of Appeal, dated Jan. 22, 2015, 1 page (Robert Stephen).
  Acknowledgement of receipt in EP 02709544.7, dated Jan. 22, 2015, 1 page (Andrew Bentham).
  Acknowledgement of receipt in EP 02709544.7, dated Jan. 22, 2015, 1 page (Jane Hollywood).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 23, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Jan. 23, 2015, 1 page (Andrew Bentham).
  Letter accompanying subsequently filed items, dated Jan. 30, 2015, 1 page (Andrew Bentham).
  Letter accompanying subsequently filed items, dated Jan. 30, 2015, 1 page (Robert Stephen).
  Explanation regarding documents disclosed in proceedings, dated Jan. 29, 2015, 2 pages.
  Letter regarding acceleration of appeal proceedings, dated Jan. 30, 2015, 2 pages (EP&C).
  Letter in response to the communication, dated Jan. 30, 2015, 2 pages (Robert Stephen).
  Letter in response to the communication, dated Jan. 30, 2015, 2 pages (Philip Thomas).
  Submission in opposition proceedings, dated Jan. 30, 2015, 2 pages (Philip Thomas).
  Acknowledgement of receipt in EP 02709544.7, dated Jan. 30, 2015, 1 page (Olivier Brake).
  Acknowledgement of receipt in EP 02709544.7, dated Jan. 30, 2015, 1 page (Stephen).
  Acknowledgement of receipt in EP 02709544.7, dated Jan. 30, 2015, 1 page (Helen Stanbrook).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 5, 2015, 3 pages.
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 5, 2015, 3 pages (with EP&C).
  Letter accompanying subsequently filed items, dated Feb. 9, 2015, 1 page (Andrew Bentham).
  Letter regarding acceleration of the proceedings, dated Feb. 9, 2015, 6 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 9, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 13, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 13, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 13, 2015, 1 page (EP&C).
  Letter accompanying subsequently filed items, dated Feb. 15, 2015, 3 pages (Andrew Bentham).
  Consolidated document list (D1-D155), dated Sep. 12, 2014, 12 pages.
  Reichert, “Monoclonal antibodies in the clinic,” Nature Biotechnology (2001) 19:819-822.
  Jones et al., “Replacing the complementarity-determining regions in a human antibody with those from a mouse,” Nature (1986) 321:522-525.
  Hurle et al., “Protein engineering techniques for antibody humanization,” Current Opinion in Biotechnology (1994) 5:428-433.
  Xu et al., “Diversity in the CDR3 region of VH is sufficient for most antibody specificities,” Immunity (2000) 13:37-45.
  Figini et al., “Panning phage antibody libraries on cells: isolation of human fab fragments against ovarian carcinoma using guided selection,” Cancer Research (1998) 58:991-996.
  Mortuza et al., “Immunoglobulin heavy-chain gene rearrangement in adult acute lymphoblastic leukemia reveals preferential usage of JH-proximal variable gene segments,” Blood (2001) 97(9):2716-2726.
  Fujieda et al., “Multiple types of chimeric germ-line Ig heavy chain transcript in human B cells: evidence for trans-splicing of human Ig RNA ,” J Immunol (1996) 157(8):3450-3459.
  Shimizu et al., “Trans-splicing as a possible molecular mechanism for the multiple isotype expression of the immunoglobulin gene,” J. Exp. Med (1991) 173:1385-1393.
  Yancopoulos et al., “Preferential utilization of the most JH-proximal VH gene segments in pre-B-cell lines,” Nature (1984) 311:727-733.
  Letter regarding grounds of Appeal, dated Feb. 15, 2015, 41 pages.
  Main Request, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 1, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 2, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 3, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 4, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 5, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 6, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 7, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 8, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 9, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 10, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 11, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 12, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 13, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 14, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 15, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 16, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 17, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 18, dated Feb. 15, 2015, 6 pages.
  Auxiliary Request 19, dated Feb. 15, 2015, 4 pages.
  Auxiliary Request 20, dated Feb. 15, 2015, 5 pages.
  Auxiliary Request 21, dated Feb. 15, 2015, 5 pages.
  Amended claims (main request), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 1), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 2), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 3), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 4), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 5), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 6), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 7), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 8), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 9), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 10), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 11), dated Feb. 15, 2015, 8 pages.
  Amended claims (Auxiliary request 12), dated Feb. 15, 2015, 12 pages.
  Amended claims (Auxiliary request 13), dated Feb. 15, 2015, 13 pages.
  Amended claims (Auxiliary request 14), dated Feb. 15, 2015, 11 pages.
  Amended claims (Auxiliary request 15), dated Feb. 15, 2015, 12 pages.
  Amended claims (Auxiliary request 16), dated Feb. 15, 2015, 12 pages.
  Amended claims (Auxiliary request 17), dated Feb. 15, 2015, 12 pages.
  Amended claims (Auxiliary request 18), dated Feb. 15, 2015, 13 pages.
  Amended claims (Auxiliary request 19), dated Feb. 15, 2015, 11 pages.
  Amended claims (Auxiliary request 20), dated Feb. 15, 2015, 11pages.
  Amended claims (Auxiliary request 21), dated Feb. 15, 2015, 8 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 15, 2015, 1 page (James Nicholls).
  Letter accompanying subsequently filed items, dated Feb. 20, 2015, 1 page (Jane Hollywood).
  Letter accompanying subsequently filed items, dated Feb. 20, 2015, 1 page (EP&C).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 20, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 20, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 20, 2015, 1 page (EP&C).
  Letter regarding prior art documents, dated Feb. 20, 2015, 2 pages (Robert Stephen).
  Letter regarding representation of Merus, dated Feb. 20, 2015, 1 page.
  Letter regarding representation of Merus, dated Feb. 20, 2015, 3 pages (Raphael Bosl).
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 20, 2015, 1 page (Jane Hollywood).
  Acknowledgement of receipt in EP 02709544.7, dated Feb. 20, 2015, 1 page (Olivier Ter Brake).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 24, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 24, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08, dated Feb. 25, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Feb. 26, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Feb. 26, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Feb. 26, 2015, 1 page (EP&C).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Feb. 26, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Feb. 26, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Feb. 26, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (form 3575), dated Feb. 26, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (form 3575), dated Feb. 26, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (form 3575), dated Feb. 26, 2015, 1 page (Stephen, Robert John).
  Communication of amended entries for T2220/14-3.3.08, dated Feb. 26, 2015, 1 page (Fritz Lahrtz).
  Letter accompanying subsequently filed items, dated Mar. 2, 2015, 1 page (Fritz Lahrtz).
  Letter accompanying subsequently filed items, dated Mar. 2, 2015, 1 page (Andrew Bentham).
  Communication of the Board of Appeal for T2220/14-3.3.08, dated Mar. 2, 2015, 10 pages (Andrew Bentham).
  Further to the Communication of the Board of Appeal, dated Mar. 2, 2015, 1 page (Fritz Lahrtz).
  Letter regarding communication, dated Mar. 2, 2015, 1 page (Andrew Bentham).
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 2, 2015, 1 page (Verena Behre).
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 2, 2015, 1 page (Andrew Bentham).
  Letter confirming proposed dates, dated Mar. 4, 2015, 2 pages (Philip Thomas).
  Letter accompanying subsequently filed items, dated Mar. 9, 2015, 1 page (Robert Stephen).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 9, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 9, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 9, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Mar. 9, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Mar. 9, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Mar. 9, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Mar. 9, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Mar. 9, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Mar. 9, 2015, 1 page (Stephen, Robert John).
  Letter in response to the EPO communication, dated Mar. 9, 2015, 1 page (Robert Stephen).
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 9, 2015, 1 page (Stephen).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Mar. 16, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Mar. 16, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Mar. 16, 2015, 1 page (Fritz Lahrtz).
  Authorisation for EP02709544.7, dated Mar. 8, 2015, 1 page.
  Letter regarding power of attorney, dated Mar. 19, 2015, 1 page.
  Letter accompanying subsequently filed items, dated Mar. 26, 2015, 2 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 26, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 26, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Mar. 26, 2015, 1 page (Stephen, Robert John).
  Letter regarding typographical errors, dated Mar. 26, 2015, 2 pages.
  Auxiliary Request 15, dated Mar. 26, 2015, 5 pages.
  Auxiliary Request 11, dated Mar. 26, 2015, 5 pages.
  Auxiliary Request 10, dated Mar. 26, 2015, 5 pages.
  Auxiliary Request 6, dated Mar. 26, 2015, 5 pages.
  Auxiliary Request 1, dated Mar. 26, 2015, 5 pages.
  Amend claims (Auxiliary Request 1), dated Mar. 26, 2015, 8 pages.
  Amend claims (Auxiliary Request 6), dated Mar. 26, 2015, 8 pages.
  Amend claims (Auxiliary Request 10), dated Mar. 26, 2015, 8 pages.
  Amend claims (Auxiliary Request 11), dated Mar. 26, 2015, 8 pages.
  Amend claims (Auxiliary Request 15), dated Mar. 26, 2015, 8 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 26, 2015, 2 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Apr. 1, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Apr. 1, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Apr. 1, 2015, 1 page (Fritz Lahrtz).
  Letter accompanying subsequently filed items, dated Jul. 2, 2015, 2 pages (Robert Stephen).
  Rule 80 EPC document, dated Jul. 2, 2015, 8 pages.
  Submission in response to EPO communication, dated Mar. 23, 2015, 3 pages.
  Response to the examination report, dated Apr. 2, 2015, 7 pages (Andrew Bentham).
  Opinion & Order, dated Nov. 21, 2014, 59 pages.
  Document regarding lack of sufficiency, dated Jul. 2, 2015, 1 page.
  Document regarding application documents in application 11728509.8, dated Mar. 4, 2015, 6 pages.
  Document regarding application documents in application 10010741.6, dated May 30, 2014, 2 pages.
  Submission in response to the third party observations, dated Jul. 1, 2014, 5 pages.
  Letter regarding response to application, dated Jun. 23, 2015, 4 pages.
  Bruggemann, “The preparation of human antibodies from mice harbouring human immunoglobulin loci,” Transgenic animals: generation and use (1997) pp. 397-402.
  Dougier et al., “Interallelic class switch recombination can reverse allelic exclusion and allow trans-complementation of an IgH locus switching defect,” Eur J Immunol (2006) 36:2181-2191.
  Gerstein et al., “Isotype switching of an immunoglobulin heavy chain transgene occurs by DNA recombination between different chromosomes,” Cell (1990) 63:537-548.
  Decision of technical board of appeal, dated Feb. 3, 2015, 21 pages.
  Letter regarding grounds of appeal, dated Jul. 2, 2015, 1 page (Robert Stephen).
  Acknowledgement of receipt in EP 02709544.7, dated Jul. 2, 2015, 2 pages.
  Request and admissibility, dated Jul. 2, 2015, 64 pages.
  Letter regarding a response to the grounds of appeal, dated Jul. 2, 2015, 19 pages (Philip Thomas).
  Letter in response to Patentee's grounds of appeal, dated Jul. 2, 2015, 85 pages (Fritz Lahrtz).
  Letter in response to Patentee's grounds of appeal, dated Jul. 2, 2015, 44 pages (Philip Thomas).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Jul. 8, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Jul. 8, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Jul. 8, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Jul. 8, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Jul. 8, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3), dated Jul. 8, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Jul. 9, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Jul. 9, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Jul. 9, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Jul. 14, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Jul. 14, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Jul. 14, 2015, 1 page (Stephen, Robert John).
  Letter accompanying subsequently filed items, dated Aug. 3, 2015, 1 page (Andrew Bentham).
  Consolidated document list for appeal (D1-D168), dated Aug. 3, 2015, 14 pages.
  Letter in response to grounds of appeal, dated Aug. 3, 2015, 1 page.
  Acknowledgement of receipt in EP 02709544.7, dated Aug. 3, 2015, 1 page.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Aug. 7, 2015, 1 page (Stephen, Robert John ).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Aug. 7, 2015, 1 page (Thomas, Philip John Duval).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Aug. 7, 2015, 1 page (Fritz Lahrtz).
  Document regarding oral proceedings, dated Aug. 13, 2015, 1 page.
  Summons to oral proceedings pursuant to Rule 115(1) EPC, dated Aug. 14, 2015, 26 pages.
  Acknowledgement of receipt of the document 3011, dated Aug. 17, 2015, 1 page (Fritz Lahrtz).
  Tracking information, dated Aug. 17, 2015, 1 page.
  Letter regarding transfer of all cases, dated Aug. 20, 2015, 2 pages.
  Advice of delivery, dated Aug. 24, 2015, 2 pages (Thomas).
  Letter accompanying subsequently filed items, dated Aug. 27, 2015, 1 page.
  Acknowledgement of receipt of the document 3011, dated Aug. 14, 2015, 1 page.
  Acknowledgement of receipt in EP 02709544.7, dated Aug. 27, 2015, 1 page.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Board's communication), dated Aug. 31, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3 and Board's communication), dated Aug. 31, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 3 and Board's communication), dated Aug. 31, 2015, 1 page (Stephen, Robert John).
  Acknowledgement of receipt of the document 3011, dated Aug. 14, 2015, 1 page (Stephen, Robert John).
  Letter in relation to appeal proceedings, dated Sep. 8, 2015, 4 pages.
  Velocimmune history narrative—from Drew's memory, dated Sep. 8, 2015, 6 pages.
  Letter in relation to Appeal proceedings, dated Sep. 16, 2015, 2 pages.
  Letter regarding representative of opponent 1, dated Sep. 21, 2015, 1 page.
  Communication of the Board of Appeal, dated Sep. 22, 2015, 1 page (Andrew Bentham).
  Communication of the Board of Appeal, dated Sep. 22, 2015, 1 page (Potter Clarkson LLP).
  Communication of the Board of Appeal, dated Sep. 22, 2015, 1 page (Fritz Lahrtz).
  Communication of the Board of Appeal, dated Sep. 22, 2015, 1 page (Stephen, Robert John).
  Letter accompanying subsequently filed items, dated Sep. 25, 2015, 2 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Sep. 25, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Sep. 25, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Sep. 25, 2015, 1 page (Stephen, Robert John).
  Letter in relation to Appeal Proceedings, dated Sep. 25, 2015, 19 pages.
  Letter in response to the summons to oral proceedings pursuant to Rule 115(1) EPC, dated Sep. 25, 2015, 9 pages.
  Main Request, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 4, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 5, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 6, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 8, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 9, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 10, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 11, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 7, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 1, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 2, dated Sep. 25, 2015, 5 pages.
  Auxiliary Request 3, dated Sep. 25, 2015, 5 pages.
  Amend claims (Main Request), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 1), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 2), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 4), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 5), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 6), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 7), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 8), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 9), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 11), dated Sep. 25, 2015, 8 pages.
  Amend claims (Auxiliary Request 10), dated Sep. 25, 2015, 8 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Sep. 25, 2015, 2 pages.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 1, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 1, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 1, 2015, 1 page (Fritz Lahrtz).
  Further to the Submission of Sep. 21, 2015, dated Oct. 1, 2015, 3 pages.
  Communication of the Board of Appeal, dated Oct. 2, 2015, 5 pages (Andrew Bentham).
  Letter in relation to appeal, dated Oct. 5, 2015, 2 pages.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 9, 2015, 1 page (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 9, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Oct. 9, 2015, 1 page (Fritz Lahrtz).
  Letter accompanying subsequently filed items, dated Oct. 12, 2015, 1 page.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 12, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 12, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 12, 2015, 1 page (Stephen, Robert John).
  Letter regarding issue of insufficiency, dated Oct. 9, 2015, 1 page.
  Letter in relation to appeal, dated Oct. 12, 2015, 3 pages (Andrew Bentham).
  Consolidated document list, dated Oct. 12, 2015, 13 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Oct. 12, 2015, 1 page.
  Letter regarding Oral Proceedings, dated Oct. 13, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Oct. 16, 2015, 6 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent Proprietor), dated Oct. 16, 2015, 6 pages (Stephen, Robert John).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 16, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 16, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 16, 2015, 1 page (Stephen, Robert John).
  Letter in relation to Appeal proceedings, dated Oct. 22, 2015, 5 pages.
  Notice of electronic filing, dated Oct. 25, 2015, 1 page.
  Memorandum decision and order, dated Oct. 25, 2015, 11 pages.
  Letter regarding decision in US proceedings, dated Oct. 25, 2015, 2 pages.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Oct. 26, 2015, 5 pages (Andrew Bentham).
  Letter enclosing D173 and D174, dated Oct. 26, 2015, 1 page.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Oct. 27, 2015, 1 page (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Oct. 27, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 1), dated Oct. 27, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent Proprietor), dated Oct. 28, 2015, 6 pages (Stephen, Robert John).
  Letter in relation to appeal, dated Oct. 23, 2015, 3 pages (Andrew Bentham).
  Oral proceedings notice, dated Oct. 30, 2015, 1 page.
  Acknowledgement of receipt of the document 3011, dated Oct. 30, 2015, 1 page (Potter Clarkson LLP).
  Acknowledgement of receipt of the document 3011, dated Oct. 30, 2015, 1 page (Fritz Lahrtz).
  Acknowledgement of receipt of the document 3011, dated Oct. 30, 2015, 1 page (Stephen, Robert John).
  Opinion and order, dated Nov. 2, 2015, 114 pages.
  Letter regarding decision of the court (D175), dated Nov. 3, 2015, 41 pages.
  Letter accompanying subsequently filed items, dated Nov. 4, 2015, 1 page (Andrew Bentham).
  Summons to oral proceedings pursuant to Rule 115(1) EPC, dated Nov. 4, 2015, 12 pages.
  Letter in preparation of the fourth day of oral proceedings, dated Nov. 4, 2015, 6 pages.
  Letter regarding amendments, dated Nov. 4, 2015, 2 pages.
  First Auxiliary Request, dated Nov. 3, 2015, 2 pages.
  Main request, dated Oct. 28, 2015, 4 pages.
  New first auxiliary request, dated Nov. 3, 2015, 5 pages.
  Acknowledgement of receipt of the document 3011, dated Nov. 4, 2015, 2 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Nov. 5, 2015, 5 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Patent proprietor), dated Nov. 5, 2015, 6 pages (Stephen, Robert John).
  Tracking information, dated Nov. 4, 2015, 1 page.
  Acknowledgement of receipt of the document 3011, dated Nov. 5, 2015, 1 page (Fritz Lahrtz).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Nov. 6, 2015, 3 pages (Andrew Bentham).
  Minutes of oral proceedings, dated Nov. 9, 2015, 11 pages.
  Main request, dated Nov. 9, 2015, 5 pages.
  Description of EP 1360287, date Nov. 9, 2015, 24 pages.
  Advice of delivery, dated Nov. 16, 2015, 2 pages.
  Minutes of the oral proceedings, dated Nov. 18, 2015, 4 pages.
  Request for correction of minutes, dated Nov. 25, 2015, 2 pages.
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Dec. 3, 2015, 1 pages (Andrew Bentham).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Dec. 3, 2015, 1 page (Potter Clarkson LLP).
  Letter from Boards of Appeal for T2220/14-3.3.08 (Opponent 2), dated Dec. 3, 2015, 1 page (Stephen, Robert John).
  Communication of the Board of Appeal, dated Dec. 4, 2015, 7 pages.
  Datasheet for the decision, dated Nov. 9, 2015, 83 pages.
  Decision, dated Mar. 11, 2016, 1 page (Andrew Bentham).
  Decision, dated Mar. 11, 2016, 1 page (Potter Clarkson LLP).
  Decision, dated Mar. 11, 2016, 1 page (Fritz Lahrtz).
  Decision, dated Mar. 11, 2016, 1 page (Stephen, Robert John).
  Tracking information, dated Mar. 11, 2016, 1 page (Fritz Lahrtz).
  Acknowledgement of receipt of the document 3032, dated Mar. 14, 2016, 1 page (Fritz Lahrtz).
  Acknowledgement of receipt of the document 3032, dated Mar. 14, 2016, 1 page (Stephen, Robert John).
  Advice of delivery, dated Mar. 16, 2016, 2 pages.
  Letter accompanying subsequently filed items, dated Mar. 21, 2016, 1 page (James R Nicholls).
  Acknowledgement of receipt of the document 3032, dated Mar. 11, 2016, 1 page (Andrew Bentham).
  Acknowledgement of receipt in EP 02709544.7, dated Mar. 21, 2016, 1 page (James Nicholls).
  Notification of the communication, dated May 24, 2016, 1 page.
  Communication pursuant to Article 101(1) and Rule 81(2) to (3) EPC, dated May 24, 2016, 2 pages (Andrew Bentham).
  Application documents, dated May 24, 2016, 1 page.
  Request for recordal, dated May 30, 2016, 1 page.
  Deed of conversion and amendment of the articles of association, dated May 19, 2016, 53 pages.
  Payment of fees and expenses, dated May 30, 2016, 1 page.
  Communication of amended entries in register of European patents, dated Jun. 20, 2016, 2 pages (Fritz Lahrtz).
  Brief Communication, dated Jun. 20, 2016, 3 pages (Andrew Bentham).
  Brief Communication, dated Jun. 20, 2016, 3 pages (Potter Clarkson LLP).
  Brief Communication, dated Jun. 20, 2016, 3 pages (Stephen, Robert John).
  Submission in opposition proceedings, dated Sep. 19, 2016, 2 pages.
  Comments on amendments (opponent 1), dated Sep. 19, 2016, 4 pages.
  Response to communication, dated May 24, 2016, 1 page (Robert Stephen).
  Acknowledgement of receipt in EP 02709544.7, dated Sep. 19, 2016, 2 pages.
  Brief communication, dated Sep. 23, 2016, 1 page (Andrew Bentham).
  Brief communication, dated Sep. 23, 2016, 1 page (Fritz Lahrtz).
  Brief communication, dated Sep. 23, 2016, 1 page (Potter Clarkson LLP).
  Submission in opposition proceedings, dated Sep. 30, 2016, 2 pages (James Nicholls).
  Description of U.S. Appl. No. 09/784,859, dated Sep. 30, 2016, 21 pages.
  Response to the Communication, dated Sep. 30, 2016, 2 pages.
  Acknowledgement of receipt in EP 02709544.7, dated Sep. 30, 2016, 2 pages.
  Submission in opposition proceedings, dated Oct. 3, 2016, 1 page (Philip Thomas).
  Letter in response to communication, dated Oct. 3, 2016, 1 page (Philip Thomas).
  Acknowledgement of receipt in EP 02709544.7, dated Oct. 3, 2016, 1 page (Rebecca Hamilton).
  Brief communication, dated Oct. 7, 2016, 1 page (Stephen, Robert John).
  Brief communication (enclosed letter from proprietor of the patent), dated Oct. 7, 2016, 1 page (Fritz Lahrtz).
  Brief communication, dated Oct. 7, 2016, 1 page (Potter Clarkson LLP).
  Brief communication, dated Oct. 7, 2016, 1 page (Andrew Bentham).
  Brief communication (enclosed letter from opponent 3), dated Oct. 7, 2016, 1 page (Stephen, Robert John).
  Brief communication (enclosed letter from opponent 3), dated Oct. 7, 2016, 1 page (Fritz Lahrtz).
  Communication, dated Oct. 14, 2016, 1 page.
  Communication pursuant to Article 101(1) and Rule 82(1) EPC, dated Oct. 14, 2016, 2 pages.
  Information of the oral proceedings, dated Oct. 28, 2016, 1 page.
  Decision on opposition, dated Sep. 7, 2016, 50 pages.
  Abedi et al., “Green fluorescent protein as a scaffold for intracellular presentation of peptides,” Nucleic Acids Res (1998) 26(2):623-630.
  Abidor et al., “Studies of cell pellets: II. Osmotic properties, electroporation, and related phenomena: membrane interactions,” Biophysical Joural (1994) 67:427-435.
  Akerstrom et al., “On the interaction between single chain Fv antibodies and bacterial immunoglobulin-binding proteins,” J Immunol Methods (1994) 177:151-163.
  Alber et al., “Nucleotide sequence of the triose phosphate isomerase gene of Saccharomyces cerevisiae,” J Mol Appl Genet (1982) 1(5):419-434.
  Al-Lazikani et al., “Standard conformations for the Canonical structures of immunoglobulins,” J Mol Biol (1997) 273:927-948.
  Allen, “Ligand-targeted therapeutics in anticancer therapy,” Nat Rev Cancer (2002) 2(10):750-763.
  Almagro et al., “Humanization of antibodies,” Front Biosci (2008) 13:1619-1633.
  Ammerer, “Expression of Genes in Yeast Using the ADCI Promoter,” Methods in Enzymology (1983) 101:192-201.
  Antica et al., “Thymic Stem Cells in Mouse Bone Marrow,” Blood (1994) 84(1):111-117.
  Appel et al., “A new generation of information retrieval tools for biologists: the example of the ExPASy WWW server,” Trends Biochem Sci (1994) 19(6):258-260.
  Approved judgment, dated Feb. 1, 2016, 87 pages.
  Arai et al., “Antibody responses induced by immunization with a Japanese rabies vaccine determined by neutralization test and enzyme-linked immunosorbent assay,” Vaccine (2002) 20(19-20):2448-2453.
  Aramda et al., “Nuclear Hormone Receptors and Gene Expression,” Physiol Rev (2001) 81(3):1269-1304.
  Arnold et al., “Development of B-1 cells: segregation of phosphatidyl choline-specific B cells to the B-1 population occurs after immunoglobulin gene expression,” J Exp Med (1994) 179(5): 1585-1595.
  Attaelmannan et al., “Understanding and identifying monoclonal gammopathies,” Clin Chem (2000) 46(8 Pt 2):1230-1238.
  Atwell et al., “Stable Heterodimers from Remodeling the Domain Interface of a Homodimer using a Phage Display Library,” J Mol Biol (1997) 270:26-35.
  Aucouturier et al., “Monoclonal Ig L chain and L chain V domain fragment crystallization in myeloma-associated Fanconi's syndrome,” J Immunol (1993) 150(8) 3561-3568.
  Auerbach et al., “Angiogenesis Assays: A Critical Overview,” Clin Chem (2003) 49(1):32-40.
  Babcook et al., “A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities,” Proc Natl Acad Sci USA (1996) 93:7843-7848.
  Banchereau et al., “Long-term human B cell lines dependent on interleukin-4 and antibody to CD40,” Science (1991) 251(4989):70-72.
  Barbas et al., “Assembly of combinatorial antibody libraries on phage surfaces: the gene III site,” Proc Natl Acad Sci U S A (1991) 88(18):7978-7982.
  Barnes et al., “Characterization of the Stability of Recombinant Protein Production in the GS-NS0 Expression System,” Biotechnol Bioeng (2001) 73(4):261-270.
  BD Biosciences, “CD Marker Handbook,” (2010) 4 pages.
  Bebbington et al., “High-level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an amplifiable selectable marker,” Biotechnology (N Y) (1992) 10(2):169-175.
  Bell et al., “Insulators and boundaries: versatile regulatory elements in the eukaryotic genome,” Science (2001) 291(5503):447-450.
  Bengig, “The production of foreign proteins in mammalian cells,” Genet Eng (1988) 7:91-127.
  Bertagnolli et al., “IL-12 augments antigen-dependent proliferation of activation lymphocytes,” J Immunol (1992) 149:3778-3783.
  Bertagnolli et al., “IL-4-Supported Induction of Cytolytic T Lymphocytes Requires IL-2 and IL-6,” Cell Immunol (1991) 133:327-341.
  Bertagnolli et al., “IL-7 supports the generation of cytotoxic T lymphocytes from thymocytes. Multiple lymphokines required for proliferation and cytotoxicity,” J Immunol (1990) 145:1706-1712.
  Betz et al., “Elements regulating somatic hypermutation of an immunoglobulin kappa gene: critical role for the intron enhancer/matrix attachment region,” Cell (1994) 77(2):239-248 (Abstract).
  Bhardwaj et al., “Influenza virus-infected dendritic cells stimulate strong proliferative and cytolytic responses from human CD8+ T cells,” J Clin Invest (1994) 94(2):797-807.
  Bins et al., “A rapid and potent DNA vaccination strategy defined by in vivo monitoring of antigen expression,” Nature Medicine (2005) 11(8):899-904.
  Binz et al., “Designing Repeat Proteins: Well-expressed, Soluble and Stable Proteins from Combinatorial Libraries of Consensus Ankyrin Repeat Proteins,” J Mol Biol (2003) 332:489-503.
  Birchmeier et al., “Met, metastasis, motility and more,” Nat Rev Mol Cell Biol (2003) 4(12):915-925.
  Bitter et al.,“Expression and secretion vectors for yeast,” Methods Enzymol (1987) 153:516-544.
  Bitter, “Heterologous gene expression in yeast,” Methods Enzymol (1987) 152:673-684.
  Bode et al., “The Hitchhiking principle: Optimizing episomal vectors for the use in gene therapy and biotechnology,” Gene Ther Mol Biol (2001) 6:33-46.
  Boder et al., “Yeast surface display for screening combinatorial polypeptide libraries,” Nat Biotechnol (1997) 15(6):553-557.
  Boel et al., “Functional human monoclonal antibodies of all isotypes constructed from phage display library-derived single-chain Fv antibody fragments,” J Immunol Methods (2000) 239(1-2):153-166.
  Bowman et al., “The cloning of CD70 and its identification as the ligand for CD27,” J Immunol (1994) 152:1756-1761.
  Brady et al., “Rapid specific amplification of rat antibody cDNA from nine hybridomas in the presence of myeloma light chains,” J Immunol Methods (2006) 315(1-2):61-67.
  Brezinsky et al., “A simple method for enriching populations of transfected CHO cells for cells of higher specific productivity,” J Immunol Methods (2003) 277(1-2):141-155.
  Brink et al., “Developing efficient strategies for the generation of transgenic cattle which produce biopharmaceuticals in milk,” Theriogenology (2000) 53(1):139-148.
  Broach et al., “Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene,” Gene (1979) 8(1):121-133.
  Burger et al., “An integrated strategy for the process development of a recombinant antibody-cytokine fusion protein expressed in BHK cells,” Appl Microbiol Biotechnol (1999) 52(3):345-353.
  Burioni et al., Nonneutralizing human antibody fragments against hepatitis C virus E2 glycoprotein modulate neutralization of binding activity of human recombinant Fabs, Virology (2001) 288:29-335.
  Campbell et al., “Sheep cloned by nuclear transfer from a cultured cell line,” Nature (1996) 380(6569):64-66.
  Cao et al., “Neutralizing monoclonal antibodies to hepatocyte growth factor/scatter factor (HGF/SF) display antitumor activity in animal models,” Proc Natl Acad Sci U S A (2001) 98(13):7443-7448.
  Carmack et al. “Influence of a V kappa 8 L chain transgene on endogenous rearrangements and the immune response to the HA(Sb) determinant on influenza virus,” J Immunol (1991) 147(6):2024-2033.
  Carter et al. “Humanization of an anti-p185HER2 antibody for human cancer therapy,” Proc Natl Acad Sci U S A (1992) 89(10)4285-4289.
  Carter, “Bispecific human IgG by design” J Immunol Methods (2001 248(1-2):7-15.
  Cascalho et al., “A quasi-monoclonal mouse,” Science (1996) 272(5268):1649-1652.
  Casellas et al., “Contribution of receptor editing to the antibody repertoire” Science (2001) 291(5508):1541-1544.
  Castelli et al., “HLA-DP4, the most frequent HLA II molecule, defines a new supertype of peptide-binding specificity,” J Immunol (2002) 169(12):6928-6934.
  Champion et al., “The development of monoclonal human rabies virus-neutralizing antibodies as a substitute for pooled human immune globulin in the prophylactic treatment of rabies virus exposure,” J Immunol Methods (2000) 235(1-2):81-90.
  Chan et al., “Genomic Organization of the T Cell Receptor,” Cancer Detect Prev (1989) 14(2):261-267.
  Chao et al., “Isolating and engineering human antibodies using yeast surface display,” Nature Protocols (2006) 1(2):755-769.
  Chen et al., “Selection and Analysis of an Optimized Anti-VEGF Antibody: Crystal Structure of an Affinity-matured Fab in Complex with Antigen,” J Mol Biol (1999) 293(4):865-881.
  Cheong et al., “Affinity enhancement of bispecific antibody against two different epitopes in the same antigen,” Biochem Biophys Res Commun (1990) 173(3):795-800.
  Cherrington et al., “New paradigms for the treatment of cancer: the role of anti-angiogenesis agents,” Adv Cancer Res (2000) 79:1-38.
  Chesnut et al., “Selective isolation of transiently transfected cells from a mammalian cell population with vectors expressing a membrane anchored single-chain antibody,” J Immunol Methods (1996) 193(1):17-27.
  Cheung et al., “A Recombinant Human Fab Expressed in Escherichia coli Neutralizes Rabies Virus,” J Virol (1992) 66(11):6714-6720.
  Chothia et al., “Canonical Structures for the Hypervariable Regions of Immunoglobulins,” J Mol Biol (1987) 196:901-917.
  Clackson et al., “Making antibody fragments using phage display libraries,” Nature (1991) 352(6336):624-628.
  Cobaugh et al., “Synthetic antibody libraries focused towards peptide ligands,” J Mol Biol (2008) 378(3):622-633.
  Cockett et al., “High level expression of tissue inhibitor of metalloproteinases in Chinese hamster ovary cells using glutamine synthetase gene amplification,” Biotechnology (N Y) (1990) 8(7):662-667.
  Conn et al., “Purification of a glycoprotein vascular endothelial cell mitogen from a rat glioma-derived cell line,” Proc Natl Acad Sci U S A (1990) 87(4):1323-1327.
  Conrath et al., “Camel Single-domain Antibodies as Modular Building Units in Bispecific and Bivalent Antibody Constructs,” J Biol Chem (2001) 276(10):7346-7350.
  Conrath et al., “Emergence and evolution of functional heavy-chain antibodies in Camelidae,” Dev Comp Immunol (2003) 27(2):87-103.
  Corsaro et al., “Enhancing the Efficiency of DNA-Mediated Gene Transfer in Mammalian Cells,” Somatic Cell Genetics (1981) 7(5):603-616.
  Crowe, “Recent advances in the study of human antibody responses to influenza virus using optimized human hybridoma approaches,” Vaccine (2009) 27S:G47-51.
  Cvetkovic et al., “Appropriate Tissue- and Cell-specific Expression of a Single Copy Human Angiotensinogen Transgene Specifically Targeted Upstream of the HPRT Locus by Homologous Recombination,” J Biol Chem (2000) 275(2):1073-1078.
  Dammacco et al., “Immunoglobulin secretion by peripheral blood and bone marrow B cells in patients with multiple myeloma. Studies by the reverse haemolytic plaque assay,” Clin exp Immunol (1984) 87:743-751.
  Darzynkiewicz et al., “Features of Apoptotic Cells Measured by Flow Cytometry,” Cytometry (1992) 13:795-808.
  Davies et al., “Antibody VH Domains as Small Recognition Units,” Nature (1995) 13:475-479.
  De Chiara et al., “Producing fully ES cell-derived mice from eight-cell stage embryo injections,” Methods Enzymol (2010) 476:285-294.
  Declaration of Andrew Murphy, dated Dec. 19, 2014, 18 pages.
  Declaration of Anthony DeFranco, dated Aug. 24, 2016, 22 pages.
  Declaration of Anthony DeFranco, dated Oct. 18, 2015, 31 pages.
  Declaration of Christopher Goodnow, dated Oct. 16, 2015, 81 pages.
  Declaration of David Tarlinton, dated Oct. 15, 2015, 24 pages.
  Declaration of Joel Martin, dated May 18, 2016, 13 pages.
  Declaration of John McWhirter, dated Aug. 2, 2016, 4 pages.
  Declaration of Peter Hudson, dated Jun. 2, 2015, 7 pages.
  Declaration of Peter Hudson, dated May 1, 2015, 52 pages.
  Declaration of Robert Brink, dated Jun. 2, 2015, 38 pages.
  Declaration of Robert Brink, dated Oct. 19, 2016, 19 pages.
  Declaration of Robert Brink, dated Apr. 30, 2015, 34 pages.
  Declaration of Ton Logtenberg, dated Sep. 15, 2015, 5 pages.
  Second declaration of Ton Logtenberg, dated Dec. 18, 2015, 10 pages.
  De Graaf et al., “Expression of scFvs and scFv Fusion Proteins in Eukaryotic Cells,” Methods Mol Biol (2002) 178:379-387.
  De Kruif et al., “Human immunoglobulin repertoires against tetanus toxoid contain a large and diverse fraction of high-affinity promiscuous V(H) genes,” J Mol Biol (2009) 387(3):548-558.
  De Kruif et al., “Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library,” Proc. Natl. Acad. Sci. USA (1995) 92:3939-3942.
  De Kruif et al., “Selection and Application of Human Single Chain Fv Antibody Fragments from a Semi-synthetic Phage Antibody Display Library with Designed CDR3 Regions,” J Mol Biol (1995) 248:97-105.
  Desmet et al., “Anchor profiles of HLA-specific peptides: analysis by a novel affinity scoring methods and experimental validation,” Protein (2005) 58:53-69.
  Desmet et al., “Computation of the binding of fully flexible peptides to proteins with flexible side chains,” FASEB Journal (2016) 11(2):164-172.
  Desmet et al., “Fast and accurate side-chain topology and energy refinement (FASTER) as a new method for protein structure optimization,” Protein (2002) 48:31-43.
  Desmet et al., “The dead-end elimination theorem and its use in protein side-chain positioning,” Nature (1992) 356:539-542.
  De Vries et al., “The Effect of Recombinant Mast Cell Growth Factor on Purified Murine Hematopoietic Stem Cells,” J Exp Med (1991) 173(5):1205-1211.
  De Wildt et al., “Analysis of Heavy and Light Chain Pairings Indicates that Receptor Editing Shapes the Human Antibody Repertoire,” J Mol Biol (1999) 285:895-901.
  Declaration of Christopher Carl Goodnow, Oct. 4, 2016, 13 pages.
  Declaration of Prof Logtenberg, dated May 4, 2016, 7 pages.
  Dejong et al., “Mammalian Artificial Chromosome Pilot Production Facility: Large-Scale Isolation of Functional Satellite DNA-Based Artificial Chromosomes,” Cytometry (1999) 35:129-133.
  Desmyter et al., “Crystal structure of a camel single-domain VH antibody fragment in complex with lysozyme,” Nat Struct Biol (1996) 3(9):803-811.
  Detailed results for the IMGT/V-QUEST analysed sequences, IMGT, (2016) 7 pages.
  Dinnyes et al., “Somatic Cell Nuclear Transfer: Recent Progress and Challenges,” Cloning Stem Cells (2002) 4(1):81-90.
  Dumoulin et al., “A camelid antibody fragment inhibits the formation of amyloid fibrils by human lysozyme,” Nature (2003) 424(6950):783-788.
  Dumoulin et al., “Single-domain antibody fragments with high conformational stability,” Protein Sci (2002) 11(3):500-515.
  Eggan et al., “Hybrid vigor, fetal overgrowth, and viability of mice derived by nuclear cloning and tetraploid embryo complementation,” PNAS (2001) 98(11):6209-6214.
  Esposito et al., “Phage display of a human antibody against Clostridium tetani toxin,” Gene (1994) 148:167-168.
  Ettinger et al., “IL-21 induces differentiation of human naïve and memory B cells into antibody-secreting plasma cells,” The Journal of Immunology (2005) 176:7867-7879.
  Ewert et al., “Biophysical Properties of Camelid VHH Domains Compared to Those of Human VH3 Domains,” Biochemistry (2002) 41:3628-3636.
  Ewert et al., “Biophysical properties of human antibody variable domains,” J Mol Biol (2003) 325:531-553.
  Ezzell, “Molecular guided missiles called monoclonal antibodies were poised to shoot down cancer and a host of other diseases—until they crashed and burned. Now a new generation is soaring to market,” Scientific American (2001) pp. 35-41.
  Fasta, Immunoglobulin light chain variable region, partial [Homo sapiens] (2014) 1 page.
  Fecteau et al., “A new memory CD27IgG+ B cell population in peripheral blood expressing VH genes with low frequency of somatic mutation,” The Journal of Immunology (2006) 177:3728-3736.
  Feldhaus et al., “Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library,” Natura Biotechnology (2003) 21:163-170.
  Feige et al., “Anti-interleukin-1 and anti-tumor necrosis factor-alpha synergistically inhibit adjuvant arthritis in Lewis rats,” Cell Mol Life Sci (2000) 57(10):1457-1470.
  Ferrara, “Vascular endothelial growth factor: molecular and biological aspects,” Curr Top Microbiol Immunol (1999) 237:1-30.
  Figini et al., “In Vitro Assembly of Repertoires of Antibody Chains on the Surface of Phage by Renaturation,” J Mol Biol (1994) 239(1):68-78.
  Fine et al., “Interleukin-10 Enhances γδ T Cell Development in the Murine Fetal Thymus,” Cellular Immunol (1994) 155:111-122.
  Fischer, “Sequencing antibody repertoires: The next generation,” mAbs (2011) 3:17-20.
  Fishwild et al., “High-avidity human IgG kappa monoclonal antibodies from a novel strain of minilocus transgenic mice,” Nat Biotechnol (1996) 14(7):845-851.
  Flavell et al., “Systemic therapy with 3BIT, a triple combination cocktail of anti-CD19, -CD22, and -CD38-saporin immunotoxins, is curative of human B-cell lymphoma in severe combined immunodeficient mice,” Cancer Res (1997) 57(21):4824-4829.
  Flavell et al., “Therapy of human T-cell acute lymphoblastic leukaemia with a combination of anti-CD7 and anti-CD38-SAPORIN immunotoxins is significantly better than therapy with each individual immunotoxin,” Br J Cancer (2001) 84(4):571-578.
  Folkman, “Angiogenesis in cancer, vascular, rheumatoid and other disease,” Nat Med (1995) 1(1):27-31.
  Franconi et al., “Functional expression in bacteria and plants of an scFv antibody fragment against tospoviruses,” Immunotechnology (1999) 4(3-4):189-201.
  Freken et al., “Isolation of antigen specific Llama VHH antibody fragments and their high level secretion by Saccharomyces cerevisiae,” J Biotechnol (2000) 78(1):11-21.
  French et al., “Cooperative Mixtures of Bispecific F(ab′)2 Antibodies for Delivering Saporin to Lymphoma in Vitro and in Vivo,” Cancer Res (1991) 51:2353-2361.
  Friedenson et al., “Immunoglobulin G antibodies from an individual rabbit in which several heavy chain variants are paired with one light chain sequence,” J Biol Chem (1973) 248(20):7073-7079.
  Frykman et al., “Quantitating secretion rates of individual cells: design of secretion assays,” Biotechnol Bioeng (1998) 59(2):214-226.
  Fuchs et al., “Targeting recombinant antibodies to the surface of Escherichia coli: fusion to a peptidoglycan associated lipoprotein,” Biotechnology (N Y) (1991) 9(12):1369-1372.
  Fussenegger et al., “Genetic optimization of recombinant glycoprotein production by mammalian cells,” Trends Biotechnol (1999) 17(1):35-42.
  Garber, “Biotech industry faces new bottleneck,” Nat Biotechnol (2001) 19:183-185.
  Garnick, “Peptide Mapping for Detecting Variants in Protein Products,” Develop biol Standard (1992) 76:117-130.
  Garrard et al., “Fab assembly and enrichment in a monovalent phage display system,” Biotechnology (N Y) (1991) 9(12):1373-1377.
  Gascan et al., “Human B cell clones can be induced to proliferate and to switch to IgE and IgG4 synthesis by interleukin 4 and a signal provided by activated CD4+ T cell clones,” J Exp Med (1991) 173:747-750.
  Ge et al., “Rapid construction and characterization of synthetic antibody libraries without DNA amplification,” Biotechnology and Bioengineering (2010) 106(3):347-357.
  Genbank, ABA26122.1, dated Dec. 31, 2005, 1 page.
  Genbank, DQ187586.1, dated Jul. 26, 2016, 1 page.
  Genbank, M87478.1, dated Oct. 28, 1994, 1 page.
  Gerstner et al., “Sequence Plasticity in the Antigen-binding Site of a Therapeutic Anti-HER2 Antibody,” J Mol Biol (2002) 321:851-862.
  Giddings et al., “Transgenic plants as factories for biopharmaceuticals,” Nat Biotechnol (2000) 18(11):1151-1155.
  Gluzman, “SV40-Transformed Simian Cells Support the Replication of Early SV40 Mutants,” Cell (1981) 23:175-I 82.
  Gonzalez-Fernandez et al., “Analysis of somatic hypermutation in mouse Peyer's patches using immunoglobulin κ light-chain transgenes,” Proc Natl Acad Sci USA (1993) 90:9862-9866.
  Good et al., “Kinetics of human B cell behavior and amplification of proliferative responses following stimulation with IL-21,” J Immunol (2006) 177:5236-5247.
  Gorczyca et al., “DNA strand breaks occurring during apoptosis: Their early in situ detection by the terminal deoxynucleotidyl transferase and nick translation assays and prevention by serine protease inhibitors,” Int J Oncol (1992) 1(6):639-648.
  Gorczyca et al., “Induction of DNA Strand Breaks Associated with Apoptosis during Treatment of Leukemias,” Leukemia (1993) 7(5 ):659-670.
  Gorman et al., “Site-specific gene targeting for gene expression in eukaryotes,” Curr Opin Biotechnol (2000) 11(5):455-460.
  Goyenechea et al., “Modifying the sequence of an immunoglobulin V-gene alters the resulting pattern of hypermutation,” Proc Natl Acad Sci USA (1996) 93:13979-13984.
  Goyenechea et al., “Cells strongly expressing Igκ transgenes show clonal recruitment of hypermutation: a role for both MAR and the enhancers,” The EMBO Journal (1997) 16(13):3987-3994.
  Graham et al., “A New Technique for the Assay of Infectivity of Human Adenovirus 5 DNA,” Virology (1973) 52:456-467.
  Gram et al., “In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library,” Proc. Natl. Acad. Sci. USA (1992) 89:3576-3580.
  Graslund et al., “Integrated strategy for selective expanded bed ion-exchange adsorption and site-specific protein processing using gene fusion technology,” J Biotechnol (2002) 96(1):93-102.
  Gray et al., “Secretion capture and report web: use of affinity derivatized agarose microdroplets for the selection of hybridoma cells,” J Immunol Methods (1995) 182(2):155-63.
  Greenberger et al., “Demonstration of permanent factor-dependent multipotential (erythroid/neutrophil/basophil) hematopoietic progenitor cell lines,” Proc. Natl Acad. Sci. USA (1983) 80:2931-2935.
  Griffiths et al., “Human anti-self antibodies with high specificity from phage display libraries,” EMBO J (1993) 12(2):725-734.
  Griffiths et al., “Isolation of high affinity human antibodies directly from large synthetic repertoires,” EMBO J (1994) 13(14):3245-3260.
  Groeneveld et al., “Bone morphogenetic proteins in human bone regeneration,” Eur J Endocrinol (2000)142(1):9-21.
  Grosveld, “Activation by locus control regions?” Curr Opin Genet Dev (1999) 9(2):152-7.
  Guery et al., “Dendritic cells are the most efficient in presenting endogenous naturally processed self-epitopes to class II-restricted T cells,” J Immunol (1995) 154(2):536-544.
  Guilli et al., “Epidermal growth factor-induced apoptosis in A431 cells can be reversed by reducing the tyrosine kinase activity,” Cell Growth and Differentiation (1996) 7:173-178.
  Gunasekaran et al., “Enhancing antibody Fc heterodimer formation through electrostatic steering effects,” Journal of Biological Chemistry (2010) 285(25):19637-19646 (enclosing supplementary tables and figures).
  Hamers-Casterman et al., “Naturally occurring antibodies devoid of light chains,” Nature (1993) 363(6428):446-8.
  Hanes et al., “Picomolar affinity antibodies from a fully synthetic naive library selected and evolved by ribosome display,” Nat Biotechnol (2000) 18(12):1287-92.
  Hanes et al., “Selecting and evolving functional proteins in vitro by ribosome display,” Methods Enzymol (2000) 328:404-430.
  Harding et al., “The immunogenicity of humanize and fully human antibodies,” mAbs (2010) 2:3:256-265.
  Hardy et al., “B cell development pathways,” Annu Rev Immunol (2001) 19:595-621.
  Harjunpaa et al., “Rituximab (Anti-CD20) Therapy of B-Cell Lymphomas: Direct Complement Killing is Superior to Cellular Effector Mechanisms,” Scand J Immunol (2000) 51(6):634-41.
  Harvey et al., “Anchored periplasmic expression, a versatile technology for the isolation of high-affinity antibodies from Escherichia coli-expressed libraries,” PNAS (2004) 101(25):9193-9198.
  Hawkins et al., “Selection of Phage Antibodies by Binding Affinity Mimicking Affinity Maturation,” J Mol Biol (1992) 226:889-896.
  Hay et al., “Bacteriophage cloning and Escherichia coli expression of a human IgM Fab,” Hum Antibod Hybridomas (1992) 3:81-85.
  Heintges et al., “Cloning, bacterial expression and sequencing of human antibody fragments against hepatitis Virus NS3 by Phage display of a combinatorial Phagemid Library,” Hepatology (1998) 28(4 Pt 2):227A.
  Hengstchlager et al., “A λ1 transgene under the control of a heavy chain promoter and enhancer does not undergo somatic hypermutation,” Eur J Immunol (1994) 24:1649-1656.
  Hiatt et al., “Production of antibodies in transgenic plants,” Nature (1989) 342(6245):76-8.
  Hitzeman et al., “Isolation and Characterization of the Yeast 3-Phosphoglycerokinase Gene (PGK) by an Immunological Screening Technique” J Biol Chem (1980) 255(24):12073-12080.
  Hochedlinger et al., “Monoclonal mice generated by nuclear transfer from mature B and T donor cells,” Nature (2002) 415:1035-1038.
  Holliger et al., ““Diabodies”: Small bivalent and bispecific antibody fragments,” Proc. Natl. Acad. Sci. USA (1993) 90:6444-6448.
  Holmes et al., “Improved cell line development by a high throughput affinity capture surface display technique to select for high secretors,” J Immunol Methods (1999) 230(1-2):141-147.
  Holt et al., “Domain antibodies: proteins for Therapy,” Trends Biotechnol (2003) 21(11):484-490.
  Homig-Holzel et al., “Constitutive CD40 signaling in B cells selectively activates the noncanonical NF-κB pathway and promotes lymphomagenesis,” J Exp Med (2008) 205(6):1317-1329.
  Hoogenboom et al., “Antibody phage display technology and its applications,” Immunotechnology (1998) 4(1):1-20.
  Hoogenboom et al., “By-passing immunisation. Human antibodies from synthetic repertoires of germline VH gene segments rearranged in vitro,” J Mol Biol (1992) 227(2):381-388.
  Hoogenboom et al., “Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains,” Nucleic Acids Research (1991) 19(15):4133-4137.
  Hoogenboom et al., “Natural and designer binding sites made by phage display technology,” Immunol Today (2000) 21(8):371-378.
  Hoogenboom, “Designing and optimizing library selection strategies for generating high-affinity antibodies,” Trends Biotechnol (1997) 15(2):62-70.
  Hoogenboom, “Selecting and screening recombinant antibody libraries,” Nature Biotechnology (2005) 23(9):1105-1116.
  Hooper, “Rabies Virus,” Manual of Clinical Laboratory Immunology (1997) 5:755-760.
  Houshmand et al., “Use of bacteriophage T7 displayed peptides for determination of monoclonal antibody specificity and biosensor analysis of the binding reaction,” Anal Biochem (1999) 268(2):363-370.
  Houston Jr et al., “Use of a Conformationally Restricted Secondary Structural Element to Display Peptide Libraries: A Two-stranded α-Helical Coiled-coil Stabilized by Lactam Bridges,” J Mol Biol (1996) 262:270-282.
  Huang et al., “Role of Bone Marrow-Derived Cells in Presenting MHC Class I-Restricted Tumor Antigens,” Science (1994) 264:961-965.
  Hudziak et al., “p185HER2 Monoclonal Antibody Has Antiproliferative Effects in Vitro and Sensitizes Human Breast Tumor Cells to Tumor Necrosis Factor,” Mol Cell Biol (1989) 9(3):1165-1172.
  Huls et al., “A recombinant, fully human monoclonal antibody with antitumor activity constructed from phage-displayed antibody fragments,” Nat Biotechnol (1999) 17(3):276-281.
  Huls et al., “Antitumor Immune Effector Mechanisms Recruited by Phage Display-derived Fully Human IgG1 and IgA1 Monoclonal Antibodies,” (1999) Cancer Res 59:1778-5784.
  Huse et al., “Generation of a Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda,” Science (1989) 246(4935):1275-1281.
  Huse et al., “Purification of antibodies by affinity chromatography,” J Biochem Biophys Methods (2002) 51:217-231.
  Hwang et al., “Immunogenicity of engineered antibodies,” Methods (2005) 36:3-10.
  Hynes, “Cell adhesion: old and new questions,” Trends Cell Biol (1999) 9(12):M33-M37.
  Inaba et al., “Dendritic Cells Pulsed with Protein Antigens in Vitro Can Prime Antigen-specific, MHC-restricted T Cells in Situ,” J Exp Med (1990) 172:631-640.
  Inaba et al., “Distinct Mechanisms of Neonatal Tolerance Induced by Dendritic Cells and Thymic B Cells,” J Exp Med (1991) 173:549-559.
  Important information regarding oral proceedings, dated Jul. 16, 2014, 3 pages.
  Inlay et al., “Essential roles of the κ light chain intronic enhancer and 3′ enhancer in κ rearrangement and demethylation,” Nature Immunology (2002) 3-5:463-468.
  Inlay et al., “Roles of the Ig κ light chain intronic and 3′ enhancers in Igκ somatic hypermutation,” Journal of Immunology (2006) 177:1146-1151.
  Ishii et al., “TANK-binding kinase-1 delineates innate and adaptive immune responses to DNA vaccines,” Nature (2008) 451:725-730.
  Itoh et al., “The Polypeptide Encoded by the cDNA for Human Cell Surface Antigen Fas Can Mediate Apoptosis,” Cell (1991) 66:233-243.
  Jacob et al., “Activity of DNA vaccines encoding self or heterologous Her-2/neu in Her-2 or neu transgenic mice,” Cellular Immunology (2006) 240:96-106.
  Jacob et al., “Combining human and rat sequences in Her-2 DNA vaccines blunts immune tolerance and drives antitumor immunity,” Cancer Research (2010) Cancer Res 70(1):119-128.
  Jain et al., “Engineering antibodies for clinical applications,” TRENDS in Biotechnology (2007) 25(7):309-316.
  Jakobovits et al., “Analysis of homozygous mutant chimeric mice: Deletion of the immunoglobulin heavy-chain joining region blocks B-cell development and antibody production,” Proc Natl Acad Sci USA (1993) 90:2551-2555.
  Jakobovits et al., “From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice,” Nat Biotechnol (2007) 25(10):1134-1143.
  Jakobovits et al., “Germ-line transmission and expression of a human-derived yeast artificial chromosome,” Nature (1993) 362(6417):255-258.
  Janeway, “Immuno biology the immune system in health and disease,” 4th edition (1999) 21 pages.
  Janeway, “The development and survival of lymphocytes,” pp. 275-290.
  Janeway's immunology, “Antigen presentation to T lymphocytes,” (2012) 31 pages.
  Jechlinger, “Optimization and delivery of plasmid DNA for vaccination,” Expert Rev Vaccines (2006) 5(6):803-825.
  Jeffers et al., “Enhanced Tumorigenicity and Invasion-Metastasis by Hepatocyte Growth Factor/Scatter Factor-Met Signalling in Human Cells Concomitant with Induction of the Urokinase Proteolysis Network,” Mol Cell Biol (1996) 16(3):1115-1125.
  Jespers et al., “Guiding the selection of human antibodies from phage display repertoires to a single epitope of an antigen,” Biotechnology (N Y) (1994) 12(9):899-903.
  Jiang et al., “A novel strategy for generation of monoclonal antibodies from single B cells using RT-RCR technique and in vitro expression,” Biotechnol Prog (2006) 22(4):979-988.
  Jin et al., “A rapid and efficient single-cell manipulation method for screening antigen-specific antibody-secreting cells from human peripheral blood,” Nature Medicine (2009) 15(9):1088-1093.
  Johansson et al., “Evidence for Involvement of Activin A and Bone Morphogenetic Protein 4 in Mammalian Mesoderm and Hematopoietic Development,” Mol Cell Biol (1995) 15(1):141-151.
  Jolly et al., “Rapid methods for the analysis of immunoglobulin gene hypermutation: application to transgenic and gene targeted mice,” Nucleic Acids Research (1997) 25(10):1913-1919.
  Jonasson et al., “Genetic design for facilitated production and recovery of recombinant proteins in Escherichia coli,” Biotechnol Appl Biochem (2002) 35:91-105.
  Jones et al., “High Level Expression of Recombinant IgG in the Human Cell Line PER.C6,” Biotechnol Prog (2003) 19:163-168.
  Kang et al., “Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces,” Proc Natl Acad Sci USA (1991) 88:4363-4366.
  Kakitani et al., “A novel transgenic chimaeric mouse system for the rapid functional evaluation of genes encoding secreted proteins,” Nucleic Acids Research (2005) 33(9):e85 8 pages.
  Kasprzyk et al., “Therapy of an Animal Model of Human Gastric Cancer Using a Combination of Anti-erbB-2 Monoclonal Antibodies,” Cancer Res (1992) 52:2771-2776.
  Kato et al., “Cell activation by CpG ODN leads to improved electrofusion in hybridoma production,” J Immunological Methods (2011) 373:102-110.
  Kaufman et al., “Amplification and Expression of Sequences Cotransfected with a Modular Dihydrofolate Reductase Complementary DNA Gene,” J Mol Biol (1982) 159:601-621.
  Kaufman, “Overview of Vector Design for Mammalian Gene Expression,” Mol Biotechnol (2000) 16(2):151-160.
  Keller et al., “Hematopoietic Commitment during Embryonic Stem Cell Differentiation in Culture,” Mol Cell Biol (1993) 13(1): 473-486.
  Kelley et al., “Antigen binding thermodynamics and antiproliferative effects of chimeric and humanized anti-p185HER2 antibody Fab fragments,” Biochemistry (1992) 31(24):5434-541.
  Kim et al., “Characterization of chimeric antibody producing CHO cells in the course of dihydrofolate reductase-mediated gene amplification and their stability in the absence of selective pressure,” Biotechnol Bioeng (1998) 58(1):73-84.
  Kim et al., “Comparative analyses of complex formation and binding sites between human tumor necrosis factor-alpha and its three antagonists elucidate their different neutralizing mechanisms,” J Mol Biol (2007) 374:1374-1388.
  Kim et al., “Subspecialization of CXCR5+T Cells: B helper activity is focused in a germinal center-localized subset of CXCR5+ T cells,” J Exp Med (2001) 193(12):1373-1381.
  Klagsbrun et al., “Vascular endothelial growth factor and its receptors,” Cytokine Growth Factor Rev (1996) 7(3):259-270.
  Kling et al., “Big Pharma vies for mice,” Nature Biotechnology (2007) 25:613-614.
  Klitz et al., “New HLA haplotype frequency reference standards: High-resolution and large sample typing of HLA DR-DQ haplotypes in a sample of European Americans,” Tissue Antigens (2003) 62:296-307.
  Klohn et al., “IBC's 23rd annual antibody engineering, 10th annual antibody therapeutics international conferences and the 2012 annual meeting of the antibody society,” mAbs (2013) 5(2):178-201.
  Klotz et al., “Somatic hypermutation of a λ2 transgene under the control of the λ enhancer or the heavy chain intron enhancer,” Journal of Immunology (1996) 157:4458-4463.
  Klotz et al., “Somatic hypermutation of an artificial test substrate within an Igκ transgene,” The Journal of Immunology (1998) 161:782-790.
  Kohler et al., “Continuous cultures of fused cells secreting antibody of predefined specificity,” Nature (1975) 256:495-497.
  Kong et al., “A λ3′ enhancer drives active and untemplated somatic hypermutation of a λ1 transgene,” The Journal of Immunology (1998) 161:294-301.
  Koide et al., “The Fibronectin Type III Domain as a Scaffold for Novel Binding Proteins,” J Mol Biol (1998) 284:1141-1151.
  Kontermann, “Dual targeting strategies with bispecific antibodies,” MAbs (2012) 4(2):182-97.
  Koochekpour et al., “Met and Hepatocyte Growth Factor/Scatter Factor Expression in Human Gliomas,” Cancer Res (1997) 57:5391-5398.
  Koopman et al., “Annexin V for Flow Cytometric Detection of Phosphatidylserine Expression on B Cells Undergoing Apoptosis,” Blood (1994) 84(5):1415-1420.
  Korndorfer et al., “Crystallographic analysis of an “anticalin” with tailored specificity for fluorescein reveals high structural plasticity of the lipocalin loop region,” Proteins (2003) 53(1):121-129.
  Korndorfer et al., “Structural Mechanism of Specific Ligand Recognition by a Lipocalin Tailored for the Complexation of Digoxigenin,” J Mol Biol (2003) 330:385-396.
  Kortt et al., “Dimeric and trimeric antibodies: high avidity scFvs for cancer targeting,” Biomol Eng (2001) 18(3):95-108.
  Kramer et al., “A novel helper phage that improves phage display selection efficiency by preventing the amplification of phages without recombinant protein,” Nucleuic Acids Research (2003) 31(11):e59.
  Krebs et al., “High-throughput generation and engineering of recombinant human antibodies,” J Immunol Methods (2001) 254(1-2):67-84.
  Krosen et al., “Bispecific antibodies for treatment of cancer in experimental animal models and man,” Advanced Drug Delivery Reviews (1998) 31:105-129.
  Kruse et al., “Tissue Culture, Methods and Applications,” Academic Press, New York (1973) p. 868.
  Ku et al, “Alternate protein frameworks for molecular recognition,” Proc Natl Acad Sci USA (1995) 92:6552-6556.
  Kuhlman et al., “Design of a Novel Globular Protein Fold with Atomic-Level Accuracy,” Science (2003) 302:1364-1368.
  Kunkel et al., “Rapid and efficient site-specific mutagenesis without phenotypic selection,” Proc Natl Acad Sci USA (1985) 82:488-492.
  Kwakkenbos et al., “Generation of stable monoclonal antibody-producing BCR+ human memory B cells by genetic programming,” Nat Med (2010) 16(1):123-128.
  Kwaks et al., “Employing epigenetics to augment the expression of the therapeutic proteins in mammalian cells,” TRENDS in Biotechnology (2006) 24(3):137-142.
  Kwaks et al., “Identification of anti-repressor elements that confer high and stable protein production in mammalian cells,” Nat Biotechnol (2003) 21(5):553-558.
  Lang et al., “Immunotherapy with Human Monoclonal Antibodies,” J Immunol (1993) 151(1):466-472.
  Larbouret et al., “In vivo therapeutic synergism of anti-epidermal growth factor receptor and anti-HER2 monoclonal antibodies against pancreatic carcinomas,” Clin Cancer Res (2007) 13(11):3356-3362.
  Larrick et al., “Producing proteins in transgenic plants and animals,” Curr Opin Biotechnol (2001) 12(4):411-418.
  Lazar et al., “A molecular immunology approach to antibody humanization and functional optimization,” Molecular Immunology (2007) 44:1986-1998.
  Lefranc et al., “Nomenclature of the human immunoglobulin kappa (IGK) genes,” Exp Clin Immunogenet (2001) 18:161-174.
  Lekkerkerker et al., “Phage antibodies against human dendritic cell subpopulations obtained by flow cytometry-based selection on freshly isolated cells,” J Immunol Methods (1999) 231(1-2):53-63.
  Lenz et al., “Expression of heterobispecific antibodies by genes transfected into producer hybridoma cells,” Gene (1990) 87(2):213-218.
  Li et al., “Stable expression of three genes from a tricistronic retroviral vector containing a picornavirus and 9-nt cellular internal ribosome entry site elements,” J Virol Methods (2004) 115(2):137-144.
  Lie et al., “Advances in quantitative PCR technology: 5′ nuclease assays,” Current Opinion in Biotechnology (1998) 9:43-48.
  Lindhofer et al., “Preferential species-restricted heavy/light chain pairing in rat/mouse quadromas. Implications for a single-step purification of bispecific antibodies,” J Immunol (1995) 55(1):219-225.
  Ling et al., “Modulation of the murine immune response to human IgG by complexing with monoclonal antibodies,” Immunology (1987) 62:1-6.
  Little et al., “Human antibody libraries in Escherichia coli,” J Biotechnol (1995) 41(2-3):187-195.
  Little, “Recombinant Antibodies for Immunotherapy,” Cambridge University Press (2009) 1st edition, 21 pages.
  Lobato et al., “Intracellular antibodies and challenges facing their use as therapeutic agents,” Trends Mol Med (2003) 9(9):390-396.
  Lofgren et al., “Comparing ELISA and surface plasmon resonance for assessing clinical immunogenicity of panitumumab,” The Journal of Immunology (2007) 178:7467-7472.
  Logtenberg, “Antibody cocktails: next-generation biopharmaceuticals with improved potency,” Trends Biotechnol (2007) 25(9):390-394.
  Lonberg et al., “Antigen-specific human antibodies from mice comprising four distinct genetic modifications,” Nature (1994) 368:856-859.
  Lonberg, “Human antibodies from transgenic animals,” Nature Biotechnology (2005) 23(9):1117-1125.
  Lonberg, “Fully human antibodies from transgenic mouse and phage display platforms,” Curr Opin Immunol (2008) 20(4):450-459.
  Love et al., “A microengraving method for rapid selection of single cells producing antigen-specific antibodies,” Nature Biotechnology (2006) 24(6):703-707.
  Lu et al., “Acquired antagonistic activity of a bispecific diabody directed against two different epitopes on vascular endothelial growth factor receptor 2,” J Immunol Methods (1999) 230(1-2):159-171.
  Lu et al., “Complete Inhibition of Vascular Endothelial Growth Factor (VEGF) Activities with a Bifunctional Diabody Directed against Both VEGF Kinase Receptors, fms-like Tyrosine Kinase Receptor and Kinase Insert Domain-containing Receptor,” Cancer Res (2001) 61:7002-7008.
  Lu et al., “Identification of the Residues in the Extracellular Region of KDR Important for Interaction with Vascular Endothelial Growth Factor and Neutralizing Anti-KDR Antibodies,” J Biol Chem (2000) 275(19):14321-14330.
  Lu et al., “Selection of High Affinity Human Neutralizing Antibodies to VEGFR2 From a Large Antibody Phage Display Library for Antiangiogenesis Therapy,” Int. J. Cancer (2002) 97:393-399.
  Lucas et al., “High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector,” Nucleic Acids Res (1996) 24(9):1774-1779.
  Ma et al., “Assembly of monoclonal antibodies with IgGI and IgA heavy chain domains in transgenic tobacco plants,” Eur J Immunol (1994) 24:131-138.
  Macatonia et al., “Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells,” J Immunol (1995) 154(10):5071-5079.
  Macatonia et al., “Primary stimulation by dendritic cells induces antiviral proliferative and cytotoxic T cell responses in vitro,” J Exp Med (1989) 169(4):1255-1264.
  MacDonald et al., “Precise and in situ genetic humanization of 6 Mb of mouse immunoglobulin genes,” Proc Natl Acad Sci U S A (2014) 111(14):5147-5152.
  Macejak et al., “Internal initiation of translation mediated by the 5′ leader of a cellular mRNA,” Nature (1991) 353(6339):90-94.
  Manen et al., “A sensitive reporter gene system using bacterial luciferase based on a series of plasmid cloning vectors compatible with derivatives of pBR322,” Gene (1997) 186:197-200.
  Manz et al., “Maintenance of serum antibody levels,” Annu Rev Immunol (2005) 23:367-286.
  Mao et al., “Activation of EGFP expression by cre-mediated excision in a new ROSA26 reporter mouse strain,” Blood (2001) 97(1):324-326.
  Marasco, “Intrabodies as antiviral agents,” Curr Top Microbiol Immunol (2001) 260:247-270.
  Marks et al., “By-passing Immunization Human Antibodies from V-gene Libraries Displayed on Phage,” J Mol Biol (1991) 222:581-597.
  Marks, “Deciphering antibody properties that lead to potent botulinum neurotoxin neutralization,” Mov Disord (2004) 19(Suppl 8):S101-S108.
  Marvin et al., “Recombinant approaches to IgG-like bispecific antibodies,” Acta Pharmacol Sin (2005) 26(6):649-658.
  Massengale et al., “CD20-negative relapse of cutaneous B-cell lymphoma after anti-CD20 monoclonal antibody therapy,” J Am Acad Dermatol (2002) 46(3):441-443.
  Matsuda et al., “The Complete Nucleotide Sequence of the Human Immunoglobulin Heavy Chain Variable Region Locus,” J Exp Med (1998) 188(11):2151-2162.
  Mattheakis et al., “An in vitro polysome display system for identifying ligands from very large peptide libraries,” Proc Natl Acad Sci U S A (1994) 91:9022-9026.
  Mayer, “A new set of useful cloning and expression vectors derived from ρBlueScript,” Gene (1995) 163(1):41-46.
  McBurney et al., “Evidence for Repeat-Induced Gene Silencing in Cultured Mammalian Cells: Inactivation of Tandem Repeats of Transfected Genes,” Exp Cell Res (2002) 274(1):1-8.
  McCafferty et al., “Antibody engineering,” (1996) Oxford University Press 178 pages.
  McClanahan et al., “Hematopoietic Growth Factor Receptor Genes as Markers of Lineage Commitment During in Vitro Development of Hematopoietic Cells,” Blood (1993) 81(11):2903-2915.
  McConnell et al., “Tendamistat as a Scaffold for Conformationally Constrained Phage Peptide Libraries,” J Mol Biol (1995) 250:460-470.
  McGinnes et al., “B-Lineage colonies from normal, human bone marrow are initiated by B cells and their progenitors,” Blood (1991) 77(5):961-970.
  Meijer et al., “Isolation of human antibody repertoires with preservation of the natural heavy and light chain pairing,” J Mol Biol (2006) 358:764-772.
  Mendel et al., “The Angiogenesis Inhibitor SU5416 Has Long-lasting Effects on Vascular Endothelial Growth Factor Receptor Phosphorylation and Function,” Clin Cancer Res (2000) 6:4848-4858.
  Merchant et al., “An efficient route to human bispecific IgG,” Nat Biotechnol (1998) 16(7):677-681.
  Merus prior art P61090-/P6498-/P67824, dated Jul. 12, 2016, 4 pages.
  Merus prior art P61090-/P6498-/P67824, dated Oct. 18, 2016, 39 pages.
  Merus prior art P85261, dated Jul. 19, 2016, 4 pages.
  Merus prior art P85261, dated Oct. 21, 2016, 17 pages.
  Merus prior art P99390, dated Sep. 30, 2016, 9 pages.
  Meyer et al., “The importance of the 3′-enhancer region in immunoglobulin χ gene expression,” Nucleic Acids Research (1990) 18(19):5609-5615.
  Meyer et al., “The Igκ 3′—enhancer triggers gene expression in early B lymphocytes but its activity is enhanced on B cell activation,” International Immunology (1996) 8(10):1561-1568.
  Middendorp et al., “Cellular maturation defects in Bruton's tyrosine kinase-deficient immature B cells are amplified by premature B cell receptor expression and reduced by receptor editing,” The Journal of Immunology (2004) 172:1371-1379.
  Middendorp et al., “Impaired precursor cell differentiation in Bruton's tyrosine kinase-deficient mice,” The Journal of Immunology (2002) 168:2695-2703.
  Mirick et al., A review of human anti-globulin antibody (HAGA, HAMA, HACA, HAHA) responses to monoclonal antibodies not four letter words, QJ Nucl Med Mol Imaging (2004) 48:251-257.
  Mohapatra et al., “Designer monoclonal antibodies as drugs: the state of the art,” Expert Rev Clin Immunol (2008) 4(3):305-307.
  Morimoto et al., “High level expression of a human rabies virus-neutralizing monoclonal antibody by a rhabdovirus-based vector,” J Immunol Methods (2001) 252(1-2):199-206 (Abstract).
  Morrison, “Transfectomas Provide Novel Chimeric Antibodies,” Science (1985) 229(4719):1202-1207.
  Mostoslavsky et al., “Asynchronous replication and allelic exclusion in the immune system,” Nature (2001) 414:221-225.
  Murakami et al., “Splenic CD19 cd35+B220+ cells function as an inducer of follicular dendritic cell network formation,” Blood (2007) 110(4):1215-1224.
  Muyldermans, “Single domain camel antibodies: current status,” J Biotechnol (2001) 74(4):277-302.
  Nahta et al., “The HER-2-Targeting Antibodies Trastuzumab and Pertuzumab Synergistically Inhibit the Survival of Breast Cancer Cells,” Cancer Res (2004) 64:2343-2346.
  Nair et al., “Induction of Primary, Antiviral Cytotoxic, and Proliferative Responses with Antigens Administered via Dendritic Cells,” J Virol (1993) 67(7):4062-4069.
  Nanbru et al., “Alternative Translation of the Proto-oncogene c-myc by an Internal Ribosome Entry Site,” J Biol Chem (1997) 272(51):32061-32066.
  Nelson et al., “Development trends for human monoclonal antibody therapeutics,” Nat Rev Drug Discov (2010) 9(10):767-774.
  Nemazee, “Receptor Editing in B Cells,” Advances in Immunology (2000)74:89-126.
  Nemazee, “Receptor editing in lymphocyte development and central tolerance,” Nat Rev Immunol (2006) 6(10):728-740.
  Neufeld et al., “Vascular endothelial growth factor (VEGF) and its receptors,” FASEB J (1999) 13(1):9-22.
  Ngo et al., “Identification of functional synergism between monoclonal antibodies. Application to the enhancement of plasminogen activator inhibitor-1 neutralizing effects,” FEBS (1997) 416:373-376.
  Nicholson et al., “Antibody repertoires of four- and five-feature translocus mice carrying human immunoglobulin heavy chain and kappa and lambda light chain yeast artificial chromosomes,” J Immunol (1999) 163(12):6898-6906.
  Nikolic et al., “A subfraction of B220+ cells in murine bone marrow and spleen does not belong to the B cell lineage but has dendritic cell characteristics,” Eur J Immunol (2002) 32:686-692.
  Nissim et al., “Antibody fragments from a ‘single pot’ phage display library as immunochemical reagents,” EMBO J (1994) 13(3):692-698.
  Nord et al., “A combinatorial library of an a-helical bacterial receptor domain,” Protein Engineering (1995) 8(6):601-608.
  Nord et al., “Recombinant human factor VIII-specific affinity ligands selected from phage-displayed combinatorial libraries of protein A,” Eur J Biochem (2001) 268:4269-4277.
  Norderhaug et al., “Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants,” Eur J Biochem (2002) 269:3205-3210.
  Novimmune SA, “Therapeutic Bispecific Antibodies, The Fully-Human Kappa-Lambda Body: Simple, Stable, Smart,” (2013) 2 pages.
  Novobrantseva et al., “Rearrangement and expression of immunoglobulin light chain genes can precede heavy chain expression during normal B cell development in mice,” J Exp Med (1999) 189(1):75-87.
  Nowakowski et al., “Potent neutralization of botulinum neurotoxin by recombinant oligoclonal antibody,” Proc Natl Acad Sci U S A (2002) 99(17):11346-11350.
  Nuemann et al., “Gene transfer into mouse lyoma cells by electroporation in high electric fields,” EMBO J (1982) 1(7):841-845.
  O'Brien et al., “Somatic hypermutation of an immunoglobulin transgene in κ transgenic mice,” Nature (1987) 326:405-409.
  Odegard et al., “Targeting of somatic hypermutation,” Nat Rev Immunol (2006) 6(8):573-583.
  Ogunniyi et al., “Screening individual hybridomas by microengraving to discover monoclonal antibodies,” Nature Protocols (2009) 4(5):767-782.
  Oh et al., “Homeotic gene Antennapedia mRNA contains 5′-noncoding sequences that confer translational initiation by internal ribosome binding,” Genes Dev (1992) 6(9):1643-1653.
  Opposition against European Patent in EP 2314629 from Merus B.V., filed May 18, 2013, 13 pages.
  Orban et al., “Tissue- and site-specific DNA recombination in transgenic mice,” Proc Natl Acad Sci USA (1992) 89:6861-6865.
  Padlan, “A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-binding properties,” Molecular Immunology (1991) 28(4-5):489-498.
  Pasqualucci et al., “BCL-6 mutations in normal germinal center B cells: Evidence of somatic hypermutation acting outside Ig loci,” Proc Natl Acad Sci USA (1998) 95:11816-11821.
  Patel et al., “An improved assay for antibody dependent cellular cytotoxicity based on time resolved fluorometry,” J Immunol Methods (1995)184(1):29-38.
  Pau et al., “The human cell line PER.C6 provides a new manufacturing system for the production of influenza vaccines,” Vaccines (2001) 19:2716-2721.
  Peeters et al., “Production of Antibodies and Antibody Fragments in Plants,” Vaccine (2001) 19 (17-19):2756-2761.
  Pelanda et al., “A prematurely expressed Igκ transgene, but not a VκJκ gene segment targeted into the Igκ locus, can rescue B cell development in λ5-deficient mice,” Immunity (1996) 5:229-239.
  Peled et al., “The biochemistry of somatic hypermutation,” Annu Rev Immunol (2008) 26:481-511.
  Perrin et al., “In vitro rabies vaccine potency appraisal by ELISA: advantages of the immunocapture method with a neutralizing anti-glycoprotein monoclonal antibody,” Biologicals. (1990) 18(4):321-330.
  Persic et al., “An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries,” Gene (1997) 187(1):9-18.
  Persson et al., “A focused antibody library for improved hapten recognition,” J Mol Biol (2006) 357:607-620.
  Phan et al., “High affinity germinal center B cells are actively selected into the plasma cell compartment,” J Exp Med (2006) 203(11):2419-2424.
  Phelps et al., “Expression and characterization of a chimeric bifunctional antibody with therapeutic applications,” J Immunol (1990) 145(4):1200-1204.
  Pluckthun et al., “In vitro selection and evolution of proteins,” Adv Protein Chem (2000) 55:367-403.
  Ponsel et al., “High Affinity, developability and functional size: the holy grail of combinatorial antibody library generation,” Molecules (2011) 16:3675-3700.
  Pollock et al., “Transgenic milk as a method for the production of recombinant antibodies,” J Immunol Methods (1999) 231(1-2):147-157.
  Popov et al., “A human immunoglobulin λ locus is similarly well expressed in mice and humans,” J Exp Med (1999) 189(10):1611-1619.
  Porgador et al., “Bone Marrow-generated Dendritic Cells Pulsed with a Class I-restricted Peptide Are Potent Inducers of Cytotoxic T Lymphocytes,” J Exp Med (1995) 182(1): 255-260.
  Poulsen et al., “Limits for antibody affinity maturation and repertoire diversification in hypervaccinated humans,” The Journal of Immunology (2011) 187:4229-4235.
  Prak et al., “Light chain replacement: A new model for antibody gene rearrangement,” J Exp Med (1995) 182:541-548.
  Presta et al., “Engineering of therapeutic antibodies to minimize immunogenicity and optimize function,” Advanced Drug Delivery Reviews (2006) 58:640-656.
  Queen et al., “A humanized antibody that binds to the interleukin 2 receptor,” Proc Natl Acad Sci USA (1989) 86:10029-10033.
  Radic et al., “Ig H and L chain contributions to autoimmune specificities,” J Immunol (1991) 146(1):176-182.
  Rajewsky et al., “Perspectives series: molecular medicine in genetically engineered animals,” J Clin Invest (1996) 98(3):600-603.
  Ravn et al., “By-passing in vitro screening—next generation sequencing technologies applied to antibody display and in silico candidate selection,” Necleic Acids Research (2010) 38(21):e193.
  Rebar et al., “Phage display methods for selecting zinc finger proteins with novel DNA-binding specificities,” Methods Enzymol (1996) 267:129-149.
  Reddy et al., “Monoclonal antibodies isolated without screening by analyzing the variable-gene repertoire of plasma cells,” Nature Biotechnology (2010) 28(9):965-971.
  Reddy et al., “Systems analysis of adaptive immunity by utilization of high-throughput technologies,” Current Opinion in Biotechnology (2011) 22:584-589.
  Rees et al., “Bicistronic Vector for the Creation of Stable Mammalian Cell Lines that Predisposes All Antibiotic-Resistant Cells to Express Recombinant Protein,” BioTechniques (1996) 20:102-110.
  Reiter et al., “An Antibody Single-domain Phage Display Library of a Native Heavy Chain Variable Region: Isolation of Functional Single-domain VH Molecules with a Unique Interface,” J Mol Biol (1999) 290:685-698.
  Repp et al., “Phase I clinical trial of the bispecific antibody MDX-H210 (anti-FcgammaRI x anti-HER-2/neu) in combination with Filgrastim (G-CSF) for treatment of advanced breast cancer,” Br J Cancer (2003) 89(12):2234-2243.
  Retter et al., “Receptor editing occurs frequently during normal B cell development,” J Exp Med (1998) 188(7):1231-1238.
  Retter et al., “Receptor editing: genetic reprogramming of autoreactive lymphocytes,” Cell Biochemistry and Biophysics (1999) 31:81-88.
  Riechmann et al., “Novel folded protein domains generated by combinatorial shuffling of polypeptide segments,” Proc Natl Acad Sci U S A (2000) 97(18):10068-10073.
  Rickert et al., “B lymphocyte-specific, cre-mediated mutagenesis in mice,” Nucleic Acids Research (1997) 25(6):1317-1318.
  Ritchie et al., “Allelic exclusion and control of endogenous immunoglobulin gene rearrangement in kappa transgenic mice,” Nature (1984) 312(5994):517-520.
  Roberts et al., “RNA-peptide fusions for the in vitro selection of peptides and proteins,” Proc Natl Acad Sci USA (1997) 94:12297-12302.
  Roholt et al., “Antibodies of limited heterogeneity: L chains of a single mobility,” Immunochemistry (1970) 7(4):329-340.
  Roitt et al., “Anti-idiotypes as surrogate antigens: structural considerations,” Immunol Today (1985) 6(9):265-267.
  Roitt, Immunology translation, (2000) 3 pages.
  Rojas et al., “Phage antibody fragments library combining a single human light chain variable region with immune mouse heavy chain variable regions,” J Biotechnol (2002) 94(3):287-298.
  Rong et al., “Tumorigenesis induced by coexpression of human hepatocyte growth factor and the human met protooncogene leads to high levels of expression of the ligand and receptor,” Cell Growth Differ (1993) 4(7):563-569.
  Rong et al., “Tumorigenicity of the met Proto-Oncogene and the Gene for Hepatocyte Growth Factor,” Mol Cell Biol (1992) 12(11):5152-5158.
  Rosenberg et al., “T7Select® Phage Display System: A powerful new protein display system based on bacteriophage T7,” (1996) 7 pages.
  Rottgen et al., “A human pancreatic secretory trypsin inhibitor presenting a hypervariable highly constrained epitope via monovalent phagemid display,” Gene (1995) 164:243-250.
  Ruuls et al., “Novel human antibody therapeutics: The age of the Umabs,” Biotechnol journal (2008) 3:1157-1171.
  Sanger et al., “DNA sequencing with chain-terminating inhibitors,” Proc Natl Acad Sci USA (1977) 74(12):5463-5467.
  Santini et al., “Efficient Display of an HCV cDNA Expression Library as C-terminal Fusion to the Capsid Protein D of Bacteriophage Lambda,” J Mol Biol (1998) 282:125-135.
  Sasaki et al., “Canonical NF-κB activity, dispensable for B cell development, replaces BAFF-receptor signals and promotes B cell proliferation upon activation,” Immunity (2006) 24:729-739.
  Schaffitzel et al., “In Vitro Selection and Evolution of Protein-Ligand Interactions by Ribosome Display” Protein-Ligand Interactions and Ribosome Display (2001) 27:517-548.
  Schaffitzel et al., “Ribosome display: an in vitro method for selection and evolution of antibodies from libraries,” J Immunol Methods (1999) 231(1-2):119-135.
  Schmidlin et al., “New insights in the regulation of human B cell differentiation,” Trends Immunol (2009) 30(6):277-285.
  Schlehuber et al., “Tuning ligand affinity, specificity, and folding stability of an engineered lipocalin variant—a so-called ‘anticalin’—using a molecular random approach,” Biophys Chem (2002) 96(2-3):213-328.
  Schmitz et al., “Phage Display: A Molecular Tool for the Generation of Antibodies—A Review,” Placenta (2000) 21(A):S106-112.
  Schnieke et al., “Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts,” Science (1997) 278(5346):2130-2133.
  Schoonjans et al., “A new model for intermediate molecular weight recombinant bispecific and trispecific antibodies by efficient heterodimerization of single chain variable domains through fusion to a Fab-chain,” Biomol Eng (2001) 17(6):193-202.
  Scott, “Mice with a human touch,” Nat Biotechnol (2007) 25(10):1075-1077.
  Segal et al., “Introduction: bispecific antibodies,” J Immunol Methods (2001) 248(1-2):1-6.
  Seibler et al., “Rapid generation of inducible mouse mutants,” Nucleic Acids Research (2003) 31(4):e12.
  Shaffer et al., “In vivo occupancy of the κ light chain enhancer in primary pro- and pre-B cells: A model for κ locus activation,” Immunity (1997) 6:131-143.
  Sharpe et al., “Somatic hypermutation of immunoglobulin χ may depend on sequences 3′ of Cχ and occurs on passenger transgenes,” The EMBO Journal (1991) 10(8):2139-2145.
  Shapiro-Shelef et al., “Regulation of plasma-cell development,” Nature Review Immunol (2005) 5:230-242.
  Shields et al., “High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R,” J Biol Chem (2001) 276(9):6591-6604.
  Shvarts et al., “A senescence rescue screen identifies BCL6 as an inhibitor of anti-proliferative p19ARF-P53 signaling,” Genes & Development (2002) 16:681-686.
  Sidhu et al., “Phage-displayed antibody libraries of synthetic heavy chain complementarity determining regions,” J Mol Biol (2004) 338(2):299-310.
  Simmons et al., “Expression of full-length immunoglobulins in Escherichia coli: rapid and efficient production of aglycosylated antibodies,” J Immunol Methods (2002) 263(1-2):133-147.
  Singer, “Genes & Genomes: A changing perspective,” University Sceince Books (1991) pp. 134-145.
  Sirac et al., “Light chain inclusion permits terminal B cell differentiation and does not necessarily result in autoreactivity,” PNAS (2006) 103(20):7747-7752.
  Sirac et al., “Role of the monoclonal κ chain V domain and reversibility of renal damage in a transgenic model of acquired Fanconi syndrome,” Blood (2006) 108:536-543.
  Sirac et al., “Toward understanding renal fanconi syndrome: step by step advances through experimental models,” Contrib Nephrol (2011) 169:247-261.
  Sjolander et al., “Integrated Fluid Handling System for Biomolecular Interaction Analysis,” Anal Chem (1991) 63:2338-2345.
  Skerra. “‘Anticalins’: a new class of engineered ligand-binding proteins with antibody-like properties,” J Biotechnol (2001) 74(4):257-275.
  Smith et al., “A novel, native-format bispecific antibody triggering T-cell killing of B-cells is robustly active in mouse tumor models and cynomolgus monkeys,” Sci Rep (2015) 5:17943.
  Smith et al., “Characterization of a murine lymphokine distinct from interleukin 2 and interleukin 3 (IL-3) possessing a T-cell growth factor activity and a mast-cell growth factor activity that synergizes with IL-3,” Proc Natl Acad Sci USA (1986) 83:1857-1861.
  Smith et al., “Small Binding Proteins Selected from a Combinatorial Repertoire of Knottins Displayed on Phage,” J Mol Biol (1998) 277:317-332.
  Smith et al., “Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen,” Nature Protocols (2009) 4(3):372-385.
  Smith-Gill et al., “Contributions of immunoglobulin heavy and light chains to antibody specificity for lysozyme and two haptens,” J Immunol (1987) 139:4135-4144.
  Soriano, “Generalized IacZ expression with the ROSA26 cre reporter strain,” Nature Genetics (1999) 21:70-71.
  Spillner et al., “Paratope-based protein identification by antibody and peptide phage display,” Anal Biochem (2003) 321(1):96-104.
  M70120EPEIN opposition documents (P22), dated Jun. 21, 2016, 108 pages.
  Spiridon et al., “Targeting multiple her-2 epitopes with monoclonal antibodies results in improved antigrowth activity of a human breast cancer cell line in vitro and in vivo,” Clin Cancer Research (2002) 8:1720-1730.
  Srinivas et al., “Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus,” BMC Developmental Biology (2001) 1:4 8 pages.
  Stein et al., “Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia,” Mol Cell Biol (1998) 18(6):3112-3119.
  Stevens, “Human Antibody Discovery, VelocImmune—A novel platform,” Pharma Focus Asia (2008) 8:72-74.
  Stevenson et al., “DNA vaccines to attack cancer,” PNAS (2004) 101(sup 2):14646-14652.
  Stijlemans et al., “Efficient Targeting of Conserved Cryptic Epitopes of Infectious Agents by Single Domain Antibodies,” J Biol Chem (2004) 279(2):1256-1261.
  Stoneley et al., “C-Myc 5′ untranslated region contains an internal ribosome entry segment,” Oncogene (1998) 16, 423-428.
  Storb et al., “Transgenic mice with μ and κ genes encoding antiphosphorylcholine antibodies,” J Exp Med (1986) 164:627-641.
  Storb et al., “Immunoglobulin transgenes as targets for somatic hypermutation,” Int J Dev Biol (1998) 42:977-982.
  Story et al., “Profiling antibody responses by multiparametric analysis of primary B cells,” PNAS (2008) 105(46):17902-17907.
  Strelkauskas et al., “Human monoclonal antibody: 2. Simultaneous expression of IgG and IgM with similar binding specificities by a human hybrid clone,” Hybridoma (1987) 6(5):479-487.
  Struhl et al., “High-frequency transformation of yeast: Autonomous replication of hybrid DNA molecules,” Proc Natl Acad Sci USA (1979) 76( 3):1035-1039.
  Szabo et al., “Surface plasmon resonance and its use in biomolecular interaction analysis (BIA),” Curr Opin Struct Biol (1995) 5(5):699-705.
  Tada et al., “Expression and characterization of a chimeric bispecific antibody against fibrin and against urokinase-type plasminogen activator,” J Biotechnol (1994) 33(2):157-174.
  Tajiri et al., “Cell-microarray analysis of antigen-specific B-cells: single cell analysis of antigen receptor expression and specificity,” Cytometry (2007) 71A:961-967.
  Takahashi et al., “Role of thrombospondin-1 in hypoxia-induced migration of human vascular smooth muscle cells,” Yakugaku Zasshi (2008) 128(3):377-383 (English abstract included).
  Takai et al., “B cell stimulatory factor-2 is involved in the differentiation of cytotoxic T lymphocytes,” J Immunol (1988) 140(2):508-512.
  Takai et al., “Requirement for three distinct lymphokines for the induction of cytotoxic T lymphocytes from thymocytes,” J Immunol (1986) 137(11):3494-3500.
  Tan et al., “Superhumanized” Antibodies: Reduction of immunogenic potential by complementarity-determining region grafting with human germline sequences: Application to anti-CD28, The Journal of Immunology (2002) 169:1119-1125.
  Tanaka et al., “De novo production of diverse intracellular antibody libraries,” Nucleic Acids Res (2003) 31(5):e23.
  Tanha et al., “Selection by phage display of llama conventional VH fragments with heavy chain antibody VHH properties,” J Immunol Methods (2002) 263:97-109.
  Taylor et al., “A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins,” Nucleic Acids Research (1992) 20(23):6287-6295.
  Thiebe et al., “The variable genes and gene families of the mouse immunoglobulin χ locus,” Eur J Immunol (1999) 29:2072-2081.
  Thomassen et al., “Large-scale production of VHH antibody fragments by Saccharomyces cerevisiae,” Enzyme and Microbial Technology (2002) 30:273-278.
  Thotakura et al., “Glycoprotein hormones: glycobiology of gonadotrophins, thyrotrophin and free α subunit,” Glycoblology (1995) 5(1):3-10.
  Throbsy et al., “Isolation and characterization of human monoclonal antibodies from individuals infected with west nile virus §,” Journal of Virology (2006) 80(14):6982-6992.
  Tiller et al., “Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning,” Journal of Immunological Methods (2008) 329:112-124.
  Toki et al., “Analyses of T-cell differentiation from hemopoietic stem cells in the GO phase by an in vitro method,” Proc Natl Acad Sci USA (1991) 88:7548-7551.
  Tokimitsu et al., “Single lymphocyte analysis with a Microwell array chip,” Cytometry (2007) 71A:1003-1010.
  Torres et al., “Laboratory protocols for conditional gene targeting,” Oxford University Press (1997) 15 pages.
  Traggai et al., “An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus,” Nature Medicine (2004) 10(8):871-875.
  Transue et al., “Camel single-domain antibody inhibits enzyme by mimicking carbohydrate substrate,” Proteins (1998) 32(4):515-522.
  Urlaub et al., “Isolation of Chinese hamster cell mutants deficient in dihydrofolate reductase activity,” Proc Natl Acad Sci USA (1980) 77(7): 4216-4220.
  Vagner et al., “Alternative Translation of Human Fibroblast Growth Factor 2 mRNA Occurs by Internal Entry of Ribosomes,” Mol Cell Biol (1995) 15(1): 35-44.
  Vajdos et al., “Comprehensive functional maps of the antigen-binding site of an anti-ErbB2 antibody obtained with shotgun scanning mutagenesis,” J Mol Biol (2002) 320(2):415-428.
  Valenzuela et al., “High-throughput engineering of the mouse genome coupled with high-resolution expression analysis,” Nat Biotechnol (2003) 21(6):652-659.
  Van Den Berg, “Formulation and delivery of dermal DNA vaccines,” Gildeprint Drukkerijen B.V (2009) 160 pages.
  Van Den Beunken et al., “Building Novel Binding Ligands to B7.1 and B7.2 Based on Human Antibody Single Variable Light Chain Domains,” J Mol Biol (2001) 310:591-601.
  Van Der Heijden et al., “Structural and functional studies on a unique linear neutralizing antigenic site (G5) of the rabies virus glycoprotein,” J Gen Virol (1993) 74(Pt 8):1539-1545.
  Van Der Vuurst De Vries et al., “Dissecting the human peripheral B-cell compartment with phage display-derived antibodies,” Immunology (1999) 98:55-62.
  Vaughan et al., “Human antibodies with sub-nanomolar affinities isolated from a large non-immunized phage display library,” Nat Biotechnol (1996) 14(3):309-314.
  Verma et al., “Antibody engineering: Comparison of bacterial, yeast, insect and mammalian expression systems,” J Immunol Methods (1998) 216:165-181.
  Wang et al., “A T cell-independent antitumor response in mice with bone marrow cells retrovirally transduced with an antibody/Fc-gamma chain chimeric receptor gene recognizing a human ovarian cancer antigen,” Nat Med (1998) 4(2):168-172.
  Ward et al., “Binding activities of a repertoire of single immunoglobulin variable domains secreted from Escherichia coli,” Nature (1989) 341:544-546.
  Warnaar et al., “Purification of Bispecific F(ab′)2 from Murine Trinoma OC/TR with Specificity for CD3 and Ovarian Cancer,” Hybridoma (1994) 13(6):519-526.
  Weeratna et al., “CPG ODN allows lower dose of antigen against hepatitis B surface antigen in BALB/c mice,” Immunology and Cell Biology (2003) 81:59-62.
  Weinberger et al., “Cellular interactions in the generation of cytolytic T lymphocyte responses: Role of la-positive splenic adherent cells in presentation of H-2 antigen,” Proc Natl Acad Sci USA (1980) 77(10):6091-6095.
  Weinberger et al., “Cellular interactions in the generation of cytolytic T lymphocyte responses. Analysis of the helper T cell pathway,” Eur J Immunol (1981) 11(5):405-411.
  Weiner et al., “Fully human therapeutic monoclonal antibodies,” J Immunother (2006) 29(1):1-9.
  Wen et al., “Tricistronic viral vectors co-expressing interleukin-12 (1L-12) and CD80 (B7-1) for the immunotherapy of cancer: Preclinical studies in myeloma,” Cancer Gene Ther (2001) 8(5):361-370.
  Whittington et al., “DNA vaccination controls Her-2+ tumors that are refractory to targeted therapies,” Cancer Res (2008) 68(18):7502-7511.
  Wigler et al., “Biochemical Transfer of Single-Copy Eucaryotic Genes Using Total Cellular DNA as Donor,” Cell (1978) 14:725-731.
  Wilmut et al., “Basic techniques for transgenesis,” J Reprod Fertil Suppl (1991) 43:265-275.
  Wilmut et al., “Viable offspring derived from fetal and adult mammalian cells,” Nature (1997) 385(6619):810-813.
  Winter et al., “Insertion of 2 KB of bacteriophage DNA between an immunoglobulin promoter and leader exon stops somatic hypermutation in a κ transgene,” Molecular Immunology (1997) 34(5):359-366.
  Wrammert et al., “Rapid cloning of high-affinity human monoclonal antibodies against influenza virus,” Nature (2008) 453:667-672.
  Wright et al., “Effect of glycosylation on antibody function: implications for genetic engineering,” Trends Biotechnol (1997) 15(1):26-32.
  Wu et al., “Simultaneous targeting of multiple disease mediators by a dual-variable-domain immunoglobulin,” Nature Biotechnology (2007) 25(11):1290-1297.
  Wunderlich et al., “Generation of inducible Cre systems for conditional gene inactivation in mice,” der Universitat zu Koln (2004) 413 pages.
  X59315 Annotation, “IMGT/LIGM-DB sequence,” (2016) 13 pages.
  Xiang et al., “The downstream transcriptional enhancer, Ed, positively regulates mouse Igκ gene expression and somatic hypermutation,” The Journal of Immunology(2008) 180:6725-6732.
  Yang et al., “Control of gene conversion and somatic hypermutation by immunoglobulin promoter and enhancer sequences,” J Exp Med (2006) 203(13):2919-2928.
  Yarlin, “Fundamentals of Immunology,” Meditsina (1999) 2 pages.
  Ye et al., “Ultrabithorax and Antennapedia 5′ Untranslated Regions Promote Developmentally Regulated Internal Translation Initiation,” Mol Cell Biol (1997) 17(3):1714-1721.
  Yelverton et al., “Rabies virus glycoprotein analogs: biosynthesis in Escherichia coli,” Science (1983) 219(4585):614-620.
  Yu et al., “An optimized electrofusion-based protocol for generating virus-specific human monoclonal antibodies,” Journal of Immunological Methods (2008) 336:142-151.
  Yoo et al., “Structural Requirements for Polymeric Immunoglobulin Assembly and Association with J Chain,” J Biol Chem (1999) 274(47): 33771-33777.
  Yoshio-Hoshino et al., “Establishment of a new interleukin-6 (IL-6) receptor inhibitor applicable to the gene therapy for IL-6-dependent tumor,” Cancer Res (2007) 67(3):871-875.
  Zacharchuk et al., “Programmed T lymphocyte death. Cell activation- and steroid-induced pathways are mutually antagonistic,” J Immunol (1990) 145(12):4037-4045.
  Zamai et al., “Optimal Detection of Apoptosis by Flow Cytometry Depends on Cell Morphology,” Cytometry (1993)14:891-897.
  Zhan-Zabel et al., “Development of stable cell lines for production or regulated expression using matrix attachment regions,” J Biotech (2001) 87:29-42.
  Zhu et al., “Inhibition of tumor growth and metastasis by targeting tumor-associated angiogenesis with antagonists to the receptors of vascular endothelial growth factor,” Invest New Drugs (1999) 17(3):195-212.
  Zhu et al., “Inhibition of Vascular Endothelial Growth Factor-induced Receptor Activation with Anti-Kinase Insert Domain-containing Receptor Single-Chain Antibodies from a Phage Display Library,” Cancer Res (1998) 58:3209-3214.
  Zhu et al., “Remodeling domain interfaces to enhance heterodimer formation,” Protein Science (1997) 6:781-788.
  Zou et al., “Generation of mouse strain that produces immunoglobulin κ chains with human constant regions,” Science (1993) 262:1271-1274.
  Zubler et al., “Theoretical and practical aspects of B-cells activation: murine and human systems,” Immunological Reviews (1987) 99:281-299.
  Abstract of Japanese patent application 2006109711, dated Apr. 27, 2006, 1 page.
  First witness statement of Andrew Joseph Murphy, dated Oct. 2, 2015, 19 pages.
  Mazor et al., “Isolation of engineered, full-length antibodies from libraries expressed in Escherichia coli,” Nature Biotechnology (2007) 25(5):563-565.
  Documents cited in opposition to Merus B.V. AU application No. 2009263082 by Regeneron Pharmaceuticals, Inc, dated Oct. 10, 2016, 5 pages.
  Opposition against Japanese Patent application 5749161, dated Jan. 15, 2016, 55 pages.
  Notice of Reasons for Revocation for JP 5749161, dated Mar. 17, 2016, 8 pages.
  Third party observations under article 115 EPC against European Parent Application No. 09075279.1 in the name of Merus BV, dated Apr. 25, 2012, 6 pages.
  Third party observation against European Parent Application No. 09075279.1 in the name of Merus BV, dated Aug. 28, 2013, 11 pages.
  Patent Oppositions Application No. 2009263082, dated May 4, 2015, 3 pages.
  Information sheet for submitted publications for JP Application No. 2011-516168, dated Apr. 25, 2012, 3 pages.
  Patent applicant's outline of submissions for Australian patent application 2009263082, dated Sep. 6, 2016, 49 pages.
  Australian opposition procedure, dated Jun. 27, 2014, 1 page.
  Communication pursuant to Rule 114(2) EPC, dated Nov. 5, 2012, 7 pages.
  Notification of material filed under section 27, dated Apr. 1, 2014, 1 page.
  Content of Arguments, dated Jun. 21, 2016, 25 pages.
  Documents regarding Opposition (Declaration of Peter Hudson and Robert Brink), dated Jun. 2, 2015, 1 page.
  Opponent's final supplementary submissions, dated Oct. 19, 2016, 4 pages.
  Declaration of Christopher Goodnow, dated Oct. 16, 2016, 13 pages.
  Opponent's initial supplementary submissions, dated Oct. 5, 2016, 7 pages.
  Letter enclosing written submissions and fee, dated May 18, 2015, 1 page.
  M70120EPEIN opposition documents (P1), dated Jun. 21, 2016, 80 pages.
  M70120EPEIN opposition documents (P2), dated Jun. 21, 2016, 61 pages.
  M70120EPEIN opposition documents (P3), dated Jun. 21, 2016, 71 pages.
  M70120EPEIN opposition documents (P4), dated Jun. 21, 2016, 80 pages.
  M70120EPEIN opposition documents (P5), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P6), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P7), dated Jun. 21, 2016, 60 pages.
  M70120EPEIN opposition documents (P8), dated Jun. 21, 2016, 60 pages.
  M70120EPEIN opposition documents (P9), dated Jun. 21, 2016, 60 pages.
  M70120EPEIN opposition documents (P10), dated Jun. 21, 2016, 60 pages.
  M70120EPEIN opposition documents (P11), dated Jun. 21, 2016, 60 pages.
  M70120EPEIN opposition documents (P12), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P13), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P14), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P15), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P16), dated Jun. 21, 2016, 80 pages.
  M70120EPEIN opposition documents (P17), dated Jun. 21, 2016, 70 pages.
  M70120EPEIN opposition documents (P18), dated Jun. 21, 2016, 70 pages.
  M70120EPEIN opposition documents (P19), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P20), dated Jun. 21, 2016, 100 pages.
  M70120EPEIN opposition documents (P21), dated Jun. 21, 2016, 80 pages.
  M70120EPEIN Proprietor documents (P1), dated Jul. 27, 2016, 100 pages.
  M70120EPEIN Proprietor documents (P2), dated Jul. 27, 2016, 100 pages.
  M70120EPEIN Proprietor documents (P3), dated Jul. 27, 2016, 80 pages.
  M70120EPEIN Proprietor documents (P4), dated Jul. 27, 2016, 57 pages.
  M70120EPEIN Proprietor EPA document, dated Jan. 12, 2016, 51 pages.
  M70121EPEIN Oppo EPA (P1), dated Jul. 27, 2016, 60 pages.
  M70121EPEIN Oppo EPA (P2), dated Jul. 27, 2016, 60 pages.
  M70121EPEIN Oppo EPA (P3), dated Jul. 27, 2016, 50 pages.
  M70121EPEIN Oppo EPA (P4), dated Jul. 27, 2016, 60 pages.
  M70121EPEIN Oppo EPA (P5), dated Jul. 27, 2016, 80 pages.
  M70121EPEIN Oppo EPA (P6), dated Jul. 27, 2016, 90 pages.
  M70121EPEIN Oppo EPA (P7), dated Jul. 27, 2016, 100 pages.
  M70121EPEIN Oppo EPA (P8), dated Jul. 27, 2016, 80 pages.
  M70121EPEIN Oppo EPA (P9), dated Jul. 27, 2016, 100 pages.
  M70121EPEIN Oppo EPA (P10), dated Jul. 27, 2016, 120 pages.
  M70121EPEIN Oppo EPA (P11), dated Jul. 27, 2016, 100 pages.
  M70121 Epein Oppo EPA (P12), dated Jul. 27, 2016, 60 pages.
  M70121 Epein Oppo EPA (P13), dated Jul. 27, 2016, 59 pages.
  M70121EPEIN Proprietor document (P1), dated Aug. 31, 2016, 100 pages.
  M70121EPEIN Proprietor document (P2), dated Aug. 31, 2016, 80 pages.
  M70121EPEIN Proprietor document (P3), dated Aug. 31, 2016, 60 pages.
  M70121EPEIN Proprietor document (P4), dated Aug. 31, 2016, 60 pages.
  M70121EPEIN Proprietor document (P5), dated Aug. 31, 2016, 100 pages.
  M70121EPEIN Proprietor document (P6), dated Aug. 31, 2016, 100 pages.
  M70121EPEIN Proprietor document (P7), dated Aug. 31, 2016, 80 pages.
  M70121EPEIN Proprietor document (P8), dated Aug. 31, 2016, 80 pages.
  M70121EPEIN Proprietor document (P9), dated Aug. 31, 2016, 90 pages.
  M70121EPEIN Proprietor document (P10), dated Aug. 31, 2016, 70 pages.
  M70121 Epein Proprietor document (P11), dated Aug. 31, 2016, 58 pages.
  Canada Office Action for CA 2,729,095, dated Nov. 10, 2015, 8 pages.
  Response to Office Action for CA 2,729,095, dated May 10, 2016, 12 pages.
  Documents to CA Patent Office, Sep. 16, 2015, 15 pages.
  Voluntary Amendment, dated May 12, 2016, 2 pages.
  M70121PCEPT1 documents(P1), dated Aug. 8, 2016, 100 pages.
  M70121PCEPT1documents (P2), dated Aug. 8, 2016, 100 pages.
  M70121PCEPT1 documents (P3), dated Aug. 8, 2016, 100 pages.
  M70121PCEPT1 documents (P4), dated Aug. 8, 2016, 100 pages.
  M70121PCEPT1 documents (P5), dated Aug. 8, 2016, 100 pages.
  M70121PCEPT1 documents (P6), dated Aug. 8, 2016, 90 pages.
  Roitt et al., “Really Essential Medical Immunology,” Blackwell Science (2000) 17 pages.
  Response to Communication, dated Sep. 29, 2014, 7 pages.
  Declaration of Peter Hudson, dated Jun. 17, 2016, 15 pages.
  Non-final Office Action for JP 2015-097258, dated Apr. 11, 2016, 7 pages.
  Communication of notices of opposition (R. 79(1) EPC), dated Sep. 25, 2014, 1 page.
  Notice of Opposition, dated Jun. 20, 2014, 1 page.
  Notification for JP 2011-516168, dated May 20, 2014, 1 page.
  Third Party Observations, dated Jun. 27, 2013, 16 pages.
  Third Party Observations, dated May 16, 2013, 82 pages.
  Letter regarding Notice of Opposition, dated Jun. 23, 2014, 1 page.
  Opponent counter argument, dated Aug. 22, 2016, 19 pages.
  Canada Office Action for CA 2,729,095, dated Apr. 16, 2014, 1 page (Protest section 10).
  Canada Office Action for CA 2,729,095, dated Apr. 16, 2014, 1 page (Letter).
  Correspondence from Canadian Patent Office, dated Apr. 8, 2014, 16 pages.
  Correspondence from Canadian Patent Office, dated Sep. 16, 2015, 15 pages.
  Statement of Grounds and Particulars, dated Sep. 22, 2014, 35 pages.
  Information in EP 09075279.1, dated Oct. 28, 2016, 1 page.
  Communication of a notice of opposition, dated Aug. 20, 2014, 1 page.
  Response to Communication under Rule 79(1) EPC, dated Apr. 2, 2015, 32 pages.
  Opposition against EP 2147594, dated Aug. 11, 2014, 55 pages.
  Annexure PH-4 (P1), dated Jul. 13, 2009, 37 pages.
  Annexure PH-4 (P2), dated Jul. 13, 2009, 37 pages.
  Carrion et al., “Light chain inclusion permits terminal B cell differentiation and does not necessarily result in autoreactivity,” PANS (2006) 103(20):7747-7752.
  Patent applicant's outline of submissions, dated Sep. 16, 2016, 15 pages.
  Letter regarding new prior art documents, dated Mar. 18, 2014, 8 pages.
  Notification of Material filed under Section 27, dated Oct. 28, 2013, 25 pages.
  Summary of submissions on behalf of Merus B.V, dated May 18, 2015, 6 pages.
  Third party observation, dated May 9, 2014, 14 pages.
  Communication pursuant to Rule 114(2) EPC, dated Oct. 10, 2013, 4 pages.
  Office Action for U.S. Appl. No. 15/140,321, dated Sep. 2, 2016, 58 pages.
  Translation of the pertinent portions of the Action, dated 2016, 11 pages.
  Payment of fees and expenses, dated Nov. 10, 2016, 1 page.
  Notice of Opposition in EP 2701499, dated Nov. 10, 2016, 27 pages.
  Extension of time limit pursuant to Rule 132 EPC, dated Jul. 5, 2016, 6 pages.
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Jun. 29, 2016, 1 page (Fritz Lahrtz).
  Notice of Opposition in EP 2501817, dated May 25, 2016, 28 pages.
  Payment of fees and expenses, dated May 25, 2016, 1 page.
  Annex in EP 14163642.3, dated Jan. 29, 2016, 3 pages.
  Third party observation for application EP 20120783456, dated Jun. 16, 2016, 3 pages.
  Joint Stipulation and Proposed order of invalidity and non-infringement of U.S. Pat. No. 8,502,018, dated Feb. 24, 2015, 7 pages.
  Documents filed by proprietor during opposition, dated Aug. 26, 2016, 8 pages.
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P1).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P2).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P3).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P4).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 120 pages (P5).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P6).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P7).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 80 pages (P8).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 80 pages (P9).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 70 pages (P10).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P11).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (P12).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (P13).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (P14).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P15).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P16).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 50 pages (P17).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 50 pages (P18).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 50 pages (P19).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 50 pages (P20).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P21).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P22).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P23).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (P24).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 100 pages (P25).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (P26).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 139 pages (P27).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P1).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P2).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 140 pages (Potter Clarkson LLP) (P3).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 110 pages (Potter Clarkson LLP) (P4).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P5).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P6).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P7).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 150 pages (Potter Clarkson LLP) (P8).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 120 pages (Potter Clarkson LLP) (P9).
  Communication of further notices of opposition pursuant to Rule 79(2) EPC, dated Aug. 23, 2016, 85 pages (Potter Clarkson LLP) (P10).
  Request for exclusion of file inspection, dated Jul. 12, 2016, 3 pages.
  Bruggemann et al., “A repertoire of monoclonal antibody with human heavy chains from transgenic mice,” PNAS USA (1989) 86:6709-6713.
  Smith et al., “Filamentous fusion phage: Novel expression factors that display cloned antigens on the Virion surface,” Science (1985) 228:1315-1317.
  Third party pre-issuance submission in U.S. Appl. No. 15/140,321, dated Feb. 10, 2017, 19 pages.
  Third party pre-issuance submission in U.S. Appl. No. 15/090,505, dated Feb. 24, 2017, 30 pages.
  Moldenhauer, “Bispecific antibodies from hybrid hybridoma,” Bispecific Antibodies (2011) pp. 29-46.
  Staerz et al., “Hybrid hybridoma producing a bispecific monoclonal antibody that can focus effector T-cell activity,” Proc Natl Acad Sci USA (1986) 83(5):1453-1457.
  Opinion of In re Chu, United States Court of Appeals for the Federal Circuit, decided on Sep. 14, 1995.
  Reply letter of proprietor in response to the opposition proceedings against EP 2264163 B1, dated Dec. 30, 2016.
  Osoegawa et al., “Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis,” Genome Research (2000) 10(1):116-28.
  Herring, CD., “Vector-Hexamer PCR Isolation of All Insert Ends from a YAC Contig of the Mouse Igh Locus,” Genome Research (1998) 8(6):673-81.
  DNA Sequencing Core Website, dated Nov. 21, 2015.
  Schedl et al., “Transgenic mice generated by pronuclear injection of a yeast artificial chromosome,” Nucleic Acids Re (1992) 20(12):3073-3077.
  Mejia et al., “Retrofitting Vectors for Escherichia coli-Based Artificial Chromosomes (PACs and BACs) with Markers for Transfection Studies,” Genome Research (1997) 7(2):179-186.
  Sambrook 3rd ed pp. 2.110-2.111 (2001).
  Sambrook 3rd ed Chapter 5 Protocols 15 and 19.
  NEB 1-Ceul datasheet and heat inactivation table.
  Schindelhauer et al., “Efficient combination of large DNA in vitro: in gel site specific recombination (IGSSR) of PAC fragments containing a satellite DNA and the human HPRT gene locus,” Nucleic Acids Research (1997) 25(11):2241-3.
  Mejia et al., “The Assembly of Large BACs by in Vivo Recombination,” Genomics (2000) 70(2):165-70.
  Shizuya et al., “Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector,” Proc Natl Acad Sci U S A (1992) 89(18):8794-7.
  Sambrook 3rd ed, vol. 1 p. 6.3.
  Sambrook 3rd ed, Chapter 5, Protocol 13.
  Sambrook 3rd ed, Chapter 6, Protocol 2.
  Boren et al., “A Simple and Efficient Method for Making Site-directed Mutants, Deletions, and Fusions of Large DNA Such as PI and BAC Clones,” Genome Res (1996) 6(11): 1123-30.
  DNA Cloning 3, A Practical Approach, 2nd Ed, pp. 112-114.
  Trucksis et al., “The Vibrio cholerae genome contains two unique circular chromosomes,” Proc Natl Acad Sci U S A, (1998) 95(24): 14464-9.
  Potter et al., “Enhancer-dependent expression of human Kc immunoglobulin genes introduced into mouse pre-B lymphocytes by electroporation,” Proc Natl Acad Sci U S A, 1984, 81(22), 7161-5.
  Sambrook 3rd ed, Chapter 16.34, protocol 5.
  Bio-Rad Cat No. 165-2105—Gene Pulser® II Electroporation System Instruction Manual.
  Potter et al., “Transfection by Electroporation,” Curr Prot Mol Biol (2003) Chapter 9:Unit9.3. doi: 10.1002/0471142727.mb0903s92.
  Yang et al., Site-specific gene targeting in mouse embryonic stem cells with intact bacterial artificial chromosomes, Nat Biotechnol., 2003, 21(4):447-51.
  Glaser et al., Current issues in mouse genome engineering, Nat Genet (2005) 37(11):1187-1193.
  Bethke et al., “Segmental genomic replacement by ere-mediated recombination: genotoxic stress activation of the p53 promoter in single-copy transformants,” Nucleic Acids Res (1997) 25(14):2828-2834.
  Mansour, SL., “Disruption of the proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy for targeting mutations to non-selectable genes,” Nature (1988) 336(6197):348-352.
  Muyrers et al., “ET-cloning: think recombination first,” Genetic Engineering (2000) 22:77-98.
  Orford et al., “Engineering EGFP reporter constructs into a 200 kb human beta-globin BAC clone using GET Recombination,” Nucleic Acids Res (2000) 28(18): E84.
  Nefedov et al., “Insertion of disease-causing mutations in BACs by homologous recombination in E coli,” Nucleic Acids Res (2000) 28(17): E79.
  Call et al., “A Cre-lox recombination system for the targeted integration of circular yeast artificial chromosomes into embryonic stem cells,” Hum Mol Genet (2000) 9(12):1745-1751.
  Sambrook 3rd ed Chapter 5.3.
  Angrand, PO. et al; Simplified generation of targeting constructs using ET recombination, Nucleic Acids Res., 1999, 27(17), e16.
  Sambrook 3rd ed Protocol 7 4.48-4.52.
  Nagy., “Cre Recombinase: The Universal Reagent for Genome Tailoring,” Genesis “2000” 26(2):99-109.
  Fox et al., “Fluorescent in situ hybridization (FISH) to mouse chromosomes, Mouse Genetics and Transgenics: A practical approach,” I.J. Jackson, C.M. Abbott (Eds.), Oxford University Press, London (2000), pp. 154-168.
  Rideout et al., “Generation of mice from wild-type and targeted ES cells by nuclear cloning,” Nat Genetics (2000) 24(2):109-110.
  Ramirez-Solis, “Gene Targeting in Embryonic Stem Cells,” Methods Enzymol (1993) 225:855-78.
  Zhang et al., “DNA cloning by homologous recombination in Escherichia coli,” Nat Biotechnol (2000) 18(12):1314-1317.
  Eppig, “Mouse Genome Informatics (MGI): reflecting on 25 years,” Mamm Genome (2015) 26(7-8):272-84. doi: 10.1007/s00335-015-9589-4. Epub Aug. 4, 2015.
  Mouse Genetics and Transgenics: A Practical Approach. I. J. Jackson and C. M. Abbott (eds). Oxford University Press, Oxford. 2000, chapter 7.
  Dietrich et al., “A comprehensive genetic map of the mouse genome,” Nature (1996) vol. 380, pp. 149-152.
  Nusbaum et al., “A YAC-based physical map of the mouse genome,” Nature Genetics (1999) 22(4):388-93.
  Van Etten et al., “Radiation hybrid map of the mouse genome,” Nature Genetics (1999) 22(4):384-7.
  Muyrers et al., “Point mutation of bacterial artificial chromosomes by ET recombination,” EMBO Reports (2000) 1(3):239-43.
  Lee et al., “A Highly Efficient Escherichia coli-Based Chromosome Engineering System Adapted for Recombinogenic Targeting and Subcloning of BAC DNA,” Genomics (2001) 73(1):56-65.
  Sambrook 3rd Ed Chapter 1.21.
  Hill et al., “BAC Trimming: Minimizing Clone Overlaps,” Genomics (2000) 64(1):111-3.
  Sheng et al., “Transformation of Escherichia coli with large DNA molecules by electroporation,” Nucleic Acids Res (1995) 23(11):1990-6.
  NEB PI-Scel datasheet.
  NIH website—Mouse BAC end sequencing project.
  Reyrat et al., “Counterselectable Markers: Untapped Tools for Bacterial Genetics and Pathogenesis,” Infect Immun (1998) 66(9):4011-4017.
  Yu et al., “An efficient recombination system for chromosome engineering in Escherichia coli,” Proc Natl Acad Sci U S A (2000) 97(11):5978-83.
  Murphy; KC., “Use of Bacteriophage Lambda Recombination Functions to Promote Gene Replacement in Escherichia coli,” J Bacteriol (1998) 180(8):2063-71.
  Mouse Genome Data available in public databases, Feb. 2001, NIH.
  Zhao, S., “A Comprehensive BAC Resource,” Nucleic Acids Research (2001) 29(1):141-3.
  Knight, “Mouse genome effort ‘on course’,” Nature (2001) vol. 411, p. 121.
  Waterston et al., “Initial sequencing and comparative analysis of the mouse genome,” Nature (2002) 420(6915):520-62.
  Herring et al., “Vector-Hexamer PCR Isolation of All Insert engds from a YAC Contig of the Mouse Igh Locus,” Genome Research (1998) 8(6): 673-81.
  Factsheet from Opponent1 re MeMo mouse dated 2012.
  MeMo™ the ingenious mouse for improved antibody therapeutics, www.merus.nl.
  Presentation by Cecile Geuijen, May 27, 2013: Full length human IgG bispecific antibodies for cancer therapy.
  Feeney et al., “Dst4: a new, and probably the last, functional Dh gene in the BALB/c mouse,” Immunogenetics (1993) 37(3):217-21.
  Mainville et al., “Deletion al Mapping of Fifteen Mouse VH Gene Families Reveals a Common Organization for Three Igh Haplotypes,” Journal of Immunology (1996) 156(3):1038-46.
  D'Eustachio et al., “Mouse Chromosome 12,” Mammalian Genome (1998) 8:S241-S257.
  Weigert et al., “The genetic control of antibody variable regions in the mouse,” Springer Seminars in Immunopathology (1978) 1:133-169.
  Riblet et al., “Polymorphism and evolution of Igh-V gene families,” Curr. Top. Microbial. Immunol. (1986) 127:168.
  Thiebe et al., The variable genes and gene families of the mouse immunoglobulin kappa locus, Eur J Immunol (1999) 29(7):2072-81.
  Richards-Smith, BA. et al., “Deletion mapping of the mouse ornithine decarboxylase-related locus Odc-rs8 within Igh-V,” Mammalian Genom (1992) 3(10):568-74.
  Extract from Fundamental Immunology, 4th Edition, Paul, W.E., Lippincott-Raven (1999).
  Materials from examination of a European Patent Application No. 09075279.1 in the name of O1, Apr. 23, 2013.
  Kawasaki et al., “Evolutionary dynamics of the human immunoglobulin k locus and the germ line repertoire of the Vk genes,” Eur J Immunol (2001) 31(4):1017-28.
  O'Connor et al., “Construction of Large DNA Segments in Escherichia coli,” Science (1989) 244(4910):1307-12.
  Red/ET Recombination guide (Gene Bridges).
  Sambrook 3rd ed vol. 3 p. 16.54-16.57.
  Zheng et al., “Engineering Mouse Chromosomes with Cre-IoxP: Range, Efficiency, and Somatic Applications,” Mol Cel Bio (2000) 20(2):648-55.
  Wade-Martins et al., “Long-term stability of large insert genomic DNA episomal shuttle vectors in human cells,” Nucleic Acids Res (1999) 27(7):1674-82.
  Macdonald et al., Poster 2006—Velocigene® Technology Extended to Humanization of Several Megabases of Complex.
  Abstract to 2006 Macdonald poster (1st International Mugen Conference Sep. 2006, Athens).
  Stevens et al., Poster 2006—VelocImmune™: Humanization of immunoglobulin loci using VelociGene® technology.
  Abstract to 2006 Stevens poster (1st International Mugen Conference Sep. 2006, Athens).
  Sambrook 3d Ed 4.82-4.85.
  Sauer, “Inducible gene targeting in mice using the Cre/loxSystem”, Methods (1998) 14(4):381-392.
  Sambrook 3rd Ed 12.10-12.13, protocol 1.
  Presentation by Open Monoclonal Technology, Inc (Nov. 3, 2013), http://www.openmonoclonaltechnology.com/downloads.html.
  Lonberg, “Human Monoclonal Antibodies from Transgenic Mice,” Handb Exp Pharmacol (2008) 181:69-97.
  Vasicek et al., “B-less: a Strain of Profoundly B Cell-deficient Mice Expressing a Human lambda Transgene,” J Exp Med (1992) 175(5):1169-80.
  Declaration of Sir Martin Evans dated Dec. 23, 2016 in opposition proceedings EP2264163.
  Declaration of Professor Kenan Murphy dated Dec. 29, 2016 in opposition proceedings EP2264163.
  Declaration of Dr Werner Muller dated Dec. 22, 2016 in opposition proceedings EP2264163.
  Declaration of Dr Andrew Murphy dated Dec. 21, 2016 in opposition proceedings EP2264163.
  Declaration of Dr Lynn Macdonald dated Dec. 20, 2016 in opposition proceedings EP2264163.
  Declaration of Professor Hidde Ploegh dated Dec. 23, 2016 in opposition proceedings EP2264163.
  Declaration of Andrew Murphy originally submitted for the EP1360287 Opposition (including appendices), dated Jan. 27, 2014.
  Declaration and CV of Anthony De Franco originally submitted for the EP1360287 Opposition, dated Sep. 2, 2014.
  Statement of Professor Ishida submitted in the UK High Court, first witness statement in UK litigation (The High Court of Justice, Chancery Division, Patents Court, Case No. HP-2013-000001/HP-2014-000001 dated Sep. 3, 2015, Report relates to a patent owned by Regeneron Pharmaceuticals, Inc., EP 2264163).
  Statement of Professor Anthony De Franco, first witness statement in UK litigation (The High Court of Justice, Chancery Division, Patents Court, Case No. HP-2013-000001/HP-2014-000001 dated Oct. 3, 2015, Report relates to a patent owned by Regeneron Pharmaceuticals, Inc., EP 2264163).
  Statement of Dr Yancopoulos, first witness statement in UK litigation (The High Court of Justice, Chancery Division, Patents Court, Case No. HP-2013-000001/HP-2014-000001 dated Oct. 2, 2015, Report relates to a patent owned by Regeneron Pharmaceuticals, Inc., EP 2264163).
  Hansen et al., “Crescendo's Cash Fragments,” BioCentury, The BernsteinReport on BioBusiness, Dec. 23, 2013, p. A13.
  Declaration and CV of Craig Bassing, originally submitted for the EP1360287 Opposition.
  Honjo et al., (Eds), Immunoglobulin Genes, Academic Press: London, 2nd Edition, (1990) pp. 71, 74-76.
  Declaration of Sue Klapholz, originally submitted for the EP1360287 Opposition (including appendicies), Jan. 27, 2014.
  Second Declaration of Craig Bassing (Bassing II), originally submitted for the EP1360287 Opposition, dated Sep. 2, 2014.
  Kirschbaum et al., The 3′ part of the immunoglobulin kappa locus of the mouse, Eur J Immunol (1998) 28(5):1458-66.
  Kirschbaum et al., “The central part of the mouse immunoglobulin kappa locus,” Eur J Immunol (1999) 29(7):2057-64.
  Roschenthaler et al., “The 5′ part of the mouse immunoglobulin kappa locus as a continuously cloned structure,” Eur J Immunol (2000) 30(12):3349-3354.
  Roschenthaler et al., “The 5′ part of the mouse immunoglobulin kappa locus,” Eur J Immunol (1999) 29(7):2065-2071.
  Sambrook 3rd Ed 8.95, Real time PCR.
  Huetz et al., “Targeted disruption of the V(H) 81X gene: influence on the B cell repertoire,” Eur J Immunol (1997) 27(1):307-314.
  Fukita et al., “Somatic hypermutation in the heavy chain locus correlates with transcription,” Immunity (1998) 9(1):105-114.
  Gu et al., “Most Peripheral B Cells in Mice Are Ligand Selected,” J Exp Med (1991) 173(6):1357-71.
  The mouse genome, Nature 420, 510, Dec. 5, 2002, p. 510-511 (Nature Genome Timeline).
  Lefranc et al., The Immunoglobulin Facts Book Academic press (2001) p. 52-58.
  Kawasaki et al., “One-megabase sequence analysis of the human immunoglobulin lambda gene locus,” Genome Res (1997) 7(3):250-261.
  Carson and Wu (1989) A linkage map of the mouse immunoglobulin lambda light chain.
  Bruggemann et al., “Human antibody production in transgenic mice: expression from 100 kb of the human IgH locus,” Eur J Immunol (1991) 21(5):1323-1326.
  Sambrook 3rd ed pp. 4.1-4.8 (2001).
  Sambrook 3rd ed pp. 1.2-1.16 (2001).
  Xu et al., “Structure of the bacteriophage lambda cohesive end site. Genetic analysis of the site (cosN) at which nicks are introduced by terminase,” J Mol Biol (1991) 220(2):281-92.
  Catalano et al., “Virus DNA packaging: the strategy used by phage lambda,” Molecular Microbiology (1995) 16(6):1075-1086.
  Aggarwal et al., “Novel site-specific DNA endonucleases,” Curr Opin Struct Biol (1998) 8(1):19-25.
  Frengen et al., “A modular, positive selection bacterial artificial chromosome vector with multiple cloning sites,” Genomics (1999) 58(3):250-3.
  Naryanan et al., “Efficient and precise engineering of a 200 kb beta-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system,” Gene Ther (1999) 6(3):442-7.
  Email relating to Gene Bridges course on RedET recombination.
  GeneBridges course invitation, 2003.
  Reply letter of proprietor in response to the opposition proceedings against EP 2501817 B1, dated Dec. 23, 2016.
  Janeway et al., “Immunobiology: the immune system in health and disease,” Current Biology Publications, 4th edition, 1999, chapter 3, pp. 79-113.
  Rickert et al., “Impairment of T-cell-dependent B-cell responses and B-1 cell development in CD19-deficient mice,” Nature (1995) 376(6538):352-355.
  Mendez et al. (1997) Functional transplant of mega base human immunoglobulin loci recapitulates human antibody response in mice, Nature Genetics, 15:146-156.
  Sirac et al. (2006) Role of the monoclonal kappa chain V domain and reversibility of renal damage in a transgenic model of acquired Franconi syndrome, Blood 108:536-543.
 
 
     * cited by examiner
 
     Primary Examiner —Anne Marie S Wehbe
     Art Unit — 1633
     Exemplary claim number — 1
 
(74)Attorney, Agent, or Firm — Morrison & Foerster LLP

(57)

Abstract

Described are transgenic, non-human animals comprising a nucleic acid encoding an immunoglobulin light chain, whereby the immunoglobulin light chain is human, human-like, or humanized. The nucleic acid is provided with a means that renders it resistant to DNA rearrangements and/or somatic hypermutations. In one embodiment, the nucleic acid comprises an expression cassette for the expression of a desired molecule in cells during a certain stage of development in cells developing into mature B cells. Further provided is methods for producing an immunoglobulin from the transgenic, non-human animal.
4 Claims, 82 Drawing Sheets, and 45 Figures


CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application is a continuation of U.S. patent application Ser. No. 12/589,181, filed Oct. 19, 2009, pending, which application is a continuation of U.S. patent application Ser. No. 12/459,285, filed Jun. 29, 2009, pending, which applications claim the benefit, under 35 U.S.C. § 119(e), to U.S. Provisional Patent Application Ser. No. 61/133,274, filed Jun. 27, 2008, for “Antibody Producing Non-Human Mammals,” the entire contents of each of which are hereby incorporated herein by this reference.

STATEMENT ACCORDING TO 37 C.F.R. § 1.821(c) or (e)—SEQUENCE LISTING SUBMITTED AS ASCII TEXT FILE

[0002] Pursuant to 37 C.F.R. § 1.821(c) or (e), files containing a TXT version and a PDF version of the Sequence Listing have been submitted concomitant with this application, the contents of which are hereby incorporated by reference.

TECHNICAL FIELD

[0003] The invention relates to the production and use of non-human animals capable of producing antibodies or derivatives thereof, which are expressed from at least partially exogenous nucleic acids (transgenes). Transgenes to produce such transgenic animals and methods to produce such heterologous antibodies; methods and vectors for producing such transgenic animals are disclosed.

BACKGROUND

[0004] B cells mediate humoral immunity by producing specific antibodies. The basic structural subunit of an antibody (Ab) is an immunoglobulin (Ig) molecule. Ig molecules consist of a complex of two identical heavy (H) and two identical light (L) polypeptide chains. At the amino terminus of each H chain and L chain is a region that varies in amino acid sequence named the variable (V) region. The remaining portion of the H and L chains is relatively constant in amino acid sequence and is named the constant (C) region. In an Ig molecule, the H and L chain V regions (VH and VL) are juxtaposed to form the potential antigen-binding site. The genes that encode H and L chain V regions are assembled somatically from segments of germline DNA during precursor B (pre-B) cell differentiation: V, D and J gene segments for the H chain and V and J gene segments for the L chain. Within Ig V regions are three regions of greatest amino acid sequence variability that interact to form the antigen-recognition site and are thus referred to as complementarity determining regions (CDRs).
[0005] The V gene segment encodes the bulk of the V region domain, including CDR1 and CDR2. Diversity in CDR1 and CDR2 derives from sequence heterogeneity among multiple different germline-encoded V segments. CDR3 is encoded by sequences that are formed by the joining of H chain V, D, and J gene segments and L chain V and J segments and by mechanisms that create nucleotide sequence heterogeneity where these segments are combined. Additional diversity may be derived from pairing of different H and L chain V regions. Collectively these processes yield a primary repertoire of antibodies encoded by germline gene segments and expressed by newly formed B cells.
[0006] An additional source of antibody diversity is imposed on top of the diversity generated by recombination of Ig gene segments. B cells are able to introduce mutations into the antibody V regions that they express, a process called somatic hypermutation. Thus, when an animal first encounters an antigen, the antigen binds to a specific B cell which happens to carry antibodies which have a V domain which binds the antigen. This primary response may activate this B cell to go on to secrete the cognate antibody. These activated B cells can also now target a somatic mutation process to their rearranged antibody gene segments and thus allow the production of daughter cells which make variants of the antibodies of the primary response. A selection process amplifies those variant B cell descendants which make an antibody of improved affinity of the antigen. In B cells, somatic hypermutations are targeted to a restricted genomic region including both the rearranged VH and VL genes. Thus somatic mutation allows affinity maturation—the production and selection of high affinity antibodies. Therefore, somatic mutation is important for the generation of high affinity antibodies.
[0007] The exquisite specificity and high affinity of antibodies and the discovery of hybridoma technology allowing the generation of monoclonal antibodies (mAbs) has generated great expectations for their utilization as targeted therapeutics for human diseases. MAbs are identical because they are produced by a single B cell and its progeny. MAbs are made by fusing the spleen cells from a mouse that has been immunized with the desired antigen with myeloma cells to generate immortalized hybridomas. One of the major impediments facing the development of in vivo applications for mAbs in humans is the intrinsic immunogenicity of non-human Igs. Patients respond to therapeutic doses of mouse mAbs by making antibodies against the mouse Ig sequences (Human Anti Mouse Antibodies; HAMA), causing acute toxicity, alter their biodistribution and accelerate clearance, thus reducing the efficacy of subsequent administrations (Mirick et al. (2004), Q. Nucl. Med. Mol. Imaging 48:251-257).
[0008] To circumvent the generation of HAMA, antibody humanization methods have been developed in an attempt to produce mAbs with decreased immunogenicity when applied to humans. These endeavors have yielded various recombinant DNA-based approaches aimed at increasing the content of human amino acid sequences in mAbs while retaining the specificity and affinity of the parental non-human antibody. Humanization began with the construction of mouse-human chimeric mAbs (S. L. Morrison et al. (1984), Proc. Natl. Acad. Sci. USA 81:6851-5), in which the Ig C regions in murine mAbs were replaced by human C regions. Chimeric mAbs contain 60-70% of human amino acid sequences and are considerably less immunogenic than their murine counterparts when injected into humans, albeit that a human anti-chimeric antibody response was still observed (W. Y. Hwang et al. (2005), Methods 36:3-10).
[0009] In attempts to further humanize murine mAbs, CDR grafting was developed. In CDR grafting, murine antibodies are humanized by grafting their CDRs onto the VL and VH frameworks of human Ig molecules, while retaining those murine framework residues deemed essential for specificity and affinity (P. T. Jones et al. (1986), Nature 321:522). Overall, CDR-grafted antibodies consist of more than 80% human amino acid sequences (C. Queen et al. (1989), Proc. Natl. Acad. Sci. U.S.A. 86:10029; P. Carter et al. (1992), Proc. Natl. Acad. Sci. U.S.A. 89:4285). Despite these efforts, CDR-grafted, humanized antibodies were shown to still evoke an antibody response against the grafted V region (W. Y. Hwang et al. (2005), Methods 36:3).
[0010] Subsequently to CDR grafting, humanization methods based on different paradigms such as resurfacing (E. A. Padlan et al. (1991), Mol. Immunol. 28:489), superhumanization (P. Tan D. A. et al. (2002), J. Immunol. 169:1119), human string content optimization (G. A. Lazar et al. (2007), Mol. Immunol. 44:1986) and humaneering have been developed in an attempt to further decrease the content of non-human sequences in therapeutic mAbs (J. C. Almagro et al. (2008), Frontiers in Bioscience 13:1619). As in CDR grafting approaches, these methods rely on analyses of the antibody structure and sequence comparison of the non-human and human mAbs in order to evaluate the impact of the humanization process into immunogenicity of the final product. When comparing the immunogenicity of chimeric and humanized antibodies, humanization of variable regions appears to decrease immunogenicity further (W. Y. Hwang et al. (2005), Methods 36:3-10).
[0011] De-immunization is another approach developed to reduce the immunogenicity of chimeric or mouse antibodies. It involves the identification of linear T-cell epitopes in the antibody of interest, using bioinformatics, and their subsequent replacement by site-directed mutagenesis to human or non-immunogenic sequences (WO 9852976 A1, the contents of which are incorporated by this reference). Although de-immunized antibodies exhibited reduced immunogenicity in primates, compared with their chimeric counterparts, some loss of binding affinity was observed (M. Jain et al. (2007). Trends in Biotechnol. 25:307).
[0012] The development of phage display technology complemented and extended humanization approaches in attempts to obtain less immunogenic mAbs for therapy in humans. In phage display, large collections (“libraries”) of human antibody VH and VL regions are expressed on the surface of filamentous bacteriophage particles. From these libraries, rare phages are selected through binding interaction with antigen; soluble antibody fragments are expressed from infected bacteria and the affinity of binding of selected antibodies is improved by mutation (G. Winter et al. (1994), Annu. Rev. Immunol. 12:433). The process mimics immune selection, and antibodies with many different bindings specificities have been isolated using this approach (H. R. Hoogenboom et al. (2005), Nat. Biotechnol. 23:1105). Various sources of H and L chain V regions have been used to construct phage display libraries including those isolated from non-immune or immune donors. In addition, phage display libraries have been constructed of V regions that contain artificially randomized synthetic CDR regions in order to create additional diversity. Often, antibodies obtained from phage display libraries are subjected to in vitro affinity maturation to obtain high affinity antibodies (H. R. Hoogenboom et al. (2005), Nat. Biotechnol. 23:1105).
[0013] The creation of transgenic mouse strains producing human antibodies in the absence of mouse antibodies has provided another technology platform for the generation of specific and high affinity human mAbs for application in humans. In these transgenic animals, the endogenous mouse antibody machinery is inactivated and replaced by human Ig loci to substantially reproduce the human humoral immune system in mice (A. Jakobovits et al. (2007), Nat. Biotechnol. 25:1134; N. Lonberg (2005), Nat. Biotechnol. 23:1117). B cell development as well as Ig diversification by recombination of gene segments is faithfully reproduced in these mice, leading to a diverse repertoire of murine B cells expressing human Igs. By immunizing these mice with antigens, it was further demonstrated that these transgenic animals accumulated somatic mutations in the V regions of both heavy and light chains to produce a wide diversity of high-affinity human mAbs (N. Lonberg (2005), Nat. Biotechnol. 23:1117).
[0014] The question, whether “fully human” mAbs such as derived from phage display libraries or transgenic mice are less immunogenic than humanized mAbs cannot be answered yet, because full immunogenicity data are available for just two human mAbs. An anti-tumor necrosis factor mAb, developed from phage-displayed human libraries induced antibody responses in 12% of patients—at the higher end of the incidence of anti-antibody responses of the humanized antibodies (W. Y. Hwang et al. (2005), Methods 36:3-10).
[0015] Evaluation of the immunogenicity of the first registered human mAb generated by the transgenic approach demonstrated that mAb treatment resulted in the generation of antibodies in approximately 5.5% of treated cancer patients (A. Jakobovits et al. (2007), Nat. Biotechnol. 25:1134; J. A. Lofgren et al. (2007), J. Immunol. 178:7467).

DISCLOSURE OF THE INVENTION

[0016] Disclosed are a method and means for producing antibodies that are specific for their targets, but are less immunogenic. Described herein, the reduction of immunogenicity is at least partially achieved by providing a transgenic non-human mammal comprising, at least in its B cell lineage, a nucleic acid encoding at least an immunoglobulin light chain or heavy chain, wherein the heavy- or light chain encoding sequence is provided with a means that renders it resistant to DNA rearrangements and/or somatic hypermutations, preferably such a non-human animal is a rodent, more specifically a mouse. In certain embodiments, the nucleic acid encodes a human, human-like, or humanized immunoglobulin chain.
[0017] In the remainder of this specification, mice are typically used as examples of the non-human mammals. The transgenic, non-human, mammalian hosts are capable of mounting an immune response to an antigen, where the response produces antibodies having primate, particularly human, variable regions. Various transgenic hosts may be employed, particularly murine, lagomorpha, ovine, avine, porcine, equine, canine, feline, or the like. Mice have been used for the production of B-lymphocytes for immortalization for the production of antibodies. Since mice are easy to handle, can be bred in large numbers, and are known to have an extensive immune repertoire, mice will usually be the animal of choice. Therefore, in the following discussion, the discussion will refer to mice, but it should be understood that other animals, particularly non-primate mammals, may be readily substituted for the mice, following the same procedures.
[0018] The reason for preventing rearrangements and hypermutation is that in this manner a non-immunogenic polypeptide can be chosen beforehand knowing that this polypeptide chain will remain non-immunogenic. At least one of the chains of the resulting immunoglobulin is thus less immunogenic. The resulting antibody needs to have (usually) both a light- and a heavy chain. The non-immunogenic chain must therefore be capable of pairing with the other chain. The other chain may be an endogenous chain, an exogenous chain or a hybrid of both. For human therapy, the non-immunogenic chain should be as close to human as possible.
[0019] A means for rendering a gene encoding an immunoglobulin chain (or chains) resistant to DNA rearrangement and/or mutation is of course removal of all genetic elements responsible for the rearrangement and/or mutation. The drawback thereof is that the variability of the two chains is eliminated, whereas the invention preferably retains the variability in one chain (preferably the heavy chain) and inhibits and/or prevents the rearrangement-mutation of the other chain (preferably the light chain).
[0020] The elements for rearrangement and/or hypermutation characterized so far are located within the loci for immunoglobulins. Therefore the means for rendering the immunoglobulin encoding sequence resistant to DNA rearrangement and/or mutation is inserting the gene in a locus outside the immunoglobulin loci.
[0021] Thus, described herein, a transgenic non-human mammal is provided wherein the light/heavy chain encoding sequence is integrated in the genome of the non-human mammal in a locus outside the immunoglobulin loci. Preferably the insertion is in a locus that is resistant to gene silencing. Described herein, the integration is in the Rosa-locus or a comparable locus.
[0022] In certain embodiments, provided is an expression cassette that can be inserted into a Rosa locus or comparable locus with a means that allows expression of the immunoglobulin chain(s) essentially limited to cells of B cell lineage, preferably with a means that allows expression of the light chain encoding nucleic acid during a certain stage of the development of B cells. The term “essentially limited expression” indicates that expression is predominantly in cells of the B-cell lineage, but that lower levels of expression in other cells, as compared to the level of expression in B-cells, is possible. In certain embodiments, the term “essentially limited expression” indicates that the expression is exclusively present in cells of the B-cell lineage. Such means typically and preferably include B cell (developmental stage) specific promoters such as CD19, CD20, μHC (all V-genes), VpreB1, VpreB2, VpreB3, λ5, Igα, Igβ, κLC (all genes), λLC (all genes), BSAP (Pax5). Although it is very well possible to direct the expression of the DNA rearrangement and/or mutation resistant chain by such promoters, they are relatively weak. A strong promoter will typically be required to ensure adequate surface expression of the B cell receptor (made up of the membrane attached Ig H and L chain) and to compete with the expression and pairing of endogenous chains (if present) through allelic exclusion. Such a promoter, however is usually not tissue specific. To confer tissue specificity, an indirect system employing Cre/lox or the like is preferred. The desired chain is put under control of a strong promoter inhibited by an element that can be removed by the action of a Cre-protein, leading to activation of the desired immunoglobulin encoding gene. This system is described in detail in F. T. Wunderlich (2004), “Generation of inducible Cre systems for conditional gene inactivation in mice,” Inauguraldissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Universität zu Köln; on the internet at deposit.ddb.de/cgi-bin/dokserv?idn=97557230x&dok_var=dl&dok_ext=pdf&filename=975572 30x.pdf.
[0023] Preferably the immunoglobulin chain produced in a manner resistant to rearrangements and hypermutation is a light chain capable of pairing with different heavy chains encoded by the non-human mammal. The light chain will then be the same (and less immunogenic) in all antibodies, but variety in specificity is retained through rearrangements and hypermutations in the heavy chains. It may in that case be preferable to silence at least one of the endogenous loci encoding a light chain, although allelic exclusion may render this unnecessary.
[0024] According to this embodiment, preferably the endogenous kappa (κ) light chain locus is functionally silenced.
[0025] If the endogenous K light chain locus is silenced, but also for other reasons, it is preferred that the resistant light chain is a κ light chain, preferably a light chain that has a germline-like sequence. Described herein such a light chain would lead to an antibody with reduced immunogenicity. The preferred germline sequence is based on the human IGKV1-39 (O12) as this light chain is very frequently observed in the human repertoire (de Wildt et al. 1999, J. Mol. Biol. 285(3):895) and has superior thermodynamic stability, yield and solubility (Ewert et al. 2003, J. Mol. Biol. 325(3):531).
[0026] The following gives more specific embodiments of the expression cassette with which the non-human animal can be provided described herein. Although this is typically advantageous for immunoglobulins, other genes of interest are also contemplated.
[0027] Thus, provided in a specific embodiment, is a transgenic non-human mammal wherein the light chain encoding nucleic acid comprises in 5′-3′ direction: a B cell specific promoter, a leader, a rearranged human V gene, optionally a mouse κ-intron enhancer (MoEκi), a constant region (κ) and optionally a (truncated) mouse κ-3′ enhancer (MoEκ3′). Neuberger identified and examined a novel B-cell specific enhancer located downstream of the kappa constant region (Neuberger, EP 00469025 B1, the contents of which are incorporated herein by this reference). This enhancer has been shown to play a crucial role in the expression of kappa genes as removal of the 808 bp enhancer strongly reduced expression. Deletion of the 3′ kappa enhancer also strongly reduced the level of somatic hypermutations (SHM). In transgenic and cell expression studies, it has been revealed that reduced, mutated or deleted 3′ kappa enhancers not only lowered expression levels, but also decreased the level of somatic hypermutations. Currently, it cannot be determined whether the 3′ kappa enhancer is involved in SHM processes, expression regulation or both (review V. H. Odegard et al. (2006), Nat. Rev. Immunol. 6:573; M. Inlay et al. (2002), Nat. Immunol. 3:463).
[0028] Detailed expression studies using engineered variants of the 3′ kappa enhancer indicated that a 50 nucleotide region is sufficient to drive expression. However for proper expression a reduced sequence of 145 nucleotides is preferred (EP04690251; K. B. Meyer et al. (1990), Nucleic Acids Res. 18(19):5609-15).
[0029] Thus, the invention in one aspect provides a nucleic acid for insertion into the genome of a non human animal that is an expression cassette for the expression of a desired proteinaceous molecule in cells developing into mature B cells during a certain stage of development, the cassette comprising means for preventing silencing of expression of the desired proteinaceous molecule after introduction into a host cell, and means for timing expression of the desired proteinaceous molecule with the desired developmental stage of the host cell.
[0030] An expression cassette is defined as a nucleic acid that has been provided with means for introduction into the genome of a host cell, such as sequences which allow for homologous recombination with a certain site in the genome. Usually the nucleic acid will be DNA, typically double stranded. Typically the expression cassette will be provided to the cell in a vector from which it is transferred to the genome of the cell. The expression cassette further comprises all elements necessary for expression of the gene in a host cell, although in certain embodiments some of such elements may be present on a second nucleic acid to be introduced, whereby these elements act in trans. Elements necessary for expression in a host cell include promoters, enhancers and other regulatory elements. Only those elements are necessary that are not provided by the host cell.
[0031] The expression of the gene of interest should not be silenced in the genome of the host cell, especially not in the development stage where expression is required. This can be done by various means, such as insertion into the endogenous locus or by providing the cassette with nucleic acid elements that prevent silencing (Kwaks et al. (2006), Trends Biotechnol. 24(3):137-142, which is incorporated herein by reference). It is preferred that the expression cassette is inserted in a locus that is not silenced in the host cells (EP 01439234; which is incorporated herein by reference).
[0032] The means for prevention of silencing comprise STabilizing Anti-Repression-sequences (STAR®-sequences) and Matrix Attachment Regions (MARs). A STAR sequence is a nucleic acid sequence that comprises a capacity to influence transcription of genes in cis. Typically, although not necessarily, a STAR sequence does not code by itself for a functional protein element. In one embodiment one STAR element is used. Preferably, however, more than one STAR element is used. In a particularly preferred embodiment an expression cassette described herein is provided with two STAR sequences; one STAR sequence at the 5′ side of the coding sequence of the immunoglobulin gene and one STAR sequence at the 3′ side of the coding sequence of the immunoglobulin gene. MARs are DNA sequences that are involved in anchoring DNA/chromatin to the nuclear matrix and they have been described in both mammalian and plant species. MARs possess a number of features that facilitate the opening and maintenance of euchromatin. MARs can increase transgene expression and limit position-effects.
[0033] Expression from the cassette should only occur during a certain period in the development of a cell, in particular a developing B cell, more in particular a B cell in a transgenic non-human animal, in particular a mouse. In this particular case the developmental period is chosen such that the expression of the gene from the cassette (typically a light- or heavy chain-like polypeptide) does not significantly interfere with the normal differentiation and/or maturation of the cell and when applicable, allows for pairing of the polypeptide chain produced with its counterpart.
[0034] This may, in one embodiment, be achieved by providing a nucleic acid described herein, wherein the means for timing expression is a promoter of which the activity is essentially limited to the certain stage of development. In a developing B cell, which, e.g., after immunization is maturing and/or differentiating, the expression of the gene of interest, when it is one of the polypeptide chains of an immunoglobulin, must not interfere (significantly) with the maturation and/or differentiation and it needs to be timed such that the resulting polypeptide can pair with its counterparts. Therefore, provided is a nucleic acid described herein wherein the certain stage starts at a stage immediately preceding or coinciding with the onset of the expression of light chain molecules by the cells at a certain stage of development into a mature B cell. This may be achieved by selecting a promoter which is active only during the suitable period. Such a promoter may be a CD19 promoter, the Ig-α promoter, the Ig-β promoter, the μhc (all genes) promoter, the Vk promoter or analogues or homologues thereof.
[0035] In a specific embodiment, the promoter as disclosed above does not drive the expression of the gene of interest directly. Instead it drives the expression of a gene of which the product activates in trans the expression of the gene of interest. Such an activating gene may be a gene encoding a so-called Cre recombinase or Cre-like protein. The expression cassette for the gene of interest may, e.g., be provided with a sequence that inhibits expression of the gene of interest. The sequence can be removed by the action of the Cre recombinase, which is under control of the desired promoter (active during the proper stage of development). In this embodiment a set of expression cassettes is required.
[0036] Therefore, provided is a set of nucleic acids that are expression cassettes, wherein one nucleic acid comprises an expression cassette encoding a Cre-like protein under control of a promoter active during the desired stage of development of the host cell and the second nucleic acid comprises a sequence encoding a desired proteinaceous molecule under control of a constitutive promoter which can be activated by the action of a Cre-like protein. The activation is preferably achieved by removal of a stop sequence flanked by loxP sites. The Cre/lox system is described in detail in Rajewsky et al. (1996), J. Clin. Invest. 98:600-603, which is incorporated herein by reference. Such systems are reviewed in F. T. Wunderlich (2004), “Generation of inducible Cre systems for conditional gene inactivation in mice,” Inauguraldissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Universität zu Köln; on the World Wide Web at deposit.ddb.de/cgi-bin/dokserv?idn=97557230x&dok_var=dl&dok_ext=pdf&filename=97557230x.pd, which is incorporated herein by reference.
[0037] Further provided is a transgenic non-human animal that has been provided with an expression cassette hereof, wherein the desired proteinaceous molecule is a polypeptide chain of an immunoglobulin. A preferred polypeptide chain is a light chain. A more preferred polypeptide is a germline or germline-like light chain. A most preferred polypeptide is encoded by the immunoglobulin kappa variable 1-39 (IGKV1-39, also known as O12) gene segment, preferably the rearranged germline kappa light chain IGKV1-39*01/IGKJ1*01 (nomenclature according to the MGT database, at [worldwideweb].imgt.org).
[0038] In certain embodiments, the polypeptide chain is rendered essentially incapable of rearrangement and/or of excluded of any sequence modification such as normally operating on Ig during the process of B cell affinity maturation. Therefore, provided is a transgenic non-human animal that has been provided with an expression cassette described herein, wherein the rearrangement and/or sequence modifications are prevented by the absence of elements at least partially responsible for somatic hypermutation such as, for example, the MoEκi enhancer.
[0039] A preferred expression cassette described herein comprises means for prevention of silencing. In one embodiment, the means for prevention of silencing are means for insertion into a locus in the genome of the host cell that is resistant to silencing. The means for insertion are preferably means for homologous recombination into the site resistant to silencing. A preferred locus when the non-human animal is a mouse is the rosa-locus.
[0040] A further preferred expression cassette described herein comprises in 5′-3′ direction: a Vκ promoter, a mouse leader, a human V gene, optionally a MoEκi enhancer, a rat constant region (Cκ) and optionally a (truncated) MOEκ3′ enhancer.
[0041] Yet a further preferred expression cassette described herein comprises in 5′-3′ direction: a Vκ promoter, a human leader, a human V gene, optionally a MoEκi enhancer, a rat constant region (Cκ) and optionally a (truncated) MoEκ3′ enhancer.
[0042] Certain antibodies produced as described herein may be be used in human therapeutics and diagnostics. Thus, provided is a method for producing a desired antibody comprising exposing a non-human mammal described herein to an antigen such that an antibody response is induced and isolating the antibodies specific for the antigen.
[0043] In certain embodiments, provided are methods for producing a desired antibody comprising exposing a non-human mammal described herein to an antigen such that an antibody response is induced and isolating cells producing such antibodies, culturing and optionally immortalizing the cells and harvesting the antibodies.
[0044] In certain embodiments, provided is a method for producing a desired antibody comprising exposing a non-human mammal described herein to an antigen such that an antibody response is induced and isolating a nucleic acid encoding at least part of such an antibody, inserting the nucleic acid or a copy or a derivative thereof in an expression cassette and expressing the antibody in a host cell.
[0045] The methods for producing antibodies from transgenic mice are known to a person skilled in the art. Particularly preferred are methods for production of mixtures of antibodies from one cell, whereby the nucleic acids encoding these antibodies have been derived from mice described herein.
[0046] These so-called oligoclonics are disclosed in WO04106375 and WO05068622, which are incorporated herein by reference.
[0047] Described herein are transgenic non-human mammals, preferably mice, capable of generating specific and high affinity hybrid mouse-human antibodies with preferably human immunoglobulin light chain variable (VL) regions in or near germline configuration and preferably murine immunoglobulin heavy chain variable (VH) regions that may have accumulated somatic mutations during the process of antigen-driven affinity maturation. It is envisaged that the murine VH regions of the hybrid antibodies may be subjected to humanization procedures to yield mAbs that have reduced immunogenicity when applied in humans based on germline or near-germline VL regions and murine VH regions that have been humanized.
[0048] In particular, we have shown that transgenic mice that harbor a DNA expression construct that encodes a rearranged human VL region under the control of cis-acting genetic elements that provide timely and regulated expression of the transgene on a significant proportion of B cells during B cell development, yet lack elements that direct the somatic hypermutation machinery to the transgene, are capable of generating specific and high affinity mouse-human hybrid antibodies with essentially unmutated L chains. It is shown that the rearranged human transgene is capable of pairing with a diversity of endogenous murine immunoglobulin H chains to form mouse-human hybrid immunoglobulins expressed on the surface of B cells and to sufficiently facilitate murine B cell development to obtain a sizeable and diverse peripheral B cell compartment.
[0049] In certain embodiments, the transgene expression construct harbors the coding sequences of a human rearranged L chain V region under the control of a human VL promoter to direct B-cell specific expression. In addition, the construct harbors the murine 3′ Ck enhancer sequence for B cell specific and inducible and high level expression of the transgene. Furthermore, the construct is designed to lack regulatory elements that facilitate the recruitment of the somatic hypermutation machinery to the transgene, such as the intron enhancer and the 3′ C-kappa enhancer.
[0050] In a related embodiment, the rearranged human VL gene is inserted in the murine Rosa26 locus by site-specific integration. The Rosa26 locus is useful in the context of the “targeted transgenesis” approach for efficient generation of transgenic organisms (such as mice) with a predictable transgene expression pattern.
[0051] In certain embodiments, the rearranged human VL region is selected for its capacity to pair with many different murine VH genes so as to ensure the generation of a population of B cells with a diverse VH gene repertoire. A method of obtaining such VL regions comprises amplifying a repertoire of rearranged VH genes from the B cells of mice and a repertoire of human rearranged germline VL regions from the B cells of humans and cloning them into phagemid display vectors to prepare diverse libraries of hybrid immunoglobulins in bacteria. By nucleotide sequence analysis of collections of unselected and antigen-selected VH/VL pairs, human germline VL genes that pair with many different murine VH genes are identified. A collection of human germline VL genes with this capacity is described.
[0052] In one embodiment, it is shown that upon immunization with antigen, the B cells are capable of mounting an immune response, leading to the generation of B cells that secrete hybrid antibodies with high specificity and affinity. The V regions encoding these antibodies are characterized by the human transgenic light chain that harbors no or very few mutations and a murine heavy chain that harbors a variable number of mutations introduced by the somatic hypermutation machinery.
[0053] In a related embodiment, strategies to obtain high affinity hybrid monoclonal antibodies from the transgenic mice by hybridoma and display technologies are contemplated as well as procedures to humanize the murine VH regions to obtain less immunogenic antibodies for application in humans.
[0054] In one embodiment, provided is an immunoglobulin L chain transgene construct comprising DNA sequences that encode a human immunoglobulin VL region in combination with a light chain constant region (CL) of an animal immunoglobulin protein, which sequences are operably linked to transcription regulatory sequences that, when integrated in a non-human transgenic animal, produce an Ig VL-CL polypeptide with a human VL region that is not or marginally subject to somatic hypermutation. The Ig VL is capable of pairing with rearranged VH-CH polypeptides that are generated during B cell development in the non-human transgenic animal, with the VH-CH polypeptides retaining the capacity to undergo somatic hypermutation upon stimulation. The CL region may be of any animal species and is generally capable of pairing with the CH regions of the non-human transgenic animal.
[0055] Also included is the use of a transgene construct as above in producing a transgenic non-human animal capable of the production of hybrid antibodies consisting of VL-CL polypeptides and VH-CH polypeptides in which the VL region is of human origin and the CL, VH and CH may be of any animal species, including human. Upon immunization, these transgenic animals are capable of generating high affinity antibodies encoded by somatically hypermutated VH genes and essentially non-mutated VL genes encoded by the transgene.
[0056] In another aspect, provided is a process for the production of a transgenic non-human animal capable of the production of hybrid antibodies in response to antigenic challenge, comprising functionally disrupting the endogenous immunoglobulin light chain locus and inserting into the animal genome a transgene construct of the invention.
[0057] Included is the use of animals obtainable by this process in the production of B cells that produce immunoglobulin having human VL light chain. In another aspect of the invention there is provided a process for the production of B cells that produce immunoglobulin having human VL and binding to a selected antigen, comprising challenging an animal obtainable by a process as above with the antigen and screening for B cells from the animal that bind the antigen. Further included is B cells obtainable by this process and hybridomas obtainable by immortalizing such B cells, e.g., hybridomas obtained by fusing B cells as above with myeloma cells. Also included is a process for producing monoclonal antibody comprising cultivating such a hybridoma. In yet a further aspect, provided is the use of the above B cells in producing a hybridoma or corresponding monoclonal antibody.
[0058] Described herein is a process for the production of immunoglobulin having human VL chain and binding to a selected antigen, comprising challenging an animal obtainable as above with the antigen and obtaining immunoglobulin there from.
[0059] In one strategy, as an individual step, a rearranged VL region encoded by human germline V and J gene segments and a light chain constant region of any animal species but preferably a murine constant region is introduced into the mouse germ line. The transgene DNA may be introduced into the pronuclei of fertilized oocytes or embryonic stem cells. The integration may be random or homologous depending on the particular strategy to be employed. For example, the VL transgene may be introduced by random insertion, resulting in mice that bear one or multiple copies of the transgene in the genome. Alternatively, the human VL transgene may be targeted to a specific genomic locus using site-specific recombination as described in the art.
[0060] In certain embodiments, the VL transgene is targeted to the murine ROSA26 locus which is a suitable integration site allowing strong and predictable expression of inserted transgenes (European Patent Office document EP 1,439,234 A1, the contents of which are incorporated herein by this reference). The targeting vector allows insertion of a single copy of a gene expression cassette, thus avoiding modulation of transgene expression by the arrangement of multiple copies. By choosing the autosomal Rosa26 locus as insertion site, the expression pattern of the inserted transgene in the non-human animal is predictable. Furthermore, random X inactivation and/or modulation by chromosomal position effects are avoided. This also eliminates the need to generate and analyze multiple transgenic strains for any given transgene. Finally, the Rosa26 targeting vector for the site-specific integration can be used for multiple gene expression cassettes. Thus, it may be envisaged that two or more different rearranged germline human VL regions are inserted into the Rosa26 locus to further increase the diversity of the repertoire of hybrid or human antibodies.
[0061] In another embodiment, a rearranged human VL region may be targeted to the murine Ig kappa or lambda light chain locus so as to functionally inactivate the endogenous locus or mice containing the rearranged human VL region may be bred with mice that lack functional kappa or lambda Ig loci or both. Thus, by using transformation, using repetitive steps or in combination with breeding, transgenic animals may be obtained which are able to produce antibodies harboring the human VL transgene in the substantial absence of endogenous host immunoglobulin light chains.
[0062] In one embodiment, a human VL transgene is selected for its capacity to pair with a substantial portion of murine VH regions to form a diverse repertoire of functional mouse-human hybrid antibodies expressed on the surface of B cells. By a substantial portion of murine VH regions is meant that the human VL pairs with at least with 0.1% of the murine VH regions generated during B cell development, more preferably with at least 1% and most preferably with at least 10%. Methods to identify human VL genes with this characteristic include randomly pairing a repertoire of human VL regions with a repertoire of murine VH regions, co-expression of VH and VL regions in appropriate eukaryotic or prokaryotic expression vectors and screening for human VL regions that pair with a substantial portion of murine VH regions. In one embodiment, phagemid vectors may be used to direct expression of mouse-human antibody fragments in bacterial cells or to the surface of filamentous phage and analysis of binding capacity of antibody fragments by methods known in the art.
[0063] In another embodiment, a human VL transgene is selected for its capacity to pair with a substantial portion of human VH regions to form a diverse repertoire of human antibodies expressed on the surface of B cells. By a substantial portion of human VH regions is meant that the human VL pairs with at least with 0.1% of the human VH regions generated during B cell development, more preferably with at least 1% and most preferably with at least 10%.
[0064] In the latter embodiment, the human VL transgenic mice are crossed with mice that harbor functional rearranged or non-rearranged human H chain immunoglobulin loci and functionally inactivated endogenous H chain Ig loci as described in the art. The functional inactivation of the two copies of each of the three host Ig loci (heavy chain, kappa and lambda light chain), where the host contains the human IgH and the rearranged human VL transgene would allow for the production of purely human antibody molecules without the production of host or host human chimeric antibodies. Such a host strain, by immunization with specific antigens, would respond by the production of mouse B-cells producing specific human antibodies, which B-cells are subsequently fused with mouse myeloma cells or are immortalized in any other manner for the continuous stable production of human monoclonal antibodies. Alternatively, the population of B cells is used as a source of VH regions that can be obtained by constructing cDNA libraries or by PCR amplification using primers for human VH regions as is known in the art.
[0065] A human rearranged VL gene is reconstructed in an appropriate eukaryotic or prokaryotic microorganism and the resulting DNA fragments can be introduced into pronuclei of fertilized mouse oocytes or embryonic stem cells. Various constructs that direct B cell specific expression of VL transgenes have been described in the art and have the following general format: a leader sequence and relevant upstream sequences to direct B cell specific expression of the transgene, a coding sequence of a human VL transgene, an enhancer sequence that directs B cell specific and high level expression of the transgene and a murine constant region gene. In a preferred format, the enhancer is the C-kappa 3′ enhancer because it directs high level expression in B-lineage cells, but does not recruit somatic hypermutation when used in transgene constructs.
[0066] In one embodiment, animals, preferably mice, comprising one or multiple copies of the transgene in the genome are isolated and analyzed for stable expression. Animals are selected that show stable expression of the transgene over longer periods of time, preferably in B-cells. If required, different animal lines comprising independent insertions of one or multiple copies of the transgene, preferably on different chromosomes, are crossed to obtain animals with different insertions of one or multiple copies of the transgene to increase expression of the transgene in animals, preferably in B-cells.
[0067] Further provided is progeny of a transgenic non-human animal described herein, the progeny comprising, at least in its B-cell lineage, a heavy- or light chain encoding sequence together with a means that renders the sequence resistant to DNA rearrangements and/or somatic hypermutations.
[0068] Further provided is progeny of a transgenic non-human animal described herein, the progeny comprising an expression cassette for the expression of a desired proteinaceous molecule in cells during a certain stage of development in cells developing into mature B cells.
[0069] In addition, provided is a cell that is isolated from a transgenic non-human animal described herein, the cell comprising a heavy- or light chain encoding sequence together with a means that renders the sequence resistant to DNA rearrangements and/or somatic hypermutations. In addition, provided is a cell that is isolated from a transgenic non-human animal described herein, the cell comprising an expression cassette for the expression of a desired proteinaceous molecule in cells during a certain stage of development in cells developing into mature B cells. A cell described herein, preferably an antibody-producing B-cell or a cell that is capable of differentiating or maturating into an antibody-producing B-cell, can be used for in vitro production of antibodies, as is known to the skilled person, for example, from Gascan et al. 1991, J. Exp. Med. 173:747-750. Methods for immortalization of a cell described herein are known in the art and include the generation of hybridomas, for example, by fusion with a myeloma cell, transformation with Epstein Barr Virus; expression of the signal transducer of activation and transcription (STAT), activation via CD40 and IL4 receptor signaling, and/or expression of Bcl6 (Shvarts et al. 2002, Genes Dev. 16: 681-686).
[0070] In a separate step, the mouse endogenous Kappa and Lambda light chain loci are rendered essentially non-functional such that at least the majority of B cells in the transgenic mice bear Ig receptors that contain the transgenic human VL region. Inactivation of the endogenous mouse immunoglobulin loci is achieved by targeted disruption of the appropriate loci by homologous recombination in mouse embryonic stem cells. The targeted disruption comprises alteration of the genomic sequence such that substantially no functional endogenous mouse immunoglobulin Kappa and/or Lambda light chain is produced. The term “substantially no functional endogenous mouse immunoglobulin” indicates that the endogenous Kappa and/or Lambda light chain loci are functionally silenced such that the level of functional protein expression of the endogenous Kappa and/or Lambda light chain loci, preferably the endogenous Kappa light chain locus, is reduced to about 20% of the level of expression in a reference mouse, more preferred to about 10%, more preferred to about 5%, more preferred to about 2% and more preferred to about 1%. In a most preferred embodiment, the level of functional protein expression of the endogenous Kappa and/or Lambda light chain loci is reduced to 0%. The level of functional protein expression can be determined by means known to the skilled person, including western blotting and pairing with a mouse heavy chain. The reference mouse is a mouse in which the endogenous Kappa and/or Lambda light chain loci is not disrupted. The alteration comprises mutation and/or deletion of gene sequences that are required for functional expression of the endogenous immunoglobulin genes. Alternatively, the alteration comprises insertion of a nucleic acid into the endogenous mouse immunoglobulin Kappa and/or Lambda light chain loci such that the functional expression of the endogenous immunoglobulin genes is reduced. In one embodiment, the nucleic acid comprises a silencing element resulting in transcriptional silencing of the endogenous immunoglobulin gene. In a further embodiment, or in addition, the nucleic acid comprises a sequence that disrupts splicing and/or translation of the endogenous immunoglobulin gene, for example, by introducing an exon that renders a frame shift in the coding sequence, or that comprises a premature stop codon. In each case chimeric animals are generated which are derived in part from the modified embryonic stem cells and are capable of transmitting the genetic modifications through the germ line. The mating of mouse strains with human immunoglobulin loci to strains with inactivated mouse loci yields animals which produce antibodies comprising essentially only human light chains.
[0071] A construct for homologous recombination is prepared by means known in the art and any undesirable sequences are removed, e.g., procaryotic sequences. Any convenient technique for introducing a construct for homologous recombination into a target cell may be employed. These techniques include spheroplast fusion, lipofection, electroporation, calcium phosphate-mediated DNA transfer or direct microinjection. After transformation or transfection of the target cells, target cells are selected by means of positive and/or negative markers, for example, by neomycin resistance and/or acyclovir and/or gancyclovir resistance. Those cells which show the desired phenotype may then be further analyzed by restriction analysis, electrophoresis, Southern analysis, PCR, or the like. By identifying fragments which show the presence of the lesion(s) at the target locus, cells in which homologous recombination has occurred to inactivate a copy of the target locus are identified.
[0072] Furthermore, it is shown that upon immunization, the murine and human VH regions in the afore-mentioned transgenic mice but not the VL regions are capable of undergoing somatic hypermutations to generate high affinity antibodies. Advantageously, these antibodies encoded by germline VL regions are predicted to contribute to lower immunogenicity when applied in humans and result in more stable antibodies that are less prone to aggregation and thus safer for therapeutic use in humans.
[0073] MAbs derived from the afore-mentioned non-human transgenic animals or cells all share the same identical human VL regions. It has been described that mAbs that share the same identical VL region may be co-expressed in a single clonal cell for the production of mixtures of recombinant antibodies with functional binding sites (see the incorporated WO04106375 and WO05068622). Thus, provided is a platform for the generation of specific and high affinity mAbs that constitute the basis for mixtures of mAbs produced by clonal cells.
[0074] It is preferred that mAbs derived from the afore-mentioned non-human transgenic animals or cells are directed against cellular targets. Preferred targets are human surface-expressed or soluble proteins or carbohydrate molecules. Further preferred targets are surface-expressed proteins or carbohydrate molecules that are expressed on the surface of bacteria, viruses, and other pathogens, especially of humans.
[0075] More specifically, preferred targets include cytokines and chemokines, including but not limited to InterLeukin 1beta (IL1beta), IL2, IL4, IL5, IL7, IL8, IL12, IL13, IL15, IL18, IL21, IL23 and chemokines such as, for example, CXC chemokines, CC chemokines, C chemokines (or γ chemokines) such as XCL1 (lymphotactin-α) and XCL2 (lymphotactin-β), and CX3C chemokines. Further included as preferred targets are receptor molecules of the cytokines and chemokines, including type I cytokine receptors such as, for example, the IL-2 receptor, type II cytokine receptors such as, for example, interferon receptors, immunoglobulin (Ig) superfamily receptors, tumor necrosis factor receptor family including receptors for CD40, CD27 and CD30, serine/threonine-protein kinase receptors such as TGF beta receptors, G-protein coupled receptors such as CXCR1-CXCR7, and tyrosine kinase receptors such as fibroblast growth factor receptor (FGFR) family members, EGF receptor family members including erbB1 (EGF-R; HER1), erbB2, (HER2), erbB3 (HER3), and erbB4 (HER4), insulin receptor family members including IGF-R1 and IGF-RII, PDGF receptor family members, Hepatocyte growth factor receptor family members including c-Met (HGF-R), Trk receptor family members, AXL receptor family members, LTK receptor family members, TIE receptor family members, ROR receptor family members, DDR receptor family members, KLG receptor family members, RYK receptor family members, MuSK receptor family members, and vascular endothelial growth factor receptor (VEGFR) family members.
[0076] Further preferred targets are targets that are over-expressed or selectively expressed in tumors such as, for example, VEGF, CD20, CD38, CD33, CEA, EpCAM, PSMA, CD54, Lewis Y, CD52, CD40, CD22, CD51/CD61, CD74, MUC-1, CD38, CD19, CD262 (TRAIL-R2), RANKL, CTLA4, and CD30; targets that are involved in chronic inflammation such as, for example, CD25, CD11a, TNF, CD4, CD80, CD23, CD3, CD14, IFNgamma, CD40L, CD50, CD122, TGFbeta and TGFalpha.
[0077] Preferred surface-expressed proteins or carbohydrate molecules that are expressed on the surface of bacteria, viruses, and other parasitic pathogens, especially of humans, include surface markers of influenza A and B viruses such as hemagglutinin (HA) and neuraminidase (NA), filoviruses such as Ebola virus, rabies, measles, rubella, mumps, flaviviruses such as Dengue virus types 1-4, tick-borne encephalitis virus, West Nile virus, Japanese encephalitis virus, and Yellow fever virus, Paramyxoviruses including Paramyxovirus such as Parainfluenza 1, 3, Rubulavirus such as Mumpsvirus and Parainfluenza 2, 4, Morbillivirus, and Pneumovirus such as Respiratory syncytial virus, Vaccinia, small pox, coronaviruses, including Severe Acute Respiratory Syndrome (SARS) virus, hepatitis virus A, B and C, Human Immunodeficiency Virus, Herpes viruses, including cytomegalovirus, Epstein Barr virus, Herpes simplex virus, and Varicella zoster virus, parvoviruses such as, for example, B19; Legionella pneumophila; Listeria monocytogenes; Campylobacter jejuni; Staphylococcus aureus; E. coli O157:H7; Borrelia burgdorferi; Helicobacter pylori; Ehrlichia chaffeensis; Clostridium difficile; Vibrio cholera; Salmonella enterica Serotype Typhimurium; Bartonella henselae; Streptococcus pyogenes (Group A Strep); Streptococcus agalactiae (Group B Strep); Multiple drug resistant S. aureus (e.g., MRSA); Chlamydia pneumoniae; Clostridium botulinum; Vibrio vulnificus; Parachlamydia pneumonia; Corynebacterium amycolatum; Klebsiella pneumonia; Linezolid-resistant enterococci (E. faecalis and E. faecium); and Multiple drug resistant Acinetobacter baumannii.
[0078] Most preferred targets are IL-6 and its receptor, IL-6Ralpha, glycoprotein-denominated gp130, RSV, especially the surface proteins F, G and SH and non-structural proteins such as N and M, and receptor tyrosine kinases, in particular erbB1 (EGF-R; HER1), erbB2, (HER2), erbB3 (HER3), erbB4 (HER4), IGF-R1 and IGF-RII, c-Met (HGF-R).
[0079] Therefore, provided is a platform for the generation of specific and high affinity mAbs against the above mentioned targets that constitute the basis for mixtures of mAbs produced by clonal cells. In certain embodiments, the specific and high affinity mAbs comprise mAbs that are directed against different epitopes on at least one of the targets. In a further preferred embodiment, the specific and high affinity mAbs comprise mAbs that are directed against different targets, such as, for example, one or more members of the EGF-receptor family, including erbB1 (EGF-R; HER1), erbB2, (HER2), erbB3 (HER3) and erbB4 (HER4).
[0080] Unless otherwise defined, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well known and commonly used in the art. Standard techniques are used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001)), which is incorporated herein by reference. The nomenclatures utilized in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

DESCRIPTION OF THE DRAWINGS

[0081] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0082] FIG. 1: A topology map of the annealing locations of mouse specific VH primers and the position of required restriction sites that are introduced by overhanging sequences at the 3′ end of primers.
[0083] FIG. 2: PCR amplification steps (Amplification, Intermediate and Site introduction). The location and names of the mouse VH amplification primers (and mixtures of primers) are indicated per step.
[0084] FIG. 3: Topology of the MV1043 vector. This vector is used for the cloning of human or murine VH fragments. O12 (IGKV1-39) is indicated as the VL gene. Products of this vector in combination with helper phages in E. coli cells allow the generation of phages that display Fab fragments on the surface of the phage particles as a fusion product to the g3 protein and presence of the vector in the phage as the genetic content (F1 ORI).
[0085] FIG. 4: The topology of the mouse Ckappa locus downstream of the J-segments. Both enhancers and Ckappa region are indicated. The lower arrow indicates the region that is removed in order to silence the locus.
[0086] FIG. 5: The topology of the mouse C-lambda locus. All three active V-regions are indicated (Igl-V1, V2 and V3) as are the J-segments (Igl-J1, Igl-J2, Igl-J3, Igl-J4 and the pseudo segment Igl-J3p) and constant regions (Igl-C1, Igl-C2, Igl-C3 and Igl-C4). The regions that are deleted in order to silence the locus are indicated by deletion markers. These deletions include all active V genes (1, 2 and 3) and the intergenic segment between V2 and V3.
[0087] FIG. 6: Construct topology of IGKV1-39/J-Ck with an intron located in the leader open reading frame (ORF).
[0088] FIG. 7: Construct topology of IGLV2-14/J-Ck with an intron located in the leader open reading frame (ORF).
[0089] FIG. 8: Construct topology of VkP-IGKV1-39/J-Ck (VkP-O12). The promoter originates from the IGKV1-39 gene and is placed directly in front of the required elements for efficient transcription and translation. Intergenic sequences (including the enhancers) are derived from mice and obtained from BAC clones. The C-kappa sequence codes for the kappa constant region of rat.
[0090] FIG. 9: Construct topology of VkP-IGLV2-14/J-Ck (VkP-2a2). The promoter originates from the IGKV1-39 gene and is placed directly in front of the required elements for efficient transcription and translation. Intergenic sequences (including the enhancers) are derived from mice and obtained from BAC clones. The C-kappa sequence codes for the kappa constant region of rat.
[0091] FIG. 10: Construct topology of VkP-IGKV1-39/J-Ck-Δ1 (VkP-O12-del1) is identical to VkP-IGKV1-39/J-Ck from FIG. 9 except that the intron enhancer region is removed.
[0092] FIG. 11: Construct topology of VkP-IGKV1-39/J-Ck-Δ2 VkP-O12-del2) is identical to VkP-IGKV1-39/J-Ck-Δ1 from FIG. 10 except that a large piece of the intergenic region between the Ck gene and 3′ enhancer is deleted. In addition, the 3′ enhancer is reduced in size from 809 bp to 125 bp.
[0093] FIG. 12: Overview of the sequences used or referred to in this application: Human germline IGKV1-39/J DNA (SEQ ID NO:84); human germline IGKV1-39/J Protein (SEQ ID NO:85); human germline IGLV2-14/J DNA (SEQ ID NO:86); human germline IGLV2-14/J Protein (SEQ ID NO:87); Rat IGCK allele a DNA (SEQ ID NO:88); Rat IGCK allele a protein (SEQ ID NO:89); IGKV1-39/J-Ck (SEQ ID NO:90); IGLV2-14/J-Ck (SEQ ID NO:91); VkP-IGKV1-39/J-Ck (SEQ ID NO:92); VkP-IGKV1-39/J-Ck-Δ1 (SEQ ID NO:93); VkP-IGKV1-39/J-Ck-Δ2 (SEQ ID NO:94); VkP-IGLV2-14/J-Ck (SEQ ID NO:95); pSELECT-IGKV1-39/J-Ck (SEQ ID NO:96); pSelect-IGLV2-14/J-Ck (SEQ ID NO:97); MV1043 (SEQ ID NO:98); and MV1057 (SEQ ID NO:99).
[0094] FIGS. 13A-C: Generation of Rosa26-IgVk1-39 KI allele. FIG. 13A Schematic drawing of the pCAGGS-IgVK1-39 targeting vector. FIG. 13B Nucleotide sequence of the pCAGGS-IgVK1-39 targeting vector (SEQ ID NO:100). FIG. 13C Targeting strategy.
[0095] FIGS. 14A-C: FIG. 14A Southern blot analysis of genomic DNA of ES clones comprising an insertion of the pCAGGS-IgVK1-39 targeting vector. Genomic DNA of four independent clones was digested with AseI and probed with 5e1 indicating the 5′-border of the targeting vector. All clones comprise a correct insertion of the targeting vector at the 5′ end. FIG. 14B Southern blot analysis of genomic DNA of ES clones comprising an insertion of the pCAGGS-IgVK1-39 targeting vector. Genomic DNA of four independent clones was digested with MscI and probed with 3e1 indicating the 3′-border of the targeting vector. All clones comprise a correct insertion of the targeting vector at the 3′ end. FIG. 14C Southern blot analysis of genomic DNA of ES clones comprising an insertion of the pCAGGS-IgVK1-39 targeting vector. Genomic DNA of four independent clones was digested with BamHI and probed with an internal Neo probe indicating the 5′-border of the targeting vector. All clones comprise a correct, single insertion of the targeting vector.
[0096] FIGS. 15A-C: Generation of Rosa26-IgV12-14 KI allele. FIG. 15A Schematic drawing of the pCAGGS-IgVL2-14 targeting vector. FIG. 15B Nucleotide sequence of the pCAGGS-IgVL2-14 targeting vector containing the CAGGS expression insert (SEQ ID NO:101) based on the rearranged germline IGLV2-14/J V lambda region (IGLV2-14/J-Ck). FIG. 15C Targeting strategy.
[0097] FIG. 16: Epibase® profile of IGKV1-39 residues 1-107 (SEQ ID NO:85). FIG. 16A displays the binding strength for DRB1 allotypes. FIG. 16C displays the binding strength for DRB3/4/5, DQ and DP allotypes. The values in the figure represent dissociation constants (Kds) and are plotted on a logarithmic scale in the range 0.01 μM-0.1 μM (very strong binders may have run off the plot). For medium binding peptides, qualitative values are given only, and weak and non-binders are not shown. Values are plotted on the first residue of the peptide in the target sequence (the peptide itself extends by another nine residues). Importantly, only the strongest binding receptor for each peptide is shown: cross-reacting allotypes with lower affinity are not visible in this plot. The strongest binding receptor is indicated by its serotypic name. Finally, any germline-filtered peptides are plotted with a lighter color in the epitope map (in this case, no non-self epitopes were found). FIG. 16B shows the HLA binding promiscuity for every decameric peptide (Y-axis: the number of HLA allotypes recognizing critical epitopes in each of the peptides starting at the indicated residue shown on the X-axis). The promiscuity is measured as the number of allotypes out of the total of 47 for which the peptide is a critical binder. White columns refer to self-peptides, and black columns (absent here) to non-self peptides.
[0098] FIG. 17: Epitope map of IGKV1-39 showing the presence of peptide binders predicted in the sequence of IGKV1-39 by serotype in the 15-mer format. Each 15-mer is numbered as indicated in the top of the figure. The full sequence of the corresponding 15-mer is listed in Table 7. Black boxes indicate the presence of one or more critical self-epitopes in the 15-mer for the serotype listed on the left. Critical epitopes are operationally defined as strong or medium DRB1 binders and strong DRB3/4/5 or DP or DQ binders.
[0099] FIGS. 18A-B: Constitutive knock-out (KO) of the Ig kappa locus. FIG. 18A Targeting strategy. FIG. 18B Schematic drawing of the pIgKappa targeting vector.
[0100] FIGS. 19A-B: Constitutive KO of the Ig lambda locus. FIG. 19A First step of the targeting strategy. FIG. 19B Second step of the targeting strategy.
[0101] FIGS. 20A-C: Schematic drawing of targeting vectors. FIG. 20A pVkP-O12 (VkP-IGKV1-39/J-Ck); FIG. 20B pVkP-O12-del1 (VkP-IGKV1-39/J-Ck-Δ1); FIG. 20C pVkP-O12-del2 (VkP-IGKV1-39/J-Ck-Δ2).
[0102] FIGS. 21A-C: Targeting strategies for insertion of transgene into the Rosa26 locus by targeted transgenesis using RMCE. FIG. 21A VkP-O12 (VkP-IGKV1-39/J-Ck); FIG. 21B VkP-O12-del1 (VkP-IGKV1-39/J-Ck-Δ1); FIG. 21C VkP-O12-del2 (VkP-IGKV1-39/J-Ck-Δ2).
[0103] FIG. 22: Topology of the MV1057 vector. Replacing the indicated stuffer fragment with a VH fragment yields an expression vector that can be transfected to eukaryotic cells for the production of IgG1 antibodies with light chains containing an O12 (IGKV1-39) VL gene.
[0104] FIG. 23: Lack of transgenic human Vk1 light chain expression in non-B cell populations of the spleen.
[0105] FIG. 24: Transgenic human Vk1 light chain is expressed in all B cell populations of the spleen.
[0106] FIG. 25: Transgenic human Vk1 light chain is expressed in B1 cells of the peritoneal cavity.
[0107] FIGS. 26A-B: Transgenic human Vk1 light chain is not expressed in pro- and pre-B cells but in the immature and recirculating populations B cells in the bone marrow. FIG. 26A Gating of bone marrow cells. FIG. 26B Histograms of transgene expression with overlay from one WT control.
[0108] FIG. 27: Transgenic human Vk1 light chain is directly correlated with endogenous light chain and IgM expression in circulating B cells in the blood.
[0109] FIG. 28: Parameters of stability for stable clones containing the germline IGKV1-39 gene.
[0110] FIG. 29A-B: Antibody mixtures used for staining of lymphocyte populations. BM=bone marrow, PC=peritoneal cavity, PP=Peyer's patches.

DETAILED DESCRIPTION OF THE INVENTION

Examples

Example 1: Human Light Chain V-Gene Clones

[0111] This example describes the rationale behind the choice of two human light chain V-genes, one gene of the kappa type and one gene of the lambda type, that are used as a proof of concept for light chain expressing transgenic mice. De Wildt et al. 1999 (de Wildt et al. (1999), J. Mol. Biol. 285(3):895) analyzed the expression of human light chains in peripheral IgG-positive B-cells. Based on these data, IGKV1-39 (O12) and IGLV2-14 (2a2) were chosen as light chains as they were well represented in the B-cell repertoire. The J-segment sequence of the light chains has been chosen based upon sequences as presented in GenBank ABA26122 for IGKV1-39 (B. J. Rabquer, S. L. Smithson, A. K. Shriner and M. A. J. Westerink) and GenBank AAF20450 for IGLV2-14 (O. Ignatovich, I. M. Tomlinson, A. V. Popov, M. Bruggemann and G. J. Winter, J. Mol. Biol. 294 (2):457-465 (1999)).
[0112] All framework segments are converted into germline amino acid sequences to provide the lowest immunogenicity possible in potential clinical applications.

Example 2: Obtaining Mouse Heavy Chain V-Genes that Pair with Human IGKV1-39 Gene Segment to Form Functional Antibody Binding Sites

[0113] This example describes the identification of mouse heavy chain V-genes that are capable of pairing with a single, rearranged human germline IGKV1-39/J region. A spleen VH repertoire from mice that were immunized with tetanus toxoid was cloned in a phage display Fab vector with a single human IGKV1-39-C kappa light chain and subjected to panning against tetanus toxoid. Clones obtained after a single round of panning were analyzed for their binding specificity. The murine VH genes encoding tetanus toxoid-specific Fab fragments were subjected to sequence analysis to identify unique clones and assign VH, DH and JH utilization.
[0114] Many of the protocols described here are standard protocols for the construction of phage display libraries and the panning of phages for binding to an antigen of interest and described in Antibody Phage Display: Methods and Protocols (editor(s): Philippa M. O'Brien and Robert Aitken).

Immunizations

[0115] BALB/c mice received one immunization with tetanus toxoid and were boosted after six weeks with tetanus toxoid.

Splenocyte Isolation

[0116] Preparation of spleen cell suspension. After dissection, the spleen was washed with PBS and transferred to a 60 mm Petri dish with 20 ml PBS. A syringe capped with 20 ml PBS and a G20 needle was used to repeatedly flush the spleen. After washing the flushed cells with PBS, the cells were carefully brought into suspension using 20 ml PBS and left on a bench for five minutes to separate the splenocytes from the debris and cell clusters. The splenocytes suspension was transferred on top of a Ficoll-Paque™ PLUS-filled tube and processed according to the manufacturer's procedures for lymphocyte isolation (Amersham Biosciences).

RNA Isolation and cDNA Synthesis

[0117] After isolation and pelleting of lymphocytes, the cells were suspended in TRIzol LS Reagent (Invitrogen) for the isolation of total RNA according to the accompanying manufacturer's protocol and subjected to reverse transcription reaction using 1 microgram of RNA, Superscript III RT in combination with dT20 according to manufacturer's procedures (Invitrogen).

PCR Amplification of cDNA

[0118] The cDNA was amplified in a PCR reaction using primer combinations that allow the amplification of approximately 110 different murine V-genes belonging to 15 VH families (Table 1; RefSeq NG_005838; Thiebe et al. 1999, European Journal of Immunology 29:2072-2081). In the first round, primer combinations that bind to the 5′ end of the V-genes and 3′ end of the J regions were used. In the second round, PCR products that were generated with the MJH-Rev2 primer were amplified in order to introduce modifications in the 3′ region to enable efficient cloning of the products. In the last round of amplification, all PCR products were amplified using primers that introduce a SfiI restriction site at the 5′ end and a BstEII restriction site at the 3′ end (sec FIGS. 1 and 2, and Table 1).
[0119] Reaction conditions for 1st round PCR: four different reactions combining all 25 forward primers (MVH1 to MVH25, Table 1 and FIG. 2) and one reverse primer per reaction (MJH-Rev1, MJH-Rev2, MJH-Rev3 or MJH-Rev4; see Table 1 and FIG. 2). Fifty microliters PCR volumes were composed of 2 microliters cDNA (from RT reactions), 10 microliters 5* Phusion polymerase HF buffer, 40 nM of each of the 25 forward primers (total concentration of 1 micromolar), 1 micromolar reverse primer, 1 microliter 10 mM dNTP stock, 1.25 unit Phusion polymerase and sterile MQ water. The thermocycler program consisted of a touch down program: one cycle 98° C. for 30 seconds, 30 cycles 98° C. for ten seconds, 58° C. decreasing 0.2° C. per cycle ten seconds, 72° C. 20 seconds and one cycle 72° C. for three minutes. The second round PCR program was set up only for the products of the first PCR that contain the MJH-Rev2 primer: two different reactions combining either the ExtMVH-1 or ExtMVH-2 primers (Table 1 and FIG. 2) in combination with the reverse primer ExtMJH-Rev2int (Table 1 and FIG. 2). Fifty microliters PCR volumes were composed of 50 ng PCR product (from first PCR round), 10 microliters 5* Phusion polymerase HF buffer, 500 nM of each forward primer, 1 micromolar reverse primer, 1 microliter 10 mM dNTP stock, 1.25 unit Phusion polymerase and sterile MQ water. The thermocycler program consisted of a touch down program followed by a regular amplification step: one cycle 98° C. for 30 seconds, ten cycles 98° C. for ten seconds, 65° C. decreasing 1.5° C. per cycle ten seconds, 72° C. 20 seconds, ten cycles 98° C. for ten seconds, 55° C. ten seconds, 72° C. 20 seconds and one cycle 72° C. for three minutes. The third round PCR program was setup as described in FIG. 2. Fifty microliters PCR volumes were composed of 50 ng PCR product (from earlier PCR rounds, FIG. 2), 10 microliters 5* Phusion polymerase HF buffer, 1 micromolar forward primer (Table 1 and FIG. 2), 1 micromolar reverse primer, 1 microliter 10 mM dNTP stock, 1.25 unit Phusion polymerase and sterile MQ water. The program consists of a touch down program followed by a regular amplification step: one cycle 98° C. for 30 seconds, ten cycles 98° C. for ten seconds, 65° C. decreasing 1.5° C. per cycle ten seconds, 72° C. 20 seconds, ten cycles 98° C. for ten seconds, 55° C. ten seconds, 72° C. 20 seconds and one cycle 72° C. for three minutes. After PCR amplifications, all PCR products were gel purified using Qiaex II according to the manufacturer's protocols.

Restriction Enzyme Digestions

[0120] Purified products were digested with BstEII and SfiI in two steps. First 1 microgram of DNA was digested in 100 microliters reactions consisting of 10 microliters of 10* NEB buffer 3 (New England Biolabs), 1 microliter 100* BSA, 12.5 unit BstEII and sterile water for six hours at 60° C. in a stove. The products were purified using Qiaquick PCR Purification kit from Qiagen according to the manual instructions and eluted in 40 microliters water. Next all products were further digested with SfiI in 100 microliters reactions consisting of 10 microliters of 10* NEB buffer 2 (New England Biolabs), 1 microliter 100* BSA, 12.5 unit SfiI and sterile water for 12 hours at 50° C. in a stove. The digested fragments were purified by Qiaquick Gel Extraction kit following gel separation on a 20 cm 1.5% agarose TBE plus ethidium bromide gel at 80 V. 100 micrograms of the acceptor vector (MV1043, FIGS. 3 and 12) was digested with 50 units Eco91I in 600 microliters under standard conditions (Tango buffer) and next purified on a 0.9% agarose gel. After a second digestion step under prescribed conditions with 400 units SfiI in 500 microliters for 12 hours, 100 units BsrGI were added for three hours at 50° C.

Ligations

[0121] Each PCR product was ligated separately according to the following scheme: 70 ng digested PCR products, 300 ng digested acceptor vector, 100 units T4 Ligase (NEB), 1* ligase buffer in 30 microliters for 16 hours at 12° C. The ligation reactions were purified with phenol/chloroform/isoamyl alcohol extractions followed by glycogen precipitations (Sigma Aldrich #G1767) according to the manufacturer's protocol and finally dissolved in 25 microliters sterile water.

Transformations and Library Storage

[0122] The purified ligation products were transformed by electroporation using 1200 microliters TG1 electrocompetent bacteria (Stratagene #200123) per ligation batch and plated on LB carbenicillin plates containing 4% glucose. Libraries were harvested by scraping the bacteria in 50 ml LB carbenicillin. After centrifugation at 2000 g for 20 minutes at 4° C., the bacterial pellets were resuspended carefully in 2 ml ice cold 2*TY/30% glycerol on ice water and frozen on dry ice/ethanol before storage at −80° C.

Library Amplification

[0123] Libraries were grown and harvested according to procedures as described by Kramer et al. 2003 (Kramer et al. (2003), Nucleic Acids Res. 31(11):e59) using VCSM13 (Stratagene) as helper phage strain.

Selection of Phages on Coated Immunotubes

[0124] Tetanus toxoid was dissolved in PBS in a concentration of 2 μg/ml and coated to MAXISORP™ Nunc-Immuno Tube (Nunc 444474) overnight at 4° C. After discarding the coating solution, the tubes were blocked with 2% skim milk (ELK) in PBS (blocking buffer) for one hour at RT. In parallel, 0.5 ml of the phage library was mixed with 1 ml blocking buffer and incubated for 20 minutes at room temperature. After blocking the phages, the phage solution was added to the tetanus toxoid-coated tubes and incubated for two hours at RT on a slowly rotating platform to allow binding. Next, the tubes were washed ten times with PBS/0.05% TWEEN™-20 detergent followed by phage elution by an incubation with 1 ml 50 mM glycine-HCl pH 2.2 ten minutes at RT on rotating wheel and directly followed by neutralization of the harvested eluent with 0.5 ml 1 M Tris-HCl pH 7.5.

Harvesting Phage Clones

[0125] Five ml XL1-Blue MRF (Stratagene) culture at O.D. 0.4 was added to the harvested phage solution and incubated for 30 minutes at 37° C. without shaking to allow infection of the phages. Bacteria were plated on Carbenicillin/Tetracycline 4% glucose 2*TY plates and grown overnight at 37° C.

Phage Production

[0126] Phages were grown and processed as described by Kramer et al. 2003 (Kramer et al. 2003, Nucleic Acids Res. 31(11):e59) using VCSM13 as helper phage strain.

Phage ELISA

[0127] ELISA plates were coated with 100 microliters tetanus toxoid per well at a concentration of 2 micrograms/ml in PBS overnight at 4° C. Plates coated with 100 microliters thyroglobulin at a concentration of 2 micrograms/ml in PBS were used as a negative control. Wells were emptied, dried by tapping on a paper towel, filled completely with PBS-4% skimmed milk (ELK) and incubated for one hour at room temperature to block the wells. After discarding the block solution, phage minipreps pre-mixed with 50 μl blocking solution were added and incubated for one hour at RT. Next five washing steps with PBS-0.05% Tween-20 removed unbound phages. Bound phages were detected by incubating the wells with 100 microliters anti-M13-HRP antibody conjugate (diluted 1/5000 in blocking buffer) for one hour at room temperature. Free antibody was removed by repeating the washing steps as described above, followed by TMB substrate incubation until color development was visible. The reaction was stopped by adding 100 microliters of 2 M H2SO4 per well and analyzed on an ELISA reader at 450 nm emission wavelength (Table 2). Higher numbers indicate stronger signals and thus higher incidence of specific binding of the phage-Fab complex.

Sequencing

[0128] Clones that gave signals at least three times above the background signal (Table 2) were propagated, used for DNA miniprep procedures (see procedures Qiagen miniPrep manual) and subjected to nucleotide sequence analysis. Sequencing was performed according to the Big Dye 1.1 kit accompanying manual (Applied Biosystems) using a reverse primer (CH1_Rev1, Table 1) recognizing a 5′ sequence of the CH1 region of the human IgG1 heavy chain (present in the Fab display vector MV1043, FIGS. 3 and 12). Mouse VH sequences of 28 tetanus toxoid binding clones are depicted in Table 3. The results show that the selected murine VH genes belong to different gene families, and different individual members from these gene families are able to pair with the rearranged human IGKV1-39/J VH region to form functional tetanus toxoid-specific antibody binding sites. From the sequence analyses, it was concluded that the murine VH regions utilize a diversity of DH and JH gene segments.

Example 3: Silencing of the Mouse Kappa Light Chain Locus

[0129] This example describes the silencing of the mouse endogenous kappa light chain locus. The endogenous kappa locus is modified by homologous recombination in ES cells, followed by the introduction of genetically modified ES cells in mouse embryos to obtain genetically adapted offspring.
[0130] A vector that contains an assembled nucleotide sequence consisting of a part comprising the J-region to 338 bp downstream of the J5 gene segment fused to a sequence ending 3′ of the 3′ CK enhancer is used for homologous recombination in ES cells. The assembled sequence is used to delete a genomic DNA fragment spanning from 3′ of the JK region to just 3′ of the 3′ CK enhancer. As a consequence of this procedure, the CK constant gene, the 3′ enhancer and some intergenic regions are removed (see FIGS. 4 and 18A-B).

Construction of the Targeting Vector

[0131] A vector that received 4.5-8 kb flanking arms on the 3′ and 5′ end fused to the deletion segment was used for targeted homologous recombination in an ES cell line. Both arms were obtained by PCR means ensuring maximum homology. The targeting strategy allows generation of constitutive KO allele. The mouse genomic sequence encompassing the Igk intronic enhancer, Igk constant region and the Igk 3′ enhancer was replaced with a PuroR cassette, which was flanked by F3 sites and inserted downstream of the Jk elements. Flp-mediated removal of the selection marker resulted in a constitutive KO allele. The replacement of the Igk MiEk-Igk C-Igk 3′E genomic region (approximately 10 kb) with a F3-Puro cassette (approx. 3 kb) was likely to decrease the efficiency of homologous recombination. Therefore, the arms of homology were extended accordingly and more ES cell colonies were analyzed after transfection in order to identify homologous recombinant clones.

Generation of ES Cells Bearing the Deleted Kappa Fragment

[0132] The generation of genetically modified ES cells was essentially performed as described (Seibler et al. (2003), Nucleic Acids Res. February 15; 31(4):e12). See also Example 14 for a detailed description.

Generation of ES Mice by Tetraploid Embryo Complementation

[0133] The production of mice by tetraploid embryo complementation using genetically modified ES cells was essentially performed as described (Eggan et al., PNAS 98:6209-6214; J. Seibler et al. (2003), Nucleic Acids Res. February 15; 31(4):e12; Hogan et al. (1994), Summary of mouse development, Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y., pp. 253-289).

Example 4: Silencing of the Mouse Lambda Light Chain Locus

[0134] This example describes the silencing of the mouse endogenous lambda light chain locus. The endogenous lambda locus is modified by homologous recombination in ES cells followed by the introduction of genetically modified ES cells in mouse embryos to obtain genetically adapted offspring.
[0135] Two regions of the murine lambda locus that together contain all functional lambda V regions are subject to deletion.
[0136] The first region targeted for homologous recombination-based deletion is a region that is located 408 bp upstream of the start site of the IGLV2 gene segment and ends 215 bp downstream of IGLV3 gene segment, including the intergenic sequence stretch between these IGLV gene segments. The second region that is subject to a deletion involves the IGLV1 gene segment consisting of a fragment spanning from 392 bp upstream to 171 bp downstream of the IGLV1 gene segment. As a consequence of these two deletion steps, all functional V-lambda genes segments are deleted, rendering the locus functionally inactive (FIGS. 5 and 19A-B).

Construction of the Targeting Vectors

[0137] Vectors that received 3-9.6 kb flanking arms on the 3′ and 5′ end fused to the deletion segment were used for targeted homologous recombination in an ES cell line. Both arms were obtained by PCR means ensuring maximum homology. In a first step, the mouse genomic sequence encompassing the Igl V2-V3 regions were replaced with a PuroR cassette flanked by F3 sites, which yields a constitutive KO allele after Flp-mediated removal of selection marker (see FIG. 19A). In a second step, the mouse genomic sequence encompassing the Igl V1 region was replaced with a Neo cassette in ES cell clones which already carried a deletion of the Igl V2-V3 regions (see FIG. 19B). The selection marker (NeoR) was flanked by FRT sites. A constitutive KO allele was obtained after Flp-mediated removal of selection markers.

Generation of ES Cells Bearing the Deleted Lambda Fragment

[0138] The generation of genetically modified ES cells was essentially performed as described (J. Seibler, B. Zevnik, B. KUter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kuhn, F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12). See also, Example 14 for a detailed description. To show that both targeting events occurred on the same chromosome several double targeted clones were selected for the in vitro deletion with pCMV C31deltaCpG. The clones were expanded under antibiotic pressure on a mitotically inactivated feeder layer comprised of mouse embryonic fibroblasts in DMEM High Glucose medium containing 20% FCS (PAN) and 1200 μ/mL Leukemia Inhibitory Factor (Millipore ESG 1107). 1×107 cells from each clone were electroporated with 20 μg of circular pCMV C31deltaCpG at 240 V and 500 μF and plated on four 10 cm dishes each. Two to three days after electroporation, cells were harvested and analyzed by PCR. Primers used were:
[0139] 
[00001] [TABLE-US-00001]
    (SEQ ID NO: 1)
    2005_5:   CCCTTTCCAATCTTTATGGG
   
    (SEQ ID NO: 2)
    2005_7:   AGGTGGATTGGTGTCTTTTTCTC
   
    (SEQ ID NO: 3)
    2005_9:   GTCATGTCGGCGACCCTACGCC
[0140] PCR reactions were performed in mixtures comprising 5 μl PCR Buffer 10× (Invitrogen), 2 μl MgCl2 (50 mM), 1 μl dNTPs (10 mM), 1 μl first primer (5 μM), 1 μl second primer (5 μM), 0.4 μl Taq (5 U/ul, Invitrogen), 37.6 μl H2O, and 2 μl DNA. The program used was 95° C. for five minutes; followed by 35 cycles of 95° C. for 30 seconds; 60° C. for 30 seconds; 72° C. for 1 minute; followed by 72° C. for ten minutes.

Generation of ES Mice by Tetraploid Embryo Complementation

[0141] The production of mice by tetraploid embryo complementation using genetically modified ES cells was essentially performed as described (Eggan et al., PNAS 98:6209-6214; J. Seibler, B. Zevnik, B. Küter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kühn, and F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12; Hogan et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.), pp. 253-289).

Example 5: Construction of the CAGGS Expression Insert Based on a Rearranged Human Germline IGKV1-39/J-Ck Gene (IGKV1-39/J-Ck)

[0142] This example describes the construction of a CAGGS expression cassette incorporating the rearranged human germline IGKV1-39/J region. This insert expression cassette encompasses cloning sites, a Kozak sequence, a leader sequence containing an intron, an open reading frame of the rearranged IGKV1-39 region, a rat CK constant region from allele a and a translational stop sequence (IGKV1-39/J-Ck; FIG. 6). The primary construct consists of naturally occurring sequences and has been analyzed and optimized by removing undesired cis acting elements like internal TATA-boxes, poly adenylation signals, chi-sites, ribosomal entry sites, AT-rich or GC-rich sequence stretches, ARE-, INS- and CRS sequence elements, repeat sequences, RNA secondary structures, (cryptic) splice donor and acceptor sites and splice branch points (GeneArt GmbH). In addition, the codon usage in the open reading frame regions is optimized for expression in mice. The intron sequence is unchanged and thus represents the sequence identical to the coding part of the human IGKV1-39 leader intron.
[0143] At the 5′ end of the expression cassette, a NotI site was introduced and on the 3′ site a NheI site. Both sites are used for cloning in the CAGGS expression module. After gene assembly according to methods used by GeneArt, the insert is digested with NotI-NheI and cloned into the expression module containing a CAGGS promoter, a stopper sequence flanked by LoxP sites (“foxed”), a polyadenylation signal sequence and, at the 5′ and 3′ end, sequences to facilitate homologous recombination into the Rosa26 locus of mouse ES cell lines. Promoter and/or cDNA fragments were amplified by PCR, confirmed by sequencing and/or cloned directly from delivered plasmids into an RMCE exchange vector harboring the indicated features. A schematic drawing and the confirmed sequence of the final targeting vector pCAGGS-IgVK1-39 are shown in FIGS. 13A and 13B. The targeting strategy is depicted in FIG. 13C.

Example 6: CAGGS Expression Insert Based on the Rearranged Germline IGLV2-14/J V Lambda Region (IGLV2-14/J-Ck)

[0144] This example describes the sequence and insertion of an expression cassette incorporating the rearranged germline IGLV2-14/J V lambda region. This insert encompasses cloning sites, a Kozak sequence, a leader sequence containing an intron, an open reading frame of the rearranged IGLV2-14/J region, a rat CK constant region from allele a and a translational stop sequence (IGLV2-14/J-Ck; FIG. 7). The primary construct consists of naturally-occurring sequences and has been analyzed and optimized by removing undesired cis acting elements like: internal TATA-boxes, poly adenylation signals, chi-sites, ribosomal entry sites, AT-rich or GC-rich sequence stretches, ARE-, INS- and CRS sequence elements, repeat sequences, RNA secondary structures, (cryptic) splice donor and acceptor sites and splice branch points (GeneArt GmbH). In addition, the codon usage in the open reading frame regions was optimized for expression in mice. The intron sequence is unchanged and thus represents the sequence identical to the human IGKV1-39 leader intron.
[0145] At the 5′ end of the expression cassette, a NotI site was introduced and on the 3′ site a NheI site. Both sites are used for cloning in the CAGGS expression module as described by TaconicArtemis. After gene assembly according to methods used by GeneArt, the insert was digested with NotI-NheI and cloned into the expression module containing a CAGGS promoter, a stopper sequence flanked by LoxP sites (“foxed”), a polyadenylation signal sequence and, at the 5′ and 3′ end, sequences to facilitate homologous recombination into the Rosa26 locus of mouse ES cell lines. To construct the final ROSA26 RMCE targeting vector, promoter and/or cDNA fragments were amplified by PCR. Amplified products were confirmed by sequencing and/or cloned directly from delivered plasmids into an RMCE exchange vector harboring the indicated features. A schematic drawing and the confirmed sequence of the final targeting vector pCAGGS-IgVL2-14 is shown in FIGS. 15A and 15B. The targeting strategy is depicted in FIG. 15C.

Example 7: Expression of IGKV1-39/J-Ck in HEK293 Cell Lines (pSELECT-IGKV1-39/J-Ck)

[0146] This example describes a method to verify that the IGKV1-39/J-Ck constructs described in Example 5 enable expression and detection of the IGKV1-39/J-Ck L chain in HEK293 cells. The IGKV1-39/J insert (FIG. 6) was modified at the 5′ end by changing the NotI site into a SalI site. This change is required for cloning of the product into the expression cassette plasmid pSELECT-hygro (InvivoGen). The CAGGS expression insert IGKV1-39/J-Ck and pSELECT-hygro were digested with SalI and NheI, ligated and used to transform competent XL1-Blue cells using standard techniques. Colonies were picked and DNA purified using Qiagen Midi-prep columns according to the manufacturer's procedures. The resulting light chain (LC) expressing vector named 0817676_pSELECT_0815426 was used to transfect HEK293 cells with Fugene6 (Roche) according to the manufacturer's protocols. Supernatants were screened for the presence of IGKV1-39/J-Ck light chains by ELISA and western blot using anti-rat-Ck antibodies (Beckton Dickinson #550336 and 553871) and protocols used in the art.
[0147] The VH of anti-tetanus toxoid (TT) IgG MG1494 was cloned into IgG expression vector MV1056 using restriction sites SfiI and BstEII. The resulting clone was sequence verified. HEK293T cells were transfected with five different vector combinations as shown in Table 4 (sec Example 8 for details of vector 0817678_pSELECT_0815427). Supernatants were harvested and IgG concentrations determined (see Table 4). No IgG could be detected for supernatants A and B containing light chain only as expected (detection antibody recognized Fc part of IgG). IgG concentration in supernatants C and D was comparable to that of positive control supernatant E, indicating correct expression of the light chain constructs.
[0148] Binding to TT was analyzed by ELISA to check functionality of the produced antibodies, using hemoglobin as negative control antigen. No TT-specific binding could be detected for supernatants A and B containing light chain only, as expected. TT-specific binding for supernatants C and D was at least as good as for positive control supernatant E, confirming correct expression of the light chain constructs and functional assembly with heavy chain. Antibodies were detected not only using an anti-human IgG secondary antibody, but also an anti-rat Ckappa light chain secondary antibody. The results confirm that the anti-rat Ckappa antibody (BD Pharmingen #553871, clone MRK-1) recognizes the light chain expressed by the pSELECT vectors.
[0149] Supernatants were analyzed by non-reducing SDS-PAGE and Western blot (not shown). Detection using an anti-human IgG heavy chain antibody did not show bands for supernatants A and B containing light chain only, as expected. Results for supernatants C and D were comparable to positive control supernatant E, with a band close to the 170 kD marker as expected for intact IgG. Additional lower molecular weight bands were observed as well for supernatants C, D and E, which might represent degradation products, IgG fragments resulting from (partial) reduction and/or irrelevant protein bands due to non-specific binding of the detection antibody.
[0150] Detection using an anti-rat Ckappa light chain antibody showed a band close to the 26 kD marker for supernatants A and B, as expected for light chain only. This band was much more intense for A compared to B, indicating that the free IGKV1-39 light chain may be better expressed and/or more stable than the free IGLV2-14 light chain. No bands were detected for control supernatant E as expected, since the expressed IgG contains a human Ckappa light chain. For supernatants C and D, expected bands close to the 170 kD marker were observed; lower molecular weight bands were also observed, but to a lesser extent than above using the anti-human IgG antibody.
[0151] In conclusion, transfection of the light chain expression constructs combined with the heavy chain of anti-tetanus toxoid (TT) IgG MG1494 resulted in IgG production comparable to the positive control construct for both the pSELECT kappa and lambda light chain constructs. Both IgG productions yielded ELISA signals in a TT ELISA that were better than or comparable to the control IgG. SDS-PAGE and Western blot analysis confirmed the presence of intact IgG. The tested anti-rat Ckappa antibody worked efficiently in both ELISA and Western blot. Culture supernatant from cells transfected with light chain constructs only did not result in detectable IgG production nor in detectable TT-specific binding, while free light chain was detected on Western blot.

Example 8: Expression of IGLV2-14/J-Ck in HEK293 Cell Lines (pSELECT-IGLV2-14/J-Ck)

[0152] This example describes a method to verify that the IGLV2-14/J constructs described in Example 6 enable expression and detection of the IGLV2-14/J-Ck L chain in HEK293 cells. The IGLV2-14/J-Ck insert (FIG. 7) was modified at the 5′ end by changing the NotI site into a SalI site. This change is required for cloning of the product into the expression cassette plasmid pSELECT-hygro (InvivoGen). The CAGGS expression insert IGLV2-14/J-Ck and pSELECT-hygro were digested with SalI and NheI ligated and used to transform competentXL1-Blue cells using standard techniques. Colonies were picked and DNA purified using Qiagen Midi-prep columns according to the manufacturer's procedures. The resulting light chain (LC) expressing vector named 0817678_pSELECT_0815427 was used to transfect HEK293 cells with Fugene6 (Roche) according to the manufacturer's protocols. Supernatants were screened for the presence of IGLV2-14/J-Ck light chains by ELISA and western blot using anti-rat-Ck antibodies (Becton Dickinson #550336 and 553871) and protocols used in the art. See Example 7 for details and results.

Example 9: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39/J Insert and Multiple Enhancer Elements Derived from the Murine CK Locus (VkP-IGKV1-39/J-Ck; VkP-O12)

[0153] This example describes the construction of an expression cassette that contains relevant elements to enable B-cell and developmental/differentiation stage-specific expression of the rearranged human IGKV1-39 VK region, based on the IGKV1-39 VK promoter region, leader containing an intron, germline V-gene, CDR3, IGKJ segment, mouse intergenic region located between Jk and CK, rat Ck allele a open reading frame, and a mouse intergenic fragment from the 3′ end of the mouse CK gene ending just 3′ of the 3′ CK enhancer.
[0154] Optimized open reading frames of the leader, IGKV1-39 rearranged gene, and rat CK allele a gene, as described in Example 5, was used for the construction of the expression cassette. The VK promoter region was obtained by gene synthesis procedures (GeneArt, GmbH) and is almost identical to the sequence of the human IGKV1-39 region between −500 bp and the ATG (start site) of the gene. The only deviation from the natural sequence is the introduction of a GCCACCATGG Kozak sequence (SEQ ID NO:102) at the ATG (start) site in order to promote translation. A genomic fragment from a mouse BAC clone (TaconicArtemis) is used as the basis for the introduction of individual elements. This fragment is identical to the sequence of the mouse VK locus starting with the intron donor site located directly 3′ of the JK5 region and ending just 3′ of the 3′ CK enhancer and covers approximately 12.5 kb.
[0155] The final construct contains from 5′ to 3′ end the following elements: human genomic IGKV1-39 promoter (500 bp), a Kozak sequence, a human IGKV1-39 leader part 1 (optimized), a human IGKV1-39 leader intron, a human IGKV1-39 leader part 2 (optimized), a human IGKV1-39 germline gene (optimized), a human J-region (optimized), a mouse intergenic region including the intron enhancer element, a rat (Rattus norvegicus) kappa constant region (optimized), and a mouse intergenic region including the 3′ kappa enhancer. The elements of this expression cassette are shown in FIG. 8 and named VkP-IGKV1-39/J-Ck (VkP-O12). An outline of the pVkP-O12 vector and the targeting strategy is depicted in FIGS. 20A and 21A. The vector was introduced into ES cells following standard procedures (see Example 14).

Example 10: Construction of a VK Promoter-Driven Expression Construct Containing an IGLV2-14/J Clone and Multiple CK Locus-Derived Enhancer Elements (VkP-IGLVL2-14/J-Ck; VkP-2a2)

[0156] This example describes the same construct as described in Example 9, except that the IGKV1-39 gene and J-region are replaced by the optimized human IGLV2-14 germline gene including a unique V-J region (VkP-IGLV2-14/J-Ck; VkP-2a2; FIG. 9).

Example 11: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39 Clone Lacking the CK Intron Enhancer Element (VkP-IGKV1-39/J-Ck-Δ1; VkP-O12-Del1)

[0157] The construct described in Example 9 was modified by removing the CK intron enhancer element, located in the intergenic region between the human J region and the rat CK region by standard PCR modification and DNA cloning methodologies (GeneArt, GmBH). The resulting expression cassette is shown in FIG. 10 and named VkP-IGKV1-39/J-Ck-Δ1 (VkP-O12-del1).
[0158] An outline of the pVkP-O12-del1 vector and the targeting strategy is depicted in FIGS. 20B and 21B. The vector was introduced into ES cells following standard procedures (see Example 14).

Example 12: Construction of a VK Promoter-Driven Expression Construct Containing an IGKV1-39 Clone Lacking the CK Intron Enhancer Element and a Truncated 3′ CK Enhancer Element (VkP-IGKV1-39/J-Ck-Δ2; VkP-O12-Del2)

[0159] The construct described in Example 11 was modified by truncating the 3′ CK enhancer element and deleting part of the intergenic region 3′ of the rat Ck gene, to remove potential inhibitory elements. This was achieved by removing the intergenic sequence between an EcoRV site (located 3′ of the rat Ck gene) and the NcoI site present in the 3′ enhancer (5993 bp) and further removing the sequence between the 3′ enhancer BstXI site and the BstXI site 3′ of the 3′ enhancer (474 bp) using standard methods. The resulting expression cassette is shown in FIG. 11 and named VkP-IGKV1-39/J-Ck-Δ2 (VkP-O12-del2).
[0160] An outline of the pVkP-O12-del2 vector and the targeting strategy is depicted in FIGS. 20C and 21C. The vector was introduced into ES cells following standard procedures (see Example 14).

Example 13: Expression of Vk Constructs in Cell Lines

[0161] The constructs described in Examples 9-12 are tested for their ability to produce light chain proteins in the myeloma cell lines MPC11 (ATCC CCL167), B-cell lymphoma WEHI231 (ATCC CRL-1702), the T-cell lymphoma EL4 (ATCC TIB-39) and in HEK293 (ATCC CRL1573). The enhancer and promoter elements in the construct enable expression in the B-cell lines but not in cell lines derived from other tissues. After transfection of the cell lines using purified linearized DNA and Fugene6 (Roche) cells are cultured for transient expression. Cells and supernatant are harvested and subjected to SDS-PAGE analysis followed by western blotting using a specific anti-rat-C-kappa antibody. Supernatants are analyzed in ELISA for secreted L chains using the anti-rat CK antibody (Beckton Dickinson #550336).

Example 14: Generation of Transgenic ES Lines

[0162] All constructs as described in Examples 3, 4, 5, 6, 9, 10, 11 and 12 were used to generate individual stable transgenic ES lines by means of homologous recombination. The methods for generation of transgenic ES lines via homologous recombination are known in the field (e.g., Eggan et al., PNAS 98:6209-6214; J. Seibler, B. Zevnik, B. Küter-Luks, S. Andreas, H. Kern, T. Hennek, A. Rode, C. Heimann, N. Faust, G. Kauselmann, M. Schoor, R. Jaenisch, K. Rajewsky, R. Kiihn, F. Schwenk (2003), Nucleic Acids Res., February 15; 31(4):e12; Hogan et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.), pp. 253-289).
[0163] For all constructs described in Examples 5 and 6, and Examples 9-12, the RMCE ES cell line (derived from mouse strain 129S6B6F1-Gt(ROSA)26Sortm10Arte) was grown on a mitotically inactivated feeder layer comprised of mouse embryonic fibroblasts (MEF) in DMEM High Glucose medium containing 15% FBS (PAN 1302-P220821). Leukemia Inhibitory Factor (Chemicon ESG 1107) was added to the medium at a concentration of 900 U/mL. For manipulation, 2×105 ES-cells were plated on 3.5 cm dishes in 2 ml medium. Directly before transfection, 2 ml fresh medium was added to the cells. Three μI Fugene6 Reagent (Roche; Catalog No. 1 814 443) was mixed with 100 μl serum free medium (OptiMEM I with Glutamax I; Invitrogen; Catalog No. 51985-035) and incubated for five minutes. One hundred μl of the Fugene/OptiMEM solution was added to 2 μg circular vector and 2 μg CAGGS-Flp and incubated for 20 minutes. This transfection complex was added dropwise to the cells and mixed. Fresh medium was added to the cells the following day. From day 2 onwards, the medium was replaced daily with medium containing 250 μg/mL G418 (Geneticin; Invitrogen; Catalog No. 10131-019). Seven days after transfection, single clones were isolated, expanded, and molecular analyzed by Southern blotting according to standard procedures.
[0164] For each construct, analysis of multiple clones by restriction enzyme digestion of genomic DNA of single clones followed by hybridization with 5′ probes, 3′ probes, and internal probes resulted in clones that comprised a correct, single insertion at the correct position in the Rosa26 locus. An example is provided in FIGS. 14A-C.

Example 15: Generation of Transgenic Mouse Strains

[0165] All ES cell lines that were generated and verified for their modifications as described in Example 14 were used to generate stable transgenic mice by means of tetraploid recombination. The methods are known in the field. In general, after administration of hormones, superovulated Balb/c females were mated with Balb/c males. Blastocysts were isolated from the uterus at dpc 3.5. For microinjection, blastocysts were placed in a drop of DMEM with 15% FCS under mineral oil. A flat tip, piezo actuated microinjection-pipette with an internal diameter of 12-15 micrometers was used to inject 10-15 targeted C57BL/6 N.tac ES cells into each blastocyst. After recovery, injected blastocysts were transferred to each uterine horn of 2.5 days post coitum, pseudopregnant NMRI females. Chimerism was measured in chimeras (G0) by coat color contribution of ES cells to the Balb/c host (black/white). Highly chimeric mice were bred to strain C57BL/6 females. Depending on the project requirements, the C57BL/6 mating partners are non-mutant (W) or mutant for the presence of a recombinase gene (Flp-Deleter or Cre-deleter or CreER inducible deleter or combination of Flp-deleter/CreER). Germline transmission was identified by the presence of black, strain C57BL/6, offspring (G1).
[0166] For example, ESC clone IgVK1-39 2683 8 (see Examples 5 and 14) was injected in a total of 62 blastocysts in three independent experiments. Three litters were obtained with a total of six pups. All pups were chimeric. Three heterozygous offspring pups were obtained that were used for further crossing.
[0167] ESC Clone Kappa 2692 A-C10 (see Examples 3 and 14) was injected in a total of 54 blastocysts in three independent experiments. Three litters were obtained with a total of eleven pups, of which ten were chimeric. Eight heterozygous offspring pups were obtained that were used for further crossing.
[0168] ESC Clone Kappa 2692 B-C1 (see Examples 3 and 14) was injected in a total of 51 blastocysts in three independent experiments. Two litters were obtained with a total of six pups, of which four were chimeric. Three heterozygous offspring pups were obtained that were used for further crossing.

Example 16: Breeding

[0169] This example describes the breeding for obtaining mice that contain transgenic expression cassettes as described Example 14 and knock-out mice in which the endogenous lambda and kappa loci have been silenced. The localization of V-lambda on chromosome 16 and CD19 on chromosome 7 allow standard breeding procedures. The breeding of the co-localized Vk locus and Rosa26 locus on chromosome 6 with a distance of about 24 cM requires special attention during the screening as only a percentage of the offspring shows crossover in a way that both modifications are brought together on one chromosome.
[0170] All four loci have to be combined in a single mouse strain that is homo- or heterozygous for CD19-cre (not described) and modified Rosa26 transgene and homozygous for the other loci. Breeding is performed by standard breeding and screening techniques as appropriate and offered by commercial breeding companies (e.g., TaconicArtemis).

Example 17: Immunizations of Mice

[0171] Primary and booster immunization of mice are performed using standard protocols.
[0172] To validate the transgenic expression of human rearranged VK O12 (IGKV1-39)—rat Cκ light chains (see Examples 5, 14-16) in B cells from CD19-HuVκ1 mice and to assess its impact on VH repertoire size, diversity of VH family usage and V(D)J recombination after immunization, the CD19-HuVκ1 transgenic mice are immunized with tetanus toxin vaccine (TT vaccine) and VH sequence diversity of randomly picked clones from CD19-HuVκ1 mice are compared with TT-immunized wt mice and CD19-Cre HuVκ1 negative littermates. Data on the SHM frequency of the human Vκ O12 transgene in the immunized mice are obtained. A diverse collection of at least 40 TT-specific, clonally-unrelated mAbs containing the human VK O12 are recovered from CD19-HuVκ1 mice by phage display.
[0173] For this, three adult CD19-HuVκ1 mice are vaccinated with TT vaccine using standard immunization procedures. After immunization, serum titers are measured using TT specific ELISA (TT: Statens Serum Institute, Art. no. 2674) and spleen suspensions subjected to cell sorting by the FACS procedure after staining with a rat CK-specific monoclonal antibody to isolate transgenic B cells (clone RG7/9.1; BD Pharmingen#553901, Lot#06548). RNA from rat Cκ-positive B cells are extracted and the resulting cDNA material used for library building and SHM analysis.
[0174] The standard monoclonal mouse anti-rat Cκ antibody (clone RG7/9.1; BD Pharmingen#553901, Lot#06548) is used in FACS analysis of transgene expressing B cells (Meyer et al. (1996), Int. Immunol. 8:1561). The clone RG7/9.1 antibody reacts with a monotypic (common) kappa chain determinant. This anti-rat Cκ antibody (clone RG7/9.1 (BD Pharmingen#553901, Lot#06548) is labeled with R-phycoerythrin (PE) using the LYNX rapid conjugation kit according to the manufacturer's instructions for FACS analysis and sorting. The labeled antibody is firstly tested by flow cytometry for binding to rat Cκ-containing functional light chain proteins produced into transiently transfected HEK-293T cells; the un-conjugated antibody serves as a positive control. Two other antibodies shown to bind to rat Cκ by ELISA and Western-blot (see Example 7) are tested as well by flow cytometry.
[0175] Fab-phage display library building is carried out with a set of optimized degenerate PCR primers designed to amplify C57BL/6 VH genes; the minimal library size is 106 clones, and minimal insert frequency is 80%. The vector used, MV1043 (FIGS. 3 and 12), contains the human Vκ O12 fused to a human Cκ region. The rat Cκ is therefore exchanged for the human counterpart in the library generation process.
[0176] Before selection, VH sequencing of 96 randomly picked clones is performed to validate VH repertoire diversity that is compared to diversity obtained from an unselected library previously generated using the same procedures from BALB/c mice immunized with TT. A library from C57Bl/6 wt mice that are immunized in the same way allows diversity comparison between two preselected libraries sharing the same vaccine and the same genetic background.
[0177] Several independent selections are performed on TT coated in immunotubes. Variables that may be included are selections using biotinylated antigens in solution or selections on captured TT. Based on the number and diversity of ELISA-positive clones obtained in the first selections, decisions on additional rounds of selection are made. Clones are considered positive when >3× positive over a negative control clone. Positive clones are analyzed by ELISA against a panel of negative control antigens to verify antigen specificity. The aim is to identify at least 40 unique VH regions, as based on unique CDR3 sequences and VHDJH rearrangements.
[0178] Amplification of the cDNA material from rat Cκ-positive sorted B cells is performed with a PCR forward primer specific to the human leader sequence and a PCR reverse primer specific to the rat Cκ sequence, in a region not redundant with the mouse Cκ sequence, as reported in a recent study (Brady et al. (2006), JIM 315:61). Primer combinations and annealing temperatures are firstly tested on cDNA from HEK-293T cells transfected with 0817676_pSELECT_0815426=pSELECT vector with IGKV1-39 DNA cassette (see Example 7).
[0179] The amplification products is cloned in pJET-1 vector and after XL1-blue transformation, 96 colonies are sequenced for assessing VL SHM frequency by direct comparison to the Vκ O12 (IGKV1-39) germline sequence. The R/S ratio method, as described in our study on human TT-specific antibodies (de Kruif et al. (2009), J. Mol. Biol. 387:548) allows discrimination between random mutations and antigen-driven mutations that occurred on VL sequences.

Example 18: Immunofluorescent Analysis of B Cell Populations in Transgenic Mouse Lines

[0180] This example describes the use of antibodies and flow cytometry to analyze B cell populations in primary (bone marrow) and secondary (spleen, peritoneal) lymphoid organs and blood. Methods and reagents are described in Middendorp et al. (2002), J. Immunol. 168:2695; and Middendorp et al. (2004), J. Immunol. 172:1371. For analysis of early B cell development in bone marrow, cells were surface stained with combinations of antibodies (Becton Dickinson) specific for B220, CD19, CD25, IgM, IgD, mouse Ckappa, mouse Clambda and rat Ckappa to detect pro-B cells, pre-B cells, large pre-B cells, early and late immature B cells and recirculating B cell populations expressing the transgene on their surface. DAPI staining (Invitrogen) was included to exclude dead cells from the analysis and FC block (Becton Dickinson) to inhibit antibody interaction with Fc receptors on myeloid cells. For analysis of surface transgene expression on B cell populations in peripheral lymphoid organs and blood, cells were stained with combinations of antibodies (Becton Dickinson) specific for B220, CD5, CD19, CD21, CD23, IgM, IgD, mouse Ckappa, mouse Clambda and rat Ckappa. DAPI staining was included to exclude dead cells from the analysis and FC block to inhibit antibody interaction with Fc receptors on myeloid cells. In addition, combinations of antibodies (Becton Dickinson) specific for CD3, CD4, CD11b, CD11c and NK1.1 were included to determine if transgene expression occurred in cell types outside of the B cell compartment.
[0181] Three mice heterozygous for the human IGKV1-39/rat Ckappa transgene and heterozygous for the CD19-Cre transgene on a C57BL6 background (HuVk1/CD19-Cre) were analyzed. As controls for the FACS analysis, three littermate mice wild-type for the human IGKV1-39/rat Ckappa transgene and heterozygous for the CD19-Cre transgene on a C57BL6 background (CD19-Cre) and two C57BL6/NTac mice (Wt) were included. All animals were allowed to acclimatize in the animal facility for one week before analysis and all mice were male and six weeks of age. Lymphocytes were isolated from the femurs, spleens, peritoneal cavity and blood of mice using conventional techniques as previously described (Middendorp et al. (2002), J. Immunol. 168:2695; and Middendorp et al. (2004), J. Immunol. 172:1371). Antibodies were pre-combined as shown in FIG. 29A-B and staining was carried out in 96-well plates. Incubation with the PE-conjugated anti-rat C kappa (described above) was carried out before staining with the rat anti-murine antibodies to avoid non-specific binding. After completion of cell staining, labeled cells were analyzed on a Becton Dickinson LSR II FACS machine and the acquired data analyzed with FlowJo software (v6.4.7).
[0182] Transgenic mice were similar in weight, appearance and activity to wild-type mice. No gross anatomical alterations were observed during the harvesting of tissues. No difference was observed in the numbers of B cells in the bone marrow (BM) and spleen (Table 9) or in the numbers of B cells, T cells and myeloid cells in peripheral organs between transgenic and wild-type mice. In addition, the frequency or proportion of the cells in the different lymphocyte developmental pathways was not altered in transgenic mice when compared to wild-type mice. Thus in the double transgenic (HuVk1/CD19-Cre) and transgenic (CD19-Cre) mice lymphoid and most importantly B cell development was indistinguishable from wild-type mice.
[0183] In the peripheral lymphoid organs, staining with the transgene specific antibody (anti-ratCkappa-PE) was only observed in the B cell populations. T cell, myeloid cell and NK cell populations were all negative for surface expression of the transgene in the spleen (FIG. 23). In contrast, in cells stained with the pan B cell markers B220 and CD19 all cells were shifted to the right in the FACS plot indicating cell surface expression of the transgene (FIG. 24). A similar transgene-specific staining was measured in CD5+ B1 cells of the peritoneum, a developmentally distinct population of B cells (FIG. 25).
[0184] Differentiation of B cells from multilineage precursors to mature B cells occurs in the bone marrow. In the lymphocytes analyzed from the bone marrow, extracellular and transgene expression was not detectable in the earliest B cell progenitors the pro- and pre-B cell consistent with the pattern of normal light chain expression (FIGS. 26A-B). Transgene expression first becomes detectable in immature B cells, the developmental stage at which the germline murine light chain undergoes rearrangement and is expressed at the cell surface in the context of the preselected heavy chain (FIGS. 26A-B). Consistent with the staining in the spleen transgenic light chain expression is also detected on mature recirculating B cells (FIGS. 26A-B). Thus the CD19-Cre driven expression of the transgene is consistent with the normal pattern of light chain expression. The staining with the endogenous light chain-specific antibody is more intense than that of the transgene-specific light chain antibody. This may indicate a higher expression level of the endogenous light chain, a more sensitive staining with the endogenous light chain-specific antibody or a combination of both. Importantly, the intensity of the surface expression of the transgenic light chain is correlated with both endogenous light chain and IgM surface expression as observed in staining of circulating B cells in the blood (FIG. 27).
[0185] Thus, overall this analysis demonstrates that expression of the human IGKV1-39/Ckappa transgene is restricted to the B cell compartment and the temporal regulation of its expression is similar to the endogenous kappa and lambda light chains resulting in normal development of all B cell populations. The apparent lower level of expression of the transgene could be explained by the strength of the promoter in comparison to the promoter and enhancers present on endogenous light chain genes or by a delay in transgene expression that gives the endogenous light chains a competitive advantage in pairing with the rearranged heavy chain. This is consistent with the observation that as B cells mature the relative intensity of transgene staining increases compared to the endogenous light chains. In addition, the observation that B cells numbers are normal and that every surface Ig+ B cell co-expresses an endogenous and transgenic light chain supports the conclusion that the IGKV1-39 variable region is capable of pairing with a normal repertoire of different murine heavy chain variable regions. We conclude from this analysis that insertion of the IGKV1-39/rat Ckappa transgene driven by the CD19-Cre activated CAGGS promoter in the Rosa locus facilitates timely and B cell-specific expression of the transgene and that the transgene is capable of pairing with a normal repertoire of murine heavy chains.

Example 19: Epibase® T-Cell Epitope Profile for IGKV1-39

[0186] The protein sequence of IGKV1-39 (FIG. 12, human germline IGKV1-39/J Protein) was scanned for the presence of putative HLA class II restricted epitopes, also known as TH-epitopes. For this, Algonomics' Epibase® platform was applied to IGKV1-39. In short, the platform analyzes the HLA binding specificities of all possible 10-mer peptides derived from a target sequence (Desmet et al. (1992), Nature 356:539-542; Desmet et al. (1997), FASEB J. 11:164-172; Desmet et al. (2002), Proteins 48:31-43; Desmet et al. (2005), Proteins 58:53-69). Profiling is done at the allotype level for 20 DRB1, 7 DRB3/4/5, 13 DQ and 7 DP, i.e., 47 HLA class II receptors in total (see Table 5). Epibase® calculates a quantitative estimate of the free energy of binding ΔGbind of a peptide for each of the 47 HLA class II receptors. These data were then further processed as follows:
[0187] Free energies were converted into Kd-values through ΔGbind=RT ln(Kd).
[0188] Peptides were classified as strong (S), medium (M), weak and non (N) binders. The following cutoffs were applied:
[0189] S: strong binder: Kd<0.1 μM.
[0190] M: medium binder: 0.1 μM≤Kd<0.8 μM.
[0191] N: weak and non-binder: 0.8 μM≤Kd.
[0192] Peptides corresponding to self-peptides were treated separately. The list of self-peptides was taken from 293 antibody germline sequences. They are referred to as “germline-filtered” peptides.
[0193] S- and M-peptides are mapped onto the target sequence in so-called epitope maps; S-affinities are plotted quantitatively; M-values are presented qualitatively. As a general overview of the results, Table 6 lists the number of strong and medium binders in the analyzed proteins, for the groups of HLA class II receptors corresponding to the DRB1, DQ, DP and DRB3/4/5 genes. Counting was done separately for strong and medium affinity binders. Peptides binding to multiple allotypes of the same group were counted as one. Values between brackets refer to germline-filtered peptides. In Table 7, the sequence is shown in a format suitable for experimental work. The sequence is broken down in consecutive 15-mers overlapping by 12 residues. For each 15-mer, the promiscuity is listed (the number of allotypes out of a total of 47 for which the 15-mer contains a critical binder), as well as the implied serotypes. The Epibase® profile and epitope maps are shown in FIGS. 16A-C and 17.
[0194] It was concluded that IGKV1-39 contains no strong non-self DRB1 binders. Typically, significantly more binders were found for DRB1 than for other HLA genes. This is in agreement with experimental evidence that allotypes belonging to the DRB1 group are more potent peptide binders. Medium strength epitopes for DRB1 allotypes are expected to contribute to the population response, and cannot be disregarded. Again, no non-self DRB1 binders were found in IGKV1-39.
[0195] In the humoral response raised against an antigen, the observed TH cell activation/proliferation is generally interpreted in terms of the DRB1 specificity. However, one cannot ignore the possible contribution of the DRB3/4/5, DQ and DP genes. Given the lower expression levels of these genes as compared to DRB1, the focus was on the class of strong epitopes for DRB3/4/5, DQ and DP. “Critical epitopes” are those epitopes that are strong binders for any DRB1, DRB3/4/5, DQ or DP allotype or are medium binders for DRB1. IGKV1-39 contains no strong or medium non-self binders for DRB3/4/5, DQ, or DP.
[0196] A number of peptides are also present in germline sequences (values between brackets in Table 6). Such peptides may very well bind to HLA but they are assumed to be self and, hence, non-immunogenic. In total, six strong and 16 medium germline-filtered DRB1 binders were found in IGKV1-39. Framework region 1 up to framework region 3 is an exact match for germline V-segment VKI 2-1-(1) O12 (VBase), a.k.a. IGKV1-39*01 (IMGT). Framework region 4 is an exact match for germline J-segment JK1 (V-base) a.k.a. IGKJ1*01(IMGT). It is hardly surprising that these segments do not contain any non-self epitopes.

Example 20: Production Characteristics of IGKV1-39

[0197] There is a great demand for antibody discovery platforms that yield therapeutic antibodies that are thermodynamically stable and give good expression yields. These characteristics are important in ensuring the stability of the drug substance during production and after injection of the drug product into the patient. In addition good expression yields impact directly on the cost of drug manufacture and thus pricing, patient access and profitability. Virtually all therapeutic antibodies in clinical use today are composed of human IgG1 and kappa constant regions but use different heavy and light chain variable regions that confer specificity. Human variable heavy and light chain domains can be divided into families that have greater than 80% sequence divergence. When rearranged examples of these families in germline configuration are combined and compared for stability and yield it is clear that the gene families are not equal in terms of biophysical properties. In particular VH3, VH1 and VH5 have favourable stability for the heavy chains and Vk1 and Vk3 have the best stability and yield of light chains. In addition when mutations are introduced as part of the somatic hypermutation process they can interfere with VH/VL pairing. To assess the effect that different light chain genes with different rates of mutation have on the production characteristics of a fixed VH chain, a Fab phage display library was built of light chains (kappa and lambda) from six naïve healthy donors combined with a panel of 44 TT binding heavy chains from immunized donors. After one round of selection TT binding Fab clones were isolated. Several of these shared the same VH gene as the TT clone PG1433 in combination with different light chains. The Fab light chain fragments were recloned into a kappa expression vector and transfected in combination with DNA encoding the heavy chain of PG1433 into 293 cells and specific IgG production measured by ELISA. As demonstrated in Table 8 the selected clones containing PG1433 VH combined with different light chains had between five- and ten-fold lower protein expression PG1433 VH combined with IGKV1-39. Note that all of the light chains contained amino acid mutations within their coding regions that might disrupt VH paring and reduce production stability. Thus, in addition to reducing the chances of unwanted immunogenicity, it is expected that the use of the light chain IGKV1-39 without mutations contributes to improved production stability and yields of various specificity-contributing VH genes. Indeed stable clones generated by the transfection of different VH genes all paired with IGKV1-39 are able to be passaged extensively and still retain robust production characteristics as shown in FIG. 28.

Example 21: Generation of Mice Expressing Fully Human VH and VL Regions

[0198] Transgenic mice described herein are crossed with mice that already contain a human VH locus. Examples of appropriate mice comprising a human VH locus are disclosed in Taylor et al. (1992), Nucleic Acids Res. 20:6287-95; Lonberg et al. (1994), Nature 368:856-9; Green et al. (1994), Nat. Genet. 7:13-21; Dechiara et al. (2009), Methods Mol. Biol. 530:311-24.).
[0199] After crossing and selecting for mice that are at least heterozygous for the IGKV1-39 transgene and the human VH locus, selected mice are immunized with a target. VH genes are harvested as described hereinabove. This method has the advantage that the VH genes are already fully human and thus do not require humanization.

Example 22: Isolation, Characterization, Oligoclonics Formatting and Production of Antibodies Targeting Human IL6 for Treatment of Chronic Inflammatory Diseases Such as Rheumatoid Arthritis

[0200] A spleen VH repertoire from transgenic mice that are immunized with human recombinant IL6 is cloned in a phage display Fab vector with a single human IGKV1-39-C kappa light chain (identical to the mouse transgene) and subjected to panning against the immunogen human IL6. Clones that are obtained after two to four rounds of panning are analyzed for their binding specificity. VH genes encoding IL6-specific Fab fragments are subjected to sequence analysis to identify unique clones and assign VH, DH and JH utilization. The Fab fragments are reformatted as IgG1 molecules and transiently expressed. Unique clones are then grouped based on non-competition in binding assays and subjected to affinity and functional analysis. The most potent anti-IL6 IgG1 mAbs are subsequently expressed as combinations of two, three, four or five heavy chains comprising different VH-regions in the Oligoclonics format, together with one IGKV1-39-C-based kappa light chain and tested in vitro for complex formation with IL-6. The Oligoclonics are also tested in vivo for clearance of human IL-6 from mice. An Oligoclonic with the most potent clearance activity is chosen and the murine VH genes humanized according to conventional methods. The humanized IgG1 are transfected into a mammalian cell line to generate a stable clone. An optimal subclone is selected for the generation of a master cell bank and the generation of clinical trial material.
[0201] Many of the protocols described here are standard protocols for the construction of phage display libraries and the panning of phages for binding to an antigen of interest and are described, for example, in Antibody Phage Display: Methods and Protocols (2002), Editor(s) Philippa M. O'Brien, Robert Aitken, Humana Press, Totowa, N.J., USA.

Immunizations

[0202] Transgenic mice receive three immunizations with human IL6 every two weeks using the adjuvant Sigma titerMax according to manufacturer's instructions.

RNA Isolation and cDNA Synthesis

[0203] Three days after the last immunization, spleens and lymphnodes from the mice are removed and passed through a 70 micron filter into a tube containing PBS pH 7.4 to generate a single cell suspension. After washing and pelleting of lymphocytes, cells are suspended in TRIzol LS Reagent (Invitrogen) for the isolation of total RNA according to the manufacturer's protocol and subjected to reverse transcription reaction using 1 microgram of RNA, Superscript III RT in combination with dT20 according to manufacturer's procedures (Invitrogen).
[0204] The generation of Fab phage display libraries is carried out as described in Example 2.

Selection of Phages on Coated Immunotubes

[0205] Human recombinant IL6 is dissolved in PBS in a concentration of 5 μg/ml and coated to MAXISORP™ Nunc-Immuno Tube (Nunc 444474) overnight at 4° C. After discarding the coating solution, the tubes arc blocked with 2% skim milk (ELK) in PBS (blocking buffer) for one hour at Room Temperature (RT). In parallel, 0.5 ml of the phage library is mixed with 1 ml blocking buffer and incubated for 20 minutes at room temperature. After blocking the phages, the phage solution is added to the IL6-coated tubes and incubated for two hours at RT on a slowly rotating platform to allow binding. Next, the tubes are washed ten times with PBS/0.05% TWEEN™-20 detergent followed by phage elution by incubating with 1 ml 50 mM glycine-HCl pH 2.2 ten minutes at RT on rotating wheel and directly followed by neutralization of the harvested eluent with 0.5 ml 1 M Tris-HCl pH 7.5.

Harvesting Phage Clones

[0206] A 5 ml XL1-Blue MRF (Stratagene) culture at O.D. 0.4 is added to the harvested phage solution and incubated for 30 minutes at 37° C. without shaking to allow infection of the phages. Bacteria are plated on Carbenicillin/Tetracycline 4% glucose 2*TY plates and grown overnight at 37° C.

Phage Production

[0207] Phages are grown and processed as described by Kramer et al. 2003 (Kramer et al. 2003, Nucleic Acids Res. 31(11):e59) using VCSM13 as helper phage strain.

Phage ELISA

[0208] ELISA plates are coated with 100 microliters human recombinant IL6 per well at a concentration of 2.5 micrograms/ml in PBS overnight at 4° C. Plates coated with 100 microliters thyroglobulin at a concentration of 2 micrograms/ml in PBS are used as a negative control. Wells are emptied, dried by tapping on a paper towel, filled completely with PBS-4% skimmed milk (ELK) and incubated for one hour at room temperature to block the wells. After discarding the block solution, phage minipreps pre-mixed with 50 μl blocking solution are added and incubated for one hour at RT. Unbound phages arc subsequently removed by five washing steps with PBS-0.05% Tween-20. Bound phages are detected by incubating the wells with 100 microliters anti-M13-HRP antibody conjugate (diluted 1/5000 in blocking buffer) for one hour at room temperature. Free antibody is removed by repeating the washing steps as described above, followed by TMB substrate incubation until color development was visible. The reaction is stopped by adding 100 microliters of 2 M H2SO4 per well and analyzed on an ELISA reader at 450 nm emission wavelength.

Sequencing

[0209] Clones that give signals at least three times above the background signal are propagated, used for DNA miniprep procedures (see procedures Qiagen miniPrep manual) and subjected to nucleotide sequence analysis. Sequencing is performed according to the Big Dye 1.1 kit accompanying manual (Applied Biosystems) using a reverse primer (CH1_Rev1, Table 1) recognizing a 5′ sequence of the CH1 region of the human IgG1 heavy chain (present in the Fab display vector MV1043, FIGS. 3 and 12). The sequences of the murine VH regions are analyzed for diversity of DH and JH gene segments.

Construction and Expression of Chimeric IgG1

[0210] Vector MV1057 (FIGS. 12 and 22) was generated by cloning the transgene (IGKV1-39) L chain fragment into a derivative of vector pcDNA3000Neo (Crucell, Leiden, The Netherlands) that contains the human IgG1- and kappa constant regions. VH regions are cloned into MV1057 and nucleotide sequences for all constructs are verified according to standard techniques. The resulting constructs are transiently expressed in HEK293T cells and supernatants containing chimeric IgG1 are obtained and purified using standard procedures as described before (M. Throsby 2006, J. Virol. 80:6982-92).

IgG1 Binding and Competition Analysis

[0211] IgG1 antibodies are titrated in ELISA using IL6-coated plates as described above and an anti-human IgG peroxidase conjugate. Competition ELISAs to group antibodies based on epitope recognition are performed by incubating Fab phages together with IgG1 or with commercial antibodies against IL6 (e.g., Abeam cat. no. ab9324) in IL6-coated plates, followed by detection of bound Fab phage using an anti-M13 peroxidase conjugate.

IgG1 Affinity Measurements

[0212] The affinities of the antibodies to IL6 are determined with the Quantitative kinetic protocol on the Octet (ForteBio). Antibodies are captured onto an Anti-Human IgG Fc Capture biosensor and exposed to free IL6 and analyzed using proprietary software to calculate the Kd of each antibody.

Functional Activity of IL6 Antibodies

[0213] To test the ability of the selected antibodies to inhibit binding between IL6 and IL6 receptor (IL6R), an ELISA based assay is used. Various concentrations of antibody are mixed with a fixed concentration (10 ng/ml) of biotinylated IL6 as described by Naoko et al. 2007, Can. Res. 67:817-875. The IL6-antibody immune complex is added to immobilized IL6R. The binding of biotinylated IL6 to IL6R is detected with horseradish peroxidase-conjugated streptavidin. The reduction of ELISA signal is a measurement of inhibition. As positive control for inhibition of binding between IL6 and IL6R either anti-IL6R antibody (Abeam cat. no. ab34351; clone B-R6) or anti IL6 antibody (Abeam cat. no. ab9324) is used.
[0214] In vitro blocking activity of the selected anti-IL6 antibodies is measured in a proliferation assay using the IL6-dependent cell line 7TD1. Briefly, cells are incubated with different concentrations of human IL6 with or without the anti-IL6 antibody. The available amount of IL6 determines the degree of proliferation. Thus if an added antibody blocks IL6 binding the proliferation readout is reduced compared to a non binding antibody control. Proliferation is measured by the incorporation of 5-bromo-T-deoxy-uridine (BrdU) into the DNA using the BrdU proliferation kit (Roche cat. no. 11444611001) according to the manufacturer's instructions.

Generation of Anti-IL6 Oligoclonics

[0215] The most potent anti-IL6 antibodies are selected from each epitope group. The expression constructs expressing these antibodies are transfected into HEK293T cells in non-competing groups of three in different ratios (1:1:1; 3:1:1; 1:3:1; 1:1:3; 3:3:1; 1:3:3; 3:1:3; 10:1:1; 1:10:1; 1:1:10; 10:10:1; 1:10:10; 10:1:10; 3:10:1; 10:3:1; 1:10:3; 3:1:10; 10:1:3; 1:3:10). Antibody containing supernatants are harvested and purified and characterized as above.

Complex Formation and In Vivo Clearance of Anti-IL6 Oligoclonics

[0216] To measure the ability of anti-IL6 Oligoclonics to form immune complexes and to analyze these complexes Size Exclusion Chromatography (SEC) is used according to the approach disclosed by Min-Soo Kim et al. (2007), JMB 374:1374-1388, to characterize the immune-complexes formed with different antibodies to TNFα. Different molar ratios of the anti-IL6 Oligoclonics are mixed with human IL6 and incubated for 20 hours at 4° C. or 25° C. The mixture is analyzed on an HPLC system fitted with a size exclusion column; different elution times are correlated to molecular weight using a molecular weight standards.
[0217] The ability of antibodies to form complexes with IL6 is correlated with their ability to rapidly clear the cytokine from the circulation in vivo. This is confirmed by measuring the clearance of radiolabelled IL6 from mice. Briefly, female, six- to eight-week-old Balb/c mice are obtained and 18 hours before the experiment, the animals are injected intravenously (IV) via the lateral tail vein with different doses of purified anti-IL6 Oligoclonics. On day 0, the mice are injected IV with 50 microliters of radiolabeled IL-6 (1×10E7 cpm/mL) under the same conditions. Blood samples (approximately 50 microliters) are collected at several time intervals and stored at 4° C. The samples are centrifuged for five minutes at 4000×g and the radioactivity of the serum determined. All pharmacokinetic experiments are performed simultaneously with three animals for each treatment.

Generation of Anti-IL6 Oligoclonics Stable Clones and Preclinical Development

[0218] A lead anti-IL6 Oligoclonic is selected based on the in vitro and in vivo potency as determined above. The murine VH genes are humanized according to standard methods and combined with the fully human IGKV1-39 light chain in an expression vector as described above. Examples of humanization methods include those based on paradigms such as resurfacing (E. A. Padlan et al. (1991), Mol. Immunol. 28:489), superhumanization (P. Tan, D. A., et al. (2002), J. Immunol. 169:1119) and human string content optimization (G. A. Lazar et al. (2007), Mol. Inzmunol. 44:1986). The three constructs are transfected into PER.C6 cells at the predetermined optimal ratio (described above) under the selective pressure of G418 according to standard methods. A stable high producing anti-IL6 Oligoclonic clone is selected and a working and qualified master cell bank generated.
[0219] 
[00002] [TABLE-US-00002]
  TABLE 1
 
  List of primers
  DO-   Primer   Sequence
 
  0012   CH1_Rev1   TGCCAGGGGGAAGACCGATG
      (SEQ ID NO: 4)
 
  0656   MVH-1GCCGGCCATGGCCGAGGTRMAGCTTCAGGAGTCAGGAC
      (SEQ ID NO: 5)
 
  0657   MVH-2GCCGGCCATGGCCGAGGTSCAGCTKCAGCAGTCAGGAC
      (SEQ ID NO: 6)
 
  0658   MVH-3GCCGGCCATGGCCCAGGTGCAGCTGAAGSASTCAGG
      (SEQ ID NO: 7)
 
  0659   MVH-4GCCGGCCATGGCCGAGGTGCAGCTTCAGGAGTCSGGAC
      (SEQ ID NO: 8)
 
  0660   MVH-5GCCGGCCATGGCCGARGTCCAGCTGCAACAGTCYGGAC
      (SEQ ID NO: 9)
 
  0661   MVH-6GCCGGCCATGGCCCAGGTCCAGCTKCAGCAATCTGG
      (SEQ ID NO: 10)
 
  0662   MVH-7GCCGGCCATGGCCCAGSTBCAGCTGCAGCAGTCTGG
      (SEQ ID NO: 11)
 
  0663   MVH-8GCCGGCCATGGCCCAGGTYCAGCTGCAGCAGTCTGGRC
      (SEQ ID NO: 12)
 
  0664   MVH-9GCCGGCCATGGCCCAGGTYCAGCTYCAGCAGTCTGG
      (SEQ ID NO: 13)
 
  0665   MVH-10GCCGGCCATGGCCGAGGTCCARCTGCAACAATCTGGACC
      (SEQ ID NO: 14)
 
  0666   MVH-11GCCGGCCATGGCCCAGGTCCACGTGAAGCAGTCTGGG
      (SEQ ID NO: 15)
 
  0667   MVH-12GCCGGCCATGGCCGAGGTGAASSTGGTGGAATCTG
      (SEQ ID NO: 16)
 
  0668   MVH-13GCCGGCCATGGCCGAVGTGAAGYTGGTGGAGTCTG
      (SEQ ID NO: 17)
 
  0669   MVH-14GCCGGCCATGGCCGAGGTGCAGSKGGTGGAGTCTGGGG
      (SEQ ID NO: 18)
 
  0670   MVH-15GCCGGCCATGGCCGAKGTGCAMCTGGTGGAGTCTGGG
      (SEQ ID NO: 19)
 
  0671   MVH-16GCCGGCCATGGCCGAGGTGAAGCTGATGGARTCTGG
      (SEQ ID NO: 20)
 
  0672   MVH-17GCCGGCCATGGCCGAGGTGCARCTTGTTGAGTCTGGTG
      (SEQ ID NO: 21)
 
  0673   MVH-18GCCGGCCATGGCCGARGTRAAGCTTCTCGAGTCTGGA
      (SEQ ID NO: 22)
 
  0674   MVH-19GCCGGCCATGGCCGAAGTGAARSTTGAGGAGTCTGG
      (SEQ ID NO: 23)
 
  0675   MVH-20GCCGGCCATGGCCGAAGTGATGCTGGTGGAGTCTGGG
      (SEQ ID NO: 24)
 
  0676   MVH-21GCCGGCCATGGCCCAGGTTACTCTRAAAGWGTSTGGCC
      (SEQ ID NO: 25)
 
  0677   MVH-22GCCGGCCATGGCCCAGGTCCAACTVCAGCARCCTGG
      (SEQ ID NO: 26)
 
  0678   MVH-23GCCGGCCATGGCCCAGGTYCARCTGCAGCAGTCTG
      (SEQ ID NO: 27)
 
  0679   MVH-24GCCGGCCATGGCCGATGTGAACTTGGAAGTGTCTGG
      (SEQ ID NO: 28)
 
  0680   MVH-25GCCGGCCATGGCCGAGGTGAAGGTCATCGAGTCTGG
      (SEQ ID NO: 29)
 
  0681   ExtMVH-1CAGTCACAGATCCTCGCGAATTGGCCCA [see pdf for image] ATGGCCSANG
      (SEQ ID NO: 30)
 
  0682   ExtMVH-2CAGTCACAGATCCTCGCGAATTGGCCCA [see pdf for image] ATGGCCSANC
      (SEQ ID NO: 31)
 
  0683   MJH-Rev1GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GTGG
      (SEQ ID NO: 32)
 
  0684   MJH-Rev2GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GTGG
      (SEQ ID NO: 33)
 
  0685   MJH-Rev3GGGGGTGTCGTTTTGGCTGCAGAGAC [see pdf for image] AGAG
      (SEQ ID NO: 34)
 
  0686   MJH-Rev4GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GAGG
      (SEQ ID NO: 35)
 
  0687   ExtMJH-Rev1 &GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GTGG
      (SEQ ID NO: 36)
 
  0688   ExtMJH-Rev2inGGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GTGG
      (SEQ ID NO: 37)
 
  0690   ExtMJH-Rev3GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] AGAG
      (SEQ ID NO: 38)
 
  0691   ExtMJH-Rev4GGGGGTGTCGTTTTGGCTGAGGAGAC [see pdf for image] GAGG
      (SEQ ID NO: 39)
 
[0220] 
[00003] [TABLE-US-00003]
  TABLE 2
 
  Phage ELISA signal levels as measured at 450 nm. TT-coated plates represent
  plates that were coated with tetanus toxoid. Thyroglobulin-coated plates
  are used as negative controls. 10/10 and 15/15 indicate the number of wash
  steps with PBS-Tween during panning procedures. The 10/10 tetanus toxoid
  and 10/10 thyroglobulin plates and the 15/15 tetanus toxoid and 15/15 thyroglobulin
  plates are duplicates from each other except for the coating agent. OD values
  higher than three times the background are assumed specific.
    1   2   3   4   5   6   7   8   9   10   11   12
 
  TT-coated plate 10/10 washings
  A   0.139   0.093   0.089   0.121   0.117   0.598   0.146   0.115   0.18   0.155   0.543   0.601
  B   0.136   0.404   0.159   0.187   0.489   0.134   0.216   0.092   0.222   0.108   0.181   0.484
  C   0.197   0.526   0.09   0.213   0.395   0.155   0.108   0.12   0.183   0.136   0.092   0.866
  D   0.143   0.258   0.101   0.422   0.088   0.243   0.485   0.251   0.304   0.198   0.478   0.091
  E   0.445   0.169   0.526   0.481   0.206   0.285   0.111   0.119   0.128   0.2   0.118   0.098
  F   0.237   0.291   0.594   0.139   0.206   0.565   0.543   0.091   0.136   0.227   0.228   0.099
  G   0.459   0.102   0.152   0.659   0.203   0.452   0.152   0.133   0.094   0.102   0.375   0.098
  H   0.341   0.623   0.745   0.415   0.682   0.527   0.655   0.114   0.258   0.284   0.685   0.113
  TT-coated plate 15/15 washings
  A   0.247   0.582   0.421   0.428   0.133   0.082   0.262   0.079   0.343   0.414   0.095   0.292
  B   0.065   0.364   0.073   0.042   0.049   0.071   0.046   0.103   0.078   0.057   0.048   0.155
  C   0.081   0.044   0.066   0.082   0.225   0.444   0.203   0.362   0.122   0.047   0.052   0.309
  D   0.092   0.11   0.59   0.22   0.33   0.544   0.058   0.159   0.047   0.174   0.086   0.05
  E   0.469   0.577   0.206   0.304   0.13   0.749   0.431   0.062   0.167   0.049   0.056   0.049
  F   0.846   0.07   0.561   0.656   0.882   0.094   0.383   0.13   0.152   0.098   0.134   0.048
  G   0.537   0.052   0.49   0.105   0.337   0.193   0.514   0.294   0.068   0.35   0.525   0.05
  H   0.061   0.306   0.157   0.853   0.054   0.534   0.102   0.235   0.441   0.412   0.565   0.061
  Thyroglobulin-coated plate 10/10 washings
  A   0.047   0.051   0.045   0.043   0.051   0.044   0.046   0.042   0.047   0.048   0.049   0.05
  B   0.042   0.042   0.042   0.042   0.043   0.041   0.041   0.042   0.043   0.045   0.042   0.046
  C   0.044   0.043   0.043   0.044   0.043   0.044   0.043   0.042   0.043   0.041   0.044   0.046
  D   0.045   0.044   0.044   0.044   0.045   0.046   0.045   0.056   0.045   0.049   0.048   0.73
  E   0.046   0.045   0.046   0.044   0.045   0.044   0.044   0.044   0.047   0.046   0.047   0.926
  F   0.048   0.045   0.044   0.046   0.044   0.043   0.044   0.046   0.046   0.046   0.046   0.792
  G   0.051   0.048   0.045   0.045   0.044   0.043   0.048   0.045   0.048   0.051   0.045   0.053
  H   0.064   0.05   0.049   0.047   0.05   0.051   0.047   0.046   0.047   0.047   0.047   0.056
  Thyroglobulin-coated plate 15/15 washings
  A   0.036   0.049   0.045   0.044   0.046   0.047   0.046   0.042   0.042   0.043   0.042   0.041
  B   0.045   0.042   0.041   0.043   0.043   0.043   0.045   0.045   0.047   0.048   0.044   0.045
  C   0.049   0.047   0.047   0.046   0.046   0.046   0.045   0.047   0.046   0.045   0.045   0.052
  D   0.047   0.049   0.048   0.048   0.048   0.048   0.047   0.052   0.048   0.046   0.048   0.456
  E   0.049   0.047   0.047   0.047   0.047   0.049   0.047   0.048   0.047   0.046   0.048   0.412
  F   0.05   0.047   0.046   0.046   0.046   0.046   0.046   0.046   0.046   0.047   0.048   0.528
  G   0.05   0.048   0.045   0.045   0.046   0.049   0.048   0.046   0.053   0.049   0.05   0.057
  H   0.057   0.05   0.046   0.045   0.047   0.049   0.047   0.047   0.046   0.047   0.053   0.048
 
[0221] 
[00004] [TABLE-US-00004]
  TABLE 3
 
  Protein sequence analysis of ELISA positive tetanus toxoid binders. 
  CDR3 sequence, CDR3 length, VH family members and specific name,  
  JH origin and DH origin of the clones is indicated.
  CDR3/   CDR3         V Gene
  SEQ ID NO:   length   VH   DH   JH   family
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAYYTYDEKAWFAY   15   musIGHV192   DSP2.11   JH3 mouse   VH7183
  (SEQ ID NO: 40)          
 
  HGAFYTYDEKPWFAY   15   musIGHV192   IGHD2-14*01   JH3 mouse   VH7183
  (SEQ ID NO: 41)          
 
  HISYYRYDEEVSFAY   15   musIGHV192   IGHD2-14*01   JH3 mouse   VH7183
  (SEQ ID NO: 42)          
 
  HISYYRYDEEVSFAY   15   musIGHV192   IGHD2-14*01   JH3 mouse   VH7183
  (SEQ ID NO: 42)          
 
  GWRAFAY    7   musIGHV131   DSP2.9   JH3 mouse   VH7183
  (SEQ ID NO: 43)          
 
  GWRAFAY    7   musIGHV131   DSP2.9   JH3 mouse   VH7183
  (SEQ ID NO: 43)          
 
  GWRAFAY    7   musIGHV131   DSP2.9   JH3 mouse   VH7183
  (SEQ ID NO: 43)          
 
  DRGNYYGMDY   10   musIGHV178   DSP2.1   JH4 mouse   VH7183
  (SEQ ID NO: 44)          
 
  LGDYYVDWFFAV   12   musIGHV165   DFL16.1   JH1 mouse   VH7183
  (SEQ ID NO: 45)          
 
  NFPAWFAF    8   musIGHV547   DST4.3inv   JH3 mouse   VJH558
  (SEQ ID NO: 46)          
 
  NFPAWFAY    8   musIGHV547   DSP2.1   JH3 mouse   VJH558
  (SEQ ID NO: 46)          
 
  NFPAWFVY    8   musIGHV547   DSP2.1   JH3 mouse   VJH558
  (SEQ ID NO: 46)          
 
  SFTPVPFYYGYDWYFDV   17   musIGHV532   DSP2.3   JH1 mouse   VJH558
  (SEQ ID NO: 47)          
 
  SFTPVPFYYGYDWYFDV   17   musIGHV532   DSP2.3   JH1 mouse   VJH558
  (SEQ ID NO: 47)          
 
  SDYDWYFDV    9   musIGHV286   DSP2.2   JH1 mouse   VJH558
  (SEQ ID NO: 48)          
 
  SDYDWYFDV    9   musIGHV286   DSP2.2   JH1 mouse   VJH558
  (SEQ ID NO: 48)          
 
  DSKWAYYFDY   10   musIGHV532   DST4.3   JH2 mouse   VJH558
  (SEQ ID NO: 49)          
 
  GDYTGYGMDY   10   musIGHV125   DSP2.13   JH4 mouse   VHSM7
  (SEQ ID NO: 50)          
 
  GDYTGYGMDY   10   musIGHV125   DSP2.13   JH4 mouse   VHSM7
  (SEQ ID NO: 50)          
 
  GGYDGYWFPY   10   musIGHV125   DSP2.9   JH3 mouse   VHSM7
  (SEQ ID NO: 51)
 
[0222] 
[00005] [TABLE-US-00005]
  TABLE 4
 
  Vector combinations that were transfected to HEK293T.
        Combined     Conc.
  Code   HC vector   LC vector   vector   Prep name   (μg/ml)
 
  A   x   0817676_pSELECT_0815426   x   PIGKV1-39/   —
      (IGKV1-39)     P1  
  B   x   0817678_pSELECT_0815427   x   PIGLV2-14/   —
      (IGLV2-14)     P1  
  C   MV1110   0817676_pSELECT_0815426   x   PMV1110/   11.0
      (IGKV1-39)     IGKV1-39/P1  
  D   MV1110   0817678_pSELECT_0815427   x   PMV1110/   15.4
      (IGLV2-14)     IGLV2-14/P1  
  E   x   x   MG1494   MG1494/P2   16.1
 
[0223] 
[00006] [TABLE-US-00006]
  TABLE 5
 
HLA allotypes considered in TH-epitope profiling. The corresponding
  serotypes are shown, as well as allotype frequencies in the Caucasian
population (Klitz et al. (2003), Tissue Antigens 62: 296-307; Gjertson and
Terasake (eds) in: HLA 1997; Gjertson and Terasake (eds) in: HLA 1998;
Castelli et al. (2002), J. Immunol. 169: 6928-6934). Frequencies can add
  up to more than 100% since each individual has two alleles for each gene.
  If all allele frequencies of a single gene were known, they would add up to
  slightly less than 200% due to homozygous individuals.
    HLA type   Serotype   Population %
 
    DRB1*0101   DR1   17.4
    DRB1*0102   DR1   4.9
    DRB1*0301   DR17(3)   21.2
    DRB1*0401   DR4   11.5
    DRB1*0402   DR4   3.1
    DRB1*0404   DR4   5.5
    DRB1*0405   DR4   2.2
    DRB1*0407   DR4   <2
    DRB1*0701   DR7   23.4
    DRB1*0801   DR8   3.3
    DRB1*0802   DR8   <2
    DRB1*0901   DR9   <2
    DRB1*1101   DR11(5)   17
    DRB1*1104   DR11(5)   5.7
    DRB1*1201   DR12(5)   3.1
    DRB1*1301   DR13(6)   15.4
    DRB1*1302   DR13(6)   10.8
    DRB1*1401   DR14(6)   4.2
    DRB1*1501   DR15(2)   13.2
    DRB1*1601   DR16(2)   5.5
    DRB3*0101   DR52   24.6
    DRB3*0202   DR52   43
    DRB3*0301   DR52   10
    DRB4*0101   DR53   25.5
    DRB4*0103   DR53   21
    DRB5*0101   DR51   15.8
    DRB5*0202   DR51   5.7
    DQA1*0101/DQB1*0501   DQ5(1)   20.5
    DQA1*0102/DQB1*0502   DQ5(1)   2.6
    DQA1*0102/DQB1*0602   DQ6(1)   26.5
    DQA1*0102/DQB1*0604   DQ6(1)   6.7
    DQA1*0103/DQB1*0603   DQ6(1)   11
    DQA1*0104/DQB1*0503   DQ5(1)   4
    DQA1*0201/DQB1*0202   DQ2   20.9
    DQA1*0201/DQB1*0303   DQ9(3)   7.2
    DQA1*0301/DQB1*0301   DQ7(3)   12.5
    DQA1*0301/DQB1*0302   DQ8(3)   18.3
    DQA1*0401/DQB1*0402   DQ4   4.5
    DQA1*0501/DQB1*0201   DQ2   24.6
    DQA1*0501/DQB1*0301   DQ7(3)   20.9
    DPA1*0103/DPB1*0201   DPw2   19.9
    DPA1*0103/DPB1*0401   DPw4   65.1
    DPA1*0103/DPB1*0402   DPw4   24.3
    DPA1*0201/DPB1*0101   DPw1   6.3
    DPA1*0201/DPB1*0301   DPw3   <2
    DPA1*0201/DPB1*0501   DPw5   <2
    DPA1*0201/DPB1*0901   —   2.4
 
[0224] 
[00007] [TABLE-US-00007]
  TABLE 6
 
TH epitope counts for IGKV1-39. Peptides binding to multiple HLAs
  of the same group (DRB1, DRB3/4/5, DP, DQ) are counted as one.
  Values between brackets refer to germline-filtered peptides.
    DRB1   DRB3/4/5   DQ   DP
    Strong   Medium   Strong   Medium   Strong   Medium   Strong   Medium
 
  Merus IGKV1-39   0 (+6)   0 (+16)   0 (+0)   0 (+5)   0 (+3)   0 (+9)   0 (+0)   0 (+9)
 
[0225] 
[00008] [TABLE-US-00008]
  TABLE 7
 
  Mapping of Epibase ® predictions for Merus IGKV1-39 in the classical 15-mer
  peptide format. This table shows the allotype count of critical epitopes
  (SEQ ID NOs: 52-83) and implicated serotypes for each of the 15-mers
  spanning the Merus IGKV1-39 sequence.
    Start   15-mer   Allotype  
  15mer   position   sequence   count   Implicated serotypes
 
   1    1   DIQMTQSPSSLSASV    6   DR1, DR4, DR7, DR9
 
   2    4   MTQSPSSLSASVGDR    5   DR1, DR4, DR9
 
   3    7   SPSSLSASVGDRVTI    0  
 
   4   10   SLSASVGDRVTITCR    0  
 
   5   13   ASVGDRVTITCRASQ    0  
 
   6   16   GDRVTITCRASQSIS    2   DR11(5), DR7
 
   7   19   VTITCRASQSISSYL    4   DQ2, DR11(5), DR4, DR7
 
   8   22   TCRASQSISSYLNWY    2   DQ2, DR4
 
   9   25   ASQSISSYLNWYQQK    5   DR13(6), DR15(2), DR4
 
  10   28   SISSYLNWYQQKPGK    8   DR12(5), DR13(6), DR15(2), DR16(2), DR4, DR8
 
  11   31   SYLNWYQQKPGKAPK   10   DR1, DR12(5), DR16(2), DR4, DR51, DR8
 
  12   34   NWYQQKPGKAPKLLI    9   DR1, DR15(2), DR4, DR51, DR8
 
  13   37   QQKPGKAPKLLIYAA    7   DQ4, DR1, DR11(5), DR15(2), DR51, DR8
 
  14   40   PGKAPKLLIYAASSL    7   DQ4, DR1, DR11(5), DR4, DR8
 
  15   43   APKLLIYAASSLQSG   15   DR1, DR11(5), DR12(5), DR13(6), DR14(6), 
          DR15(2), DR4, DR51, DR8, DR9
 
  16   46   LLIYAASSLQSGVPS   15   DR1, DR11(5), DR12(5), DR13(6), DR14(6), 
          DR15(2), DR4,DR51, DR8, DR9
 
  17   49   YAASSLQSGVPSRFS    1   DR15(2)
 
  18   52   SSLQSGVPSRFSGSG    1   DR15(2)
 
  19   55   QSGVPSRFSGSGSGT    0  
 
  20   58   VPSRFSGSGSGTDFT    0  
 
  21   61   RFSGSGSGTDFTLTI    0  
 
  22   64   GSGSGTDFTLTISSL    1   DR52
 
  23   67   SGTDFTLTISSLQPE    4   DR4, DR52, DR7, DR9
 
  24   70   DFTLTISSLQPEDFA    4   DQ2, DR4, DR7, DR9
 
  25   73   LTISSLQPEDFATYY    1   DQ2
 
  26   76   SSLQPEDFATYYCQQ    0  
 
  27   79   QPEDFATYYCQQSYS    1   DR4
 
  28   82   DFATYYCQQSYSTPP    5   DR4, DR51, DR7
 
  29   85   TYYCQQSYSTPPTFG    4   DR4, DR51, DR7
 
  30   88   CQQSYSTPPTFGQGT    0  
 
  31   91   SYSTPPTFGQGTKVE    0  
 
  32   94   TPPTFGQGTKVEIK    0
 
[0226] 
[00009] [TABLE-US-00009]
  TABLE 8
 
The VH gene from PG1433 paired with various light chain genes with
  differing rates of amino acid mutation were compared for production
  levels with the original clone containing the IGKV1-39 gene.
    Light   Number of amino acid   concentration
  IgG name   chain gene   mutations   (μg/ml)
 
  PG1433   1-39   0   63, 45.5, 38.6 (avg = 49)
  PG1631   1-12   4   10.5
  PG1632   1-27   7   9.3
  PG1634   1D-12   10   10.8
  PG1635   1D-33   6   10.2
  PG1642   1-5   8   7.1
  PG1644   1-9   3   7.8
  PG1650   1D-39   3   9.1
  PG1652   2D-28   3   7.1
  PG1653   3-15   14   7
  PG1654   3-20   2   5.2
  PG1674   1-40   7   8.2
  PG1678   2-11   2   8.1
  PG1680   2-14   15   10.8
  PG1682   3-1   13   9.9
  PG1683   6-57   6   13.9
 
[0227] 
[00010] [TABLE-US-00010]
  TABLE 9
 
  Numbers of lymphocytes harvested from the bone marrow and spleen
  of wild-type and transgenic mice
    *10e6/ml   total vol   total cells
    cells   (ml)*106
 
  Bone Marrow
    Wt   18.82   5.05   95.0
    Wt   19.24   4.96   95.4
    CD19-Cre   23.42   5.08   119.0
    CD19-Cre   20.58   4.82   99.2
    CD19-Cre   25.77   5.15   132.7
    CD19-Cre/HuVk1   17.71   5.06   89.6
    CD19-Cre/HuVk1   12.60   5.33   67.2
    CD19-Cre/HuVk1   18.13   5.27   95.5
  Spleen
    Wt   41.70   5.36   223.5
    Wt   37.85   4.71   178.3
    CD19-Cre   60.19   3.77   226.9
    CD19-Cre   35.06   3.66   128.3
    CD19-Cre   80.69   4.60   371.2
    CD19-Cre/HuVk1   51.67   4.48   231.5
    CD19-Cre/HuVk1   58.80   6.24   366.9
    CD19-Cre/HuVk1   24.37   6.25   152.3
 
(57)

Claims

1. A transgenic mouse that has been immunized with an antigen wherein the genome of said mouse comprises a transgene comprising a single human immunoglobulin light chain germline V gene segment fused to a single human immunoglobulin light chain germline J gene segment such that there is no mutation due to said fusion,
wherein said fused human V/J gene segments encode a rearranged human immunoglobulin light chain variable region, wherein the transgene is inserted by site-specific integration in the murine Rosa locus or wherein said transgene lacks the intronic light chain enhancer MoEκi or comprises a truncation of the transgene 3′ kappa enhancer or combination of these; and
wherein the transgene comprises a murine light chain constant region gene segment or is operatively linked to an endogenous mouse light chain constant region gene segment;
wherein if the transgene is inserted by site-specific integration in the murine Rosa locus the transgene comprises a murine light chain constant region gene segment; and
wherein said transgenic mouse, in response to said antigen, has produced B cells that secrete antibodies with immunoglobulin light chains comprising said rearranged human light chain variable region and a murine light chain constant region, paired with a diversity of immunoglobulin heavy chains, which bind said antigen.
2. A method to prepare antibodies immunoreactive with a desired antigen which method comprises isolating B cells from the transgenic mouse of claim 1 and culturing said cells, optionally immortalizing said cells and harvesting the antibodies.
3. A method to prepare antibodies immunoreactive with a desired antigen which method comprises isolating nucleic acids from the B cells of the transgenic mouse of claim 1 that encode at least part of such antibodies, inserting the nucleic acids or copies or derivatives thereof into an expression cassette and expressing the antibodies in host cells.
4. A method to prepare antibodies immunoreactive with a desired antigen which method comprises recovering said antibodies from the mouse of claim 1.
*****

Download Citation


Sign in to the Lens

Feedback