{"search_session":{},"preferences":{"l":"en","queryLanguage":"en"},"patentId":"013-469-144-908-836","frontPageModel":{"patentViewModel":{"ref":{"entityRefId":"013-469-144-908-836","entityRefType":"PATENT"},"entityMetadata":{"linkedIds":{"empty":true},"tags":[],"collections":[{"id":22770,"type":"PATENT","title":"Citing Karolinska Institute publications","description":"Patent documents citing scholarly work of Karolinska Institute","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":40101,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:57:09Z","updated":"2017-08-07T04:57:09Z","lastEventDate":"2017-08-07T04:57:09Z"},{"id":22778,"type":"PATENT","title":"Citing Leiden Univ publications","description":"Patent documents citing scholarly work of Leiden Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":25965,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:01:20Z","updated":"2017-08-07T05:01:20Z","lastEventDate":"2017-08-07T05:01:20Z"},{"id":22790,"type":"PATENT","title":"Citing MIT publications","description":"Patent documents citing scholarly work of MIT","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":143355,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:05:29Z","updated":"2019-11-29T02:59:34Z","lastEventDate":"2019-11-29T02:59:34Z"},{"id":22799,"type":"PATENT","title":"Citing Univ Alabama System publications","description":"Patent documents citing scholarly work of Univ Alabama System","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":32860,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:26Z","updated":"2017-08-07T05:09:26Z","lastEventDate":"2017-08-07T05:09:26Z"},{"id":22859,"type":"PATENT","title":"Citing Harvard Univ publications","description":"Patent documents citing scholarly work of Harvard Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":175224,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:37:44Z","updated":"2017-08-07T05:37:44Z","lastEventDate":"2017-08-07T05:37:44Z"},{"id":22864,"type":"PATENT","title":"Citing Ohio State Univ publications","description":"Patent documents citing scholarly work of Ohio State Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31507,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:42:04Z","updated":"2017-08-07T05:42:04Z","lastEventDate":"2017-08-07T05:42:04Z"},{"id":22876,"type":"PATENT","title":"Citing Univ Virginia publications","description":"Patent documents citing scholarly work of Univ Virginia","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":27785,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:46:41Z","updated":"2017-08-07T05:46:41Z","lastEventDate":"2017-08-07T05:46:41Z"},{"id":22914,"type":"PATENT","title":"Citing Yale Univ publications","description":"Patent documents citing scholarly work of Yale Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":53591,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T06:01:58Z","updated":"2017-08-07T06:01:58Z","lastEventDate":"2017-08-07T06:01:58Z"}],"notes":[],"inventorships":[],"privateCollections":[],"publicCollections":[{"id":22770,"type":"PATENT","title":"Citing Karolinska Institute publications","description":"Patent documents citing scholarly work of Karolinska Institute","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":40101,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T04:57:09Z","updated":"2017-08-07T04:57:09Z","lastEventDate":"2017-08-07T04:57:09Z"},{"id":22778,"type":"PATENT","title":"Citing Leiden Univ publications","description":"Patent documents citing scholarly work of Leiden Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":25965,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:01:20Z","updated":"2017-08-07T05:01:20Z","lastEventDate":"2017-08-07T05:01:20Z"},{"id":22790,"type":"PATENT","title":"Citing MIT publications","description":"Patent documents citing scholarly work of MIT","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":143355,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:05:29Z","updated":"2019-11-29T02:59:34Z","lastEventDate":"2019-11-29T02:59:34Z"},{"id":22799,"type":"PATENT","title":"Citing Univ Alabama System publications","description":"Patent documents citing scholarly work of Univ Alabama System","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":32860,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:09:26Z","updated":"2017-08-07T05:09:26Z","lastEventDate":"2017-08-07T05:09:26Z"},{"id":22859,"type":"PATENT","title":"Citing Harvard Univ publications","description":"Patent documents citing scholarly work of Harvard Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":175224,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:37:44Z","updated":"2017-08-07T05:37:44Z","lastEventDate":"2017-08-07T05:37:44Z"},{"id":22864,"type":"PATENT","title":"Citing Ohio State Univ publications","description":"Patent documents citing scholarly work of Ohio State Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":31507,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:42:04Z","updated":"2017-08-07T05:42:04Z","lastEventDate":"2017-08-07T05:42:04Z"},{"id":22876,"type":"PATENT","title":"Citing Univ Virginia publications","description":"Patent documents citing scholarly work of Univ Virginia","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":27785,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T05:46:41Z","updated":"2017-08-07T05:46:41Z","lastEventDate":"2017-08-07T05:46:41Z"},{"id":22914,"type":"PATENT","title":"Citing Yale Univ publications","description":"Patent documents citing scholarly work of Yale Univ","access":"OPEN_ACCESS","displayAvatar":true,"attested":false,"itemCount":53591,"tags":[],"user":{"id":233682368,"username":"tech","firstName":"The Lens","lastName":"Team","created":"2017-08-06T20:11:49.000Z","displayName":"The Lens Team","profilePictureKey":"lens/users/15eac2a0-031d-4923-92cb-a162e1cb2bbb/profile-picture","preferences":"{\"beta\":true}","accountType":"PERSONAL","isOauthOnly":false},"notes":[],"sharedType":"PUBLISHED","hasLinkedSavedQueries":false,"savedQueries":[],"created":"2017-08-07T06:01:58Z","updated":"2017-08-07T06:01:58Z","lastEventDate":"2017-08-07T06:01:58Z"}],"privateNotes":[],"landscapeCollections":[],"landscapeNotes":[]},"document":{"record_lens_id":"013-469-144-908-836","lens_id":["013-469-144-908-836","147-075-485-968-447"],"doc_key":"US_20110281755_A1_20111117","created":"2016-01-15T11:35:02.326","docdb_id":338981570,"lens_internal":{"earliest_lens_id_created_time":"2016-01-15T11:35:02.326","last_modified":"2024-03-25T07:49:33.397","legacy_pub_key":"US_2011_0281755_A1","has_doc_lang":true,"has_biblio_lang":true,"has_all_title_lang":true,"has_all_abstract_lang":true,"has_all_claims_lang":true,"has_description_lang":true},"jurisdiction":"US","doc_number":"20110281755","kind":"A1","date_published":"2011-11-17","year_published":2011,"ids":["US_2011_0281755_A1","013-469-144-908-836","147-075-485-968-447","US_20110281755_A1_20111117","US","20110281755","A1","US20110281755A1","US20110281755","20110281755A1"],"lang":"en","publication_type":"PATENT_APPLICATION","application_reference":{"jurisdiction":"US","doc_number":"201113107786","kind":"A","date":"2011-05-13"},"priority_claim":[{"jurisdiction":"US","doc_number":"201113107786","kind":"A","date":"2011-05-13"},{"jurisdiction":"US","doc_number":"33465810","kind":"P","date":"2010-05-14"}],"priority_claim.source":"DOCDB","earliest_priority_claim_date":"2010-05-14","title":{"en":[{"text":"Karyotyping Assay","lang":"en","source":"DOCDB","data_format":"DOCDBA"}]},"title_lang":["en"],"has_title":true,"applicant":[{"name":"BROOMER ADAM","residence":"US","sequence":1,"app_type":"applicant"},{"name":"LI KELLY","residence":"US","sequence":2,"app_type":"applicant"},{"name":"TOBLER ANDREAS R","residence":"US","sequence":3,"app_type":"applicant"},{"name":"CHEN CAIFU","residence":"US","sequence":4,"app_type":"applicant"},{"name":"KEYS JR DAVID N","residence":"US","sequence":5,"app_type":"applicant"},{"name":"LIFE TECHNOLOGIES CORP","residence":"US","sequence":6,"app_type":"applicant"}],"applicant_count":6,"has_applicant":true,"inventor":[{"name":"BROOMER ADAM","residence":"US","sequence":1},{"name":"LI KELLY","residence":"US","sequence":2},{"name":"TOBLER ANDREAS R","residence":"US","sequence":3},{"name":"CHEN CAIFU","residence":"US","sequence":4},{"name":"KEYS JR DAVID N","residence":"US","sequence":5}],"inventor_count":5,"has_inventor":true,"agent":[],"agent_count":0,"has_agent":false,"owner":[{"name":"LIFE TECHNOLOGIES CORPORATION","address":"5791 VAN ALLEN WAY, CARLSBAD, CALIFORNIA, 92008","sequence":4,"recorded_date":"2011-09-07","execution_date":"2011-06-21","is_current_owner":true}],"owner_count":1,"owner_all":[{"name":"LIFE TECHNOLOGIES CORPORATION","address":"5791 VAN ALLEN WAY, CARLSBAD, CALIFORNIA, 92008","sequence":4,"recorded_date":"2011-09-07","execution_date":"2011-06-21","is_current_owner":true}],"owner_all_count":1,"has_owner":true,"has_examiner":false,"class_ipcr":[{"symbol":"C12Q1/68","version_indicator":"2006-01-01","class_symbol_position":"L","class_value":"I","action_date":"2011-11-17","class_status":"B","class_data_source":"H","generating_office":"US","sequence":1},{"symbol":"C40B30/04","version_indicator":"2006-01-01","class_symbol_position":"F","class_value":"I","action_date":"2011-11-17","class_status":"B","class_data_source":"H","generating_office":"US","sequence":2},{"symbol":"C40B40/06","version_indicator":"2006-01-01","class_symbol_position":"L","class_value":"I","action_date":"2011-11-17","class_status":"B","class_data_source":"H","generating_office":"US","sequence":3}],"class_ipcr.first_symbol":"C40B30/04","class_ipcr.later_symbol":["C12Q1/68","C40B40/06"],"class_ipcr.inv_symbol":["C12Q1/68","C40B30/04","C40B40/06"],"class_ipcr.add_symbol":[],"class_ipcr.source":"DOCDB","class_cpc":[{"symbol":"C12Q1/6844","version_indicator":"2013-01-01","class_symbol_position":"F","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"EP","sequence":1},{"symbol":"C12Q1/6844","version_indicator":"2013-01-01","class_symbol_position":"F","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"US","sequence":3}],"class_cpc_cset":[{"class":[{"symbol":"C12Q1/6844","version_indicator":"2013-01-01","class_symbol_position":"L","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"EP"},{"symbol":"C12Q2537/16","version_indicator":"2013-01-01","class_symbol_position":"L","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"EP"}],"sequence":2},{"class":[{"symbol":"C12Q1/6844","version_indicator":"2013-01-01","class_symbol_position":"L","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"US"},{"symbol":"C12Q2537/16","version_indicator":"2013-01-01","class_symbol_position":"L","class_value":"I","action_date":"2013-01-01","class_status":"B","class_data_source":"H","generating_office":"US"}],"sequence":4}],"class_cpc.first_symbol":"C12Q1/6844","class_cpc.later_symbol":[],"class_cpc.inv_symbol":["C12Q1/6844","C12Q1/6844"],"class_cpc.add_symbol":[],"class_cpc.source":"DOCDB","class_national":[{"symbol":"506/9","symbol_position":"F"},{"symbol":"435/6.12","symbol_position":"L"},{"symbol":"506/16","symbol_position":"L"},{"symbol":"435/6.11","symbol_position":"L"}],"class_national.first_symbol":"506/9","class_national.later_symbol":["435/6.12","506/16","435/6.11"],"class_national.source":"DOCDB","reference_cited":[{"npl":{"num":1,"text":"Kim et al., Disruption of Neurexin 1 Associated with Autism Spectrum Disorder, The American Journal of Human Genetics 82, 199-207, January 2008","npl_type":"a","external_id":["10.1016/j.ajhg.2007.09.011","18179900","pmc2253961"],"record_lens_id":"003-322-795-346-735","lens_id":["075-833-362-526-024","074-016-592-133-684","003-322-795-346-735"],"sequence":1,"category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[]}},{"npl":{"num":2,"text":"Berggren et al., Detecting Homozygous Deletions in the CDKN2A(p16INK4a)/ARF(p14ARF) Gene in Urinary Bladder Cancer Using Real-Time Quantitative PCR, Clinical Cancer Research, Vol. 9, 235-242, January 2003","npl_type":"a","external_id":["12538475"],"record_lens_id":"143-008-319-201-181","lens_id":["144-840-763-133-64X","143-008-319-201-181"],"sequence":2,"category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[]}},{"npl":{"num":3,"text":"Schmittgen et al., Analyzing real-time PCR data by the comparative CT method, NATURE PROTOCOLS, VOL.3, NO.6, 2008, 1101-1108","npl_type":"a","external_id":["18546601","10.1038/nprot.2008.73"],"record_lens_id":"073-182-667-529-964","lens_id":["086-990-183-385-498","075-978-468-305-278","073-182-667-529-964"],"sequence":3,"category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[]}},{"patent":{"num":1,"document_id":{"jurisdiction":"US","doc_number":"2008286783","kind":"A1","date":"2008-11-20","name":"HOSONO NAOYA [JP], et al"},"lens_id":"104-885-537-825-443","category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[],"sequence":4}},{"patent":{"num":2,"document_id":{"jurisdiction":"US","doc_number":"2008118925","kind":"A1","date":"2008-05-22","name":"CUPPENS HARRY [BE], et al"},"lens_id":"173-655-214-801-710","category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[],"sequence":5}},{"patent":{"num":3,"document_id":{"jurisdiction":"US","doc_number":"6180349","kind":"B1","date":"2001-01-30","name":"GINZINGER DAVID G [US], et al"},"lens_id":"072-670-433-240-865","category":[],"us_category":[],"cited_phase":"PRS","rel_claims":[],"sequence":6}}],"reference_cited.source":"DOCDB","reference_cited.patent_count":3,"cites_patent":true,"reference_cited.npl_count":3,"reference_cited.npl_resolved_count":3,"cites_npl":true,"cites_resolved_npl":true,"cited_by":{"patent_count":1,"patent":[{"lens_id":"180-550-424-070-509","document_id":{"jurisdiction":"US","doc_number":"20160024581","kind":"A1"}}]},"cited_by_patent":true,"family":{"simple":{"size":10,"id":215475348,"member":[{"lens_id":"052-094-367-906-068","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"A2","date":"2013-03-20"}},{"lens_id":"069-696-375-728-244","document_id":{"jurisdiction":"US","doc_number":"9309565","kind":"B2","date":"2016-04-12"}},{"lens_id":"093-930-682-184-358","document_id":{"jurisdiction":"US","doc_number":"20220119873","kind":"A1","date":"2022-04-21"}},{"lens_id":"013-469-144-908-836","document_id":{"jurisdiction":"US","doc_number":"20110281755","kind":"A1","date":"2011-11-17"}},{"lens_id":"021-678-050-369-887","document_id":{"jurisdiction":"WO","doc_number":"2011143611","kind":"A3","date":"2012-04-05"}},{"lens_id":"054-759-878-204-38X","document_id":{"jurisdiction":"WO","doc_number":"2011143611","kind":"A2","date":"2011-11-17"}},{"lens_id":"023-010-329-635-217","document_id":{"jurisdiction":"US","doc_number":"20160251707","kind":"A1","date":"2016-09-01"}},{"lens_id":"097-835-769-087-403","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"B1","date":"2020-03-25"}},{"lens_id":"052-495-164-228-364","document_id":{"jurisdiction":"US","doc_number":"11193165","kind":"B2","date":"2021-12-07"}},{"lens_id":"158-547-172-458-667","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"A4","date":"2014-04-09"}}]},"extended":{"size":10,"id":214601690,"member":[{"lens_id":"052-094-367-906-068","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"A2","date":"2013-03-20"}},{"lens_id":"093-930-682-184-358","document_id":{"jurisdiction":"US","doc_number":"20220119873","kind":"A1","date":"2022-04-21"}},{"lens_id":"069-696-375-728-244","document_id":{"jurisdiction":"US","doc_number":"9309565","kind":"B2","date":"2016-04-12"}},{"lens_id":"013-469-144-908-836","document_id":{"jurisdiction":"US","doc_number":"20110281755","kind":"A1","date":"2011-11-17"}},{"lens_id":"021-678-050-369-887","document_id":{"jurisdiction":"WO","doc_number":"2011143611","kind":"A3","date":"2012-04-05"}},{"lens_id":"054-759-878-204-38X","document_id":{"jurisdiction":"WO","doc_number":"2011143611","kind":"A2","date":"2011-11-17"}},{"lens_id":"023-010-329-635-217","document_id":{"jurisdiction":"US","doc_number":"20160251707","kind":"A1","date":"2016-09-01"}},{"lens_id":"097-835-769-087-403","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"B1","date":"2020-03-25"}},{"lens_id":"052-495-164-228-364","document_id":{"jurisdiction":"US","doc_number":"11193165","kind":"B2","date":"2021-12-07"}},{"lens_id":"158-547-172-458-667","document_id":{"jurisdiction":"EP","doc_number":"2569452","kind":"A4","date":"2014-04-09"}}]}},"sequence":{"seq_list_key":"US_20110281755_A1","type":["N"],"length_bucket":["NT_1_100","NT_101_5000"],"length":[16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,36,71,72,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98,99,100,101,102,103,104,106,109,110],"organism":[{"name":"Unknown/Artificial","tax_id":-1}],"document_location":["DDESC","CLAIM"],"count":384,"data_source":["USPTO_FULLTEXT_RB"]},"has_sequence":true,"legal_status":{"ipr_type":"patent for invention","granted":true,"earliest_filing_date":"2011-05-13","grant_date":"2016-04-12","anticipated_term_date":"2031-05-13","has_disclaimer":false,"patent_status":"ACTIVE","publication_count":2,"has_spc":false,"has_grant_event":true,"has_entry_into_national_phase":false},"abstract":{"en":[{"text":"This disclosure relates to methods and kits for karyotyping in which chromosomes are interrogated by amplifying loci that are not within copy number variable regions thereof.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}]},"abstract_lang":["en"],"has_abstract":true,"claim":{"en":[{"text":"1 . A method for determining the copy number of at least one test locus on at least one chromosome in a test sample, the method comprising: (a) interrogating at least one test locus on at least one chromosome in the test sample; and (b) quantifying the copy number of at least one of the interrogated test loci, wherein the at least one test locus is located on a region of the chromosome that is not within a copy number variable region (CNVR) on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"2 . The method of claim 1 , further comprising, interrogating at least one reference locus of at least one chromosome in a calibrator sample; and quantifying the copy number of at least one of the interrogated reference loci, wherein the quantifying of the copy number of the interrogated test locus comprises quantifying the copy number of the test locus relative to the copy number of at least one of the reference loci of the calibrator sample.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"3 . The method of claim 1 , further comprising, determining the copy number of at least one chromosome in the test sample on which at least one of the interrogated test loci is located, wherein determining the copy number of the chromosome is based on the copy number of the interrogated test locus.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"4 . The method of claim 3 , wherein the determining of the copy number of at least one chromosome in the test sample comprises determining the copy number of more than one chromosome in the test sample.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"5 . The method of claim 1 , wherein the copy number of more than one test loci in the test sample is interrogated and quantified.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"6 . The method of claim 2 , wherein the calibrator sample is a virtual calibrator sample derived by assaying at least two or more test samples by a method comprising the steps of: (a) interrogating one or more test loci in each test sample using one or more copy number assays and calculating an average C T for each of said copy number assays; (b) interrogating one or more reference loci in each test sample using one or more copy number reference assays and calculating an average C T from each of said copy number reference assays; (c) averaging the copy number assay average C T values of (a); (d) averaging the copy number reference assay average C T values of (b); (e) calculating the relative quantity using values of (c) and (d); and (f) determining the copy number for each test locus by multiplying the relative quantity by the copy number of the calibrator sample.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"7 . The method of claim 1 wherein the test sample comprises genomic DNA.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"8 . The method of claim 1 wherein at least one of the interrogated test loci and at least one of the reference loci correspond to the same location on a chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"9 . The method of claim 1 wherein at least one of the interrogated test loci and at least one of the reference loci correspond to different locations on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"10 . The method of claim 1 , further comprising the steps of: (a) amplifying from a first genomic DNA sample at least one or more test loci from at least one chromosome and at least one or more reference loci from at least one chromosome; (b) amplifying from a second test genomic DNA sample at least one or more target loci from at least one chromosome and at least one or more reference loci from at least one chromosome; (c) calculating the average C T values for each of amplifications (a) and (b); (d) calculating the average of the average C T values for each of amplifications (a) and (b); and (e) calculating the relative copy number in the genomic DNA sample, wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"11 . The method of claim 1 , further comprising the steps of: (a) amplifying from a genomic DNA sample one or more target loci on a chromosome; (b) amplifying from the genomic DNA sample one or more target loci on a chromosome; (c) amplifying from the genomic DNA sample one or more reference loci on a chromosome; (d) calculating the average C T values for each of amplifications (a), (b), and (c); (e) calculating the average of the average C T values for each of amplifications (a), (b), and (c); (f) calculating the ΔC T value from the average calculated in (e) for amplifications (a) and (c); (g) calculating the relative copy number in the genomic DNA sample, wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"12 . The method of claim 1 , further comprising the steps of: (a) amplifying from a genomic DNA sample one or more test loci on a chromosome; (b) amplifying from the genomic DNA sample one or more test loci on a chromosome; (c) calculating the average C T values for each of amplifications (a) and (b); (d) calculating the average of the average C T values for each of amplifications (a) and (b); (e) calculating the ΔC T value by subtracting the average calculated in (d) for amplification (b) from the average calculated in (d) for amplification (a); and (f) calculating the relative copy number in the genomic DNA sample, wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"13 . The method of claim 1 , wherein the at least one test locus is amplified using the polymerase chain reaction to produce amplicons.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"14 . The method of claim 13 , wherein the amplification efficiency of each amplicon amplified from the test genome is within about ten percent of any other amplicon.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"15 . The method of claim 14 , wherein at least two target loci are amplified from each arm of each chromosome being interrogated.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"16 . The method of claim 15 , wherein at least four target loci are amplified from each chromosome being assayed.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"17 . The method of claim 13 , wherein multiple target loci are amplified and each is from any other target loci on the arm by approximately the same number of nucleotides.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"18 . The method of claim 13 , wherein the amplicons are less than or equal to about 110 nucleotides in length.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"19 . The method of claim 19 , wherein the amplicons are about 70 to 110 nucleotides in length.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"20 . The method of claim 13 , wherein primers utilized in the polymerase chain reaction are specific for regions outside of a copy number variable region.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"21 . The method of claim 20 , wherein the primers are selected from the group consisting of SEQ ID NOS. 1-192.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"22 . An array comprising a plurality of oligonucleotide probe sets, wherein each probe has a portion that is specific for at least one target locus in at least one chromosome, wherein the target locus is located on a region of the chromosome that is not within a copy number variable region on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"23 . The array of claim 22 , wherein the plurality of oligonucleotide probe sets are immobilized on a solid support.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"24 . The array of claim 22 , wherein the plurality of oligonucleotide probe sets comprise subsets of probes that are specific for at least two target loci outside of a CNVR from at least one chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"25 . The array of claim 22 , wherein the at least one chromosome is selected from human chromosomes 1-22, X and Y.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"26 . The array of claim 22 , wherein the nucleic acid probes are selected from the group consisting of SEQ ID NO: 193-288.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"27 . The array of claim 22 , wherein the nucleic acid primers are selected from the group consisting of SEQ ID NO: 1-192.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"28 . A kit for determining the copy number of at least one chromosome of a test genomic DNA sample of an unknown karyotype, the kit comprising, at least two oligonucleotide primers and at least one nucleic acid probe corresponding to a test locus located on a region of the chromosome that is not within a copy number variable region on the at least one chromosome and instructions for use.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"29 . The kit of claim 28 , further comprising at least one additional set of oligonucleotide primers corresponding to a reference test locus.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"30 . The kit of claim 28 , further comprising a control genomic DNA sample of known karyotype optionally affixed to a solid support.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"31 . The kit of claim 28 , further comprising a plurality of oligonucleotide primers and a plurality of oligonucleotide probes corresponding to a plurality of test loci located on a region of the chromosome that is not within a copy number variable region on one or more chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"32 . A method for diagnosing a disease resulting from a chromosomal abnormality, the method comprising: (a) providing a test sample comprising at least one test locus on at least one chromosome; (b) interrogating the at least one test locus on at least one chromosome in the test sample; and (c) quantifying the copy number of at least one of the interrogated test loci, thereby diagnosing a disease resulting from the chromosomal abnormality, wherein the at least one test locus is located on a region of the chromosome that is not within a copy number variable region on the chromosome.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"33 . Use of the method of claim 1 for diagnosing a disease resulting from a chromosomal abnormality.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"34 . Use of the array of claim 22 for diagnosing a disease resulting from a chromosomal abnormality.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"},{"text":"35 . Use of the kit of claim 28 for diagnosing a disease resulting from a chromosomal abnormality.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}]},"claim_lang":["en"],"has_claim":true,"description":{"en":{"text":"CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 61/334,658, filed May 14, 2010, which is herein incorporated by reference in its entirety. FIELD This disclosure relates to methods and kits for karyotyping in which at least one chromosome is interrogated by amplifying one or more loci that are not within copy number variable regions (CNVR) thereof. BACKGROUND INFORMATION The human haploid genome is a deoxyribonucleic acid (DNA) sequence and consists of approximately three billion base pairs grouped into 23 chromosomes. However, the human genome is diploid and consists of approximately six billion base pairs grouped into 46 chromosomes. Hence, two copies of each genomic segment and two copies of each chromosome are represented in most of the human genome. The exception is the male human, which has only one copy each of chromosome X and chromosome Y. Nevertheless, variable copy numbers (i.e. not two copies) of genomic segments and chromosomes are observed in individual genomic DNA (gDNA) samples. Such copy number variable regions (CNVR) that are typically greater than one kilobase in length and generally occur at a minor frequency of equal to or greater than 1% in the population are termed “copy number variants” (CNVs; see, e.g., Feuk, et al. Nat. Rev. Genet. 7:85-97 (2006)). Copy number variation (CNV) and its mechanisms of formation, associations with phenotype, and methods of analysis have been extensively reviewed (Feuk, supra; Freeman, et al. Genome Res. 16:949-961 (2006); Sharp, et al. Annu. Rev. Genomics Hum. Genet. 7:407-442 (2006); Nature Genetics 39:S1-S54 (2007), entire issue). Currently, approximately 8600 CNVs have been identified and cover about 5-10% of the human genome (Redon, et al. Nature 444:444-454 (2006); Conrad, et al. Nature 464:704-712 (2010)). Continuing studies toward finer mapping of the CNV map and interrogating more diverse gDNA samples are tracked at the Database of Genomic Variants (http://projects.tcag.ca/variation/). Aberrations in the normal complement of 46 human chromosomes have been identified by cytogenetic analysis. Cytogenetics and its history, linking of chromosomal defects and disease, and methods of analysis have been extensively reviewed (Speicher, et al. Nat. Rev. Genet. 6:782-792 (2005); Trask, Nat. Rev. Genet. 3:769-778 (2002)). More recently, polymerase chain reaction (PCR)-based assays have been used to identify such aberrations. There is a need in the art for methods that provide fast, accurate, easy-to-use and reliable karyotype information. Karyotype includes an analysis of chromosome number, type, shape, and banding. Currently available methods for determining karyotype and chromosome number lack accuracy due to the presence of CNVRs, are labor-intensive and do not provide for simultaneous interrogation of multiple chromosomes without requiring multiple reporting labels. Unless chromosomes are interrogated outside of CNVRs, an inaccurate karyotype or chromosome number determination may result. Accordingly, this disclosure provides such methods by using as target sequences only those targets known to be outside of CNVRs. In addition, the methods described herein provide for simultaneous interrogation of multiple chromosomes using a single, or multiple reporting labels. Using these methods, karyotypes may be rapidly and accurately determined. These and other advantages may be drawn from the description provided below. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 . Results of exemplary assay of chromosome 2. FIG. 2 . Results of exemplary assay of chromosome 3. FIG. 3 . Results of exemplary assay of chromosome 4. FIG. 4 . Results of exemplary assay of chromosome 5. FIG. 5 . Results of exemplary assay of chromosome 6. FIG. 6 . Results of exemplary assay of chromosome 20. FIG. 7 . Results of additional exemplary assay of chromosome 20. FIG. 8 . Results of exemplary assay of chromosome 22. For FIGS. 1-8 , the genomic DNA (gDNA) samples on the x-axis from left-to-right are as follows: NA 10859 — 1, NA10859 — 2, NA 10859 — 3, NA 10859 — 4, NA 14474, NA 14476, NA 17102, NA 17103, NA 17104, NA 17105, NA 17106, NA 17107, NA 17108, NA 17109, NA 17110, NA 17111, NA 17112, NA 17113, NA 17114, NA 17115, NA 17116, NA 17117, NA 17118, NA 17119, NA 17120, NA 17121, NA 17122M NA 17123, NA 17124, NA 17125, NA 17126, NA 17127, NA 17128, NA 17129, NA 17130, NA 17131, NA 17132, NA 17134, NA 17136, NA 17137, NA 17139, NA 17140, NA 17144, NA 17147, NA 17148, NA 17149, NA 17155, NA 17188, NA 17194, NA 17201, NA 17202, NA 17203, NA 17204, NA 17205, NA 17206, NA 17207, NA 17208, NA 17209, NA 17210, NA 17211, NA 17212, NA 17213, NA 17214, NA 17215, NA 17216, NA 17217, NA 17220, NA 17221, NA 17223, NA 17225, NA 17226, NA 17227, NA 17228, NA 17230, NA 17231, NA 17232, NA 17235, NA 17237, NA 17239, NA 17240, NA 17241, NA 17242, NA 17245, NA 17247, NA 17251, NA 17253, NA 17254, NA 17255, NA 17258, NA 17259, NA 17260, NA 17261, NA 17262, NA 17263. SUMMARY Disclosed herein are methods for karyotype analysis and for determining the copy number of a test locus on a chromosome in a test biological sample, the test locus being located outside of a copy number variable region (CNVR) of the chromosome, by amplifying a nucleic acid sequence corresponding to the test locus to produce an amplification product, or amplicon, and quantifying the relative copy number of the chromosome in the test biological sample relative to a control biological sample. Karyotyping methods are also provided here that do not require comparison to a reference assay or reference sample. Such methods include those using virtual reference assays or virtual calibrator samples. Embodiments of the methods disclosed herein can be performed on one or multiple samples with or without a calibrator sample or reference assay. In other embodiments, the target copy number assays can serve as the copy number reference assay herein denoted as a “virtual copy number reference assay”. Variations of these methods, as well as reagents, kits, arrays and devices for carrying out the same are also provided. DETAILED DESCRIPTION This disclosure relates to methods for measuring the copy number of one, more than one, or all chromosomes of a genome using real-time amplification methods (i.e., “karyotyping”). The term “karyotype” refers to the interrogation of one, more than one, or all chromosomes of a particular biological sample, such as a nucleic acid preparation including, but not limited to, deoxyribonucleic acid (DNA, including but not limited to, genomic (gDNA) and mitochondrial DNA (mtDNA)), ribonucleic acid (RNA), proteins, cells, tissues, and organisms. To “interrogate” one or more chromosomes means to perform an assay, including the methods described herein, to obtain information about the one or more chromosomes contained in the sample. Typically, information relating to “copy number” (CN) is desired. The term copy number generally refers to the number of amplicons resulting from polymerase chain reaction (PCR) amplification, the number of genes or regions on a chromosome, the number of chromosomes in a genome, and the like. The term “amplicon” refers to a piece of DNA formed as the product of an amplification reaction, such as PCR, ligase chain reaction (LCR) or natural gene duplication. The skilled artisan will understand that, within this disclosure, any such molecules can be referred to as target or reference loci depending on the particular assay system. For example, a genome can be queried using as the biological sample a gDNA that preferably, but not necessarily, contains at least one of each chromosome that the user desires to interrogate. In some embodiments, the gDNA sample can contain a pair of each of chromosomes 1-22 and either two X chromosomes, or an X and a Y chromosome. However, it is understood that variations and abnormalities occur such that the number or composition of chromosomes among gDNA samples can vary. In fact, the methods described herein are directed to detecting such variations and abnormalities. In addition, the user may desire to interrogate only a subset of chromosomes (i.e., one or more) present in a genome and it is therefore necessary that only those chromosomes of interest be present. Furthermore, the interrogation typically includes a reference locus (i.e., a “reference locus” or “endogenous control”) which is a locus different from the test locus and is not found within a CNVR. The copy number of the reference locus is typically, but not necessarily, known. A reference locus can reside on a chromosome of interest or on another chromosome and can be interrogated to normalize sample input or to determine relative copy number (i.e., an “endogenous control”). The methods and assays described herein, which include the determination of the copy number of target loci, are referred to herein as “copy number assays”. The methods and assays described herein for interrogating reference loci are referred to herein as “copy number reference assays”. Typically, the reference locus is present in all samples and is used to normalize for sample input variation and determine relative copy number. However, the test locus can be present or absent. For example, a Y chromosome test assay may interrogate as “present” in a normal male sample, but “absent” in a normal female sample. Existing assay systems, such as the TaqMan® Copy Number Assays (Applied Biosystems), have been used in some instances to interrogate target and reference loci. However, interrogation of test loci within copy number variable regions (CNVRs) has been found to lead to inaccurate karyotype determinations. An important feature of the methods described herein is that the test loci are outside of (i.e., not within) CNVRs. As described herein, a CNVR includes, but is not limited to, any type of structural variation of a target locus that can affect copy number determination including, but not limited to, duplications, deletions, insertions, repeats, substitutions, and the like. Certain variations can imitate or mimic changes in chromosomal copy number or detrimentally affect the assay by making it less reliable or accurate. Typically, a “universal” set of karyotyping assays (i.e., applicable to all samples or persons) will not target CNVRs. However, it is important to note that CNVRs may vary between individuals or populations of individuals. For instance, a duplication observed in an individual or population of individuals may not be observed in another individual or population of individuals. As such, the methods described herein may target loci that are within a CNVR in one individual or population of individuals but not within a CNVR or another individual or population of individuals. The difference in copy number between samples is typically determined by “relative quantitation”. Relative quantitation is used to report the copy number of a target locus or chromosome on which the target locus is found in a test sample (i.e., “test locus” or “unknown locus”) relative to one or more reference loci or “calibrator samples”. With reference to the use of a calibrator sample, the term “relative to” means compared to the copy number of a target locus or chromosome on which the target locus is found in a calibrator sample. A “calibrator sample” is a biological sample, often of known karyotype (i.e., a “control gDNA”), that is interrogated before, after or simultaneously with the test sample. The number of copies in the test sample can then be determined relative to the calibrator sample. One or more reference loci or calibrator samples can be used as desired by the user. The one or more reference loci can be the same or different and can be present in the test sample(s) or calibrator sample(s). Typically, the measure of relative quantitation is reported using the term “fold change”, which refers to the amount of amplified product (which relates to the copy number) in a test sample relative to a reference or calibrator sample. Fold change can be quantified using any of several available methods, including but not limited to those described by Livak, et al. (Methods, 25:402-408 (2001)) or commercially available products such as CopyCaller™ (Applied Biosystems, see below). The methods described herein can be performed on one or more than one sample with or without a calibrator sample or reference assay. Various embodiments of such methods are described herein. The real-time polymerase chain reaction (RT-PCR) is a conventional tool which can be used to amplify and quantify a target nucleic acid molecule, including but not limited to, DNA and RNA, in a sample. The amount of target nucleic acid can be determined as an absolute copy number or as a relative amount. Specifically, the use of RT-PCR to quantify gene expression using the comparative C T method is known to one of skill in the art (Livak, et al. (supra)). In general, the threshold cycle (C T ) for a given genetic locus can be determined by arbitrarily setting a signal intensity threshold that falls within the linear range of amplification of real-time PCR data. Previous application of this calculation has been used, for example, to normalize the amplification product of a target gene to the amplification product of an endogenous control gene and then to normalize the data to a calibrator sample, such as an untreated reference sample, to determine the expression of the target gene. Certain currently available assay systems, such as PCR-based TaqMan® systems, can be useful for relative quantification of nucleic acids amplified from a biological sample to determine gene or chromosome copy number (see, e.g., the TaqMan® assays described in the following Applied Biosystems publications: “Product Bulletin: TaqMan® Copy Number Assays and Custom TaqMan® Copy Number Assays”, “Protocol: TaqMan® Copy Number Assays” (PN 4397425 Rev. C), “Quick Reference Card: TaqMan® Copy Number Assays” (PN 4397424 Rev. B)). The TaqMan® Copy Number Assay and the TaqMan® Copy Number Reference Assay have been used in tandem to interrogate chromosomes to amplify target and control loci, respectively. Usually, the assays are carried out as a single step, “two-plex” real-time PCR assay (i.e., two separate assays within the same reaction well or container). In this type of assay, target and control loci are detected using differently labeled probes. Often, the sample interrogated by such PCR-based assays is human genomic DNA (gDNA) and, typically a minimum of two human gDNA samples are interrogated, including a test and a calibrator sample. Currently, the TaqMan® Copy Number Assay interrogates test loci, which are located throughout the genome and may reside within a copy number variable region (CNVR) and provides copy number variation (CNV) information. The TaqMan® Copy Number Reference Assay interrogates one or more reference loci which, as defined above, are found outside of CNVRs (e.g., Ribonuclease P RNA component H1 (H1RNA) gene (RPPH1) on chromosome 14, cytoband 14q11.2, also known as “RNase P”, and the telomerase reverse transcriptase (TERT) gene located on chromosome 5, cytoband 5p15.33). The TaqMan® Copy Number Reference Assay thereby serves as the endogenous control by interrogating a non-CNVR sequence of interest to normalize for sample input variation by relative quantification (RQ). For example, the TaqMan® Copy Number Assay can utilize an FAM™ dye-labeled minor groove binder (MGB) probe and unlabeled PCR primers directed at the one or more test loci in the test sample or calibrator sample, which are typically assayed separately. The TaqMan® Copy Number Reference Assay can use VIC dye-labeled TAMRA™ probes directed at the one or more reference loci. By comparing the products of these reactions, the user normalizes for sample amount and determines the relative number of copies of the target loci in the sample. However, as described above, interrogation of test loci within copy number variable regions (CNVRs) has been found to lead to inaccurate karyotype determinations. Thus, it is important that the target loci are found outside of (e.g., not within) CNVRs. The methods described herein can utilize a copy number reference assay. In certain embodiments, the target loci in the test and calibrator sample(s) of, for example, gDNA, can be the same or different. In certain embodimetns, the reference assay is used to normalize for sample input variation between samples (i.e., between multiple test samples or between the test and calibrator samples). Thus, in such assays, one or more reference loci can be amplified from the test or control samples and the copy number (i.e., fold change) is calculated as described herein as a copy number reference assay. Variations of such embodiments are also contemplated as would be understood by one of skill in the art. The methods described herein can also be conducted using a calibrator sample that, as described above, is typically a biological sample of known karyotype, while the karyotype of the test sample is unknown. The relative difference in copy number between the calibrator sample and the test sample can be calculated as is known in the art or described herein. Typically, the “test assay” and “calibrator assay” (i.e., reference or endogenous control assay) are both used for relative quantification of all samples in order to normalize for sample input variation between samples prior to comparing the different samples themselves. The copy number of the target loci of the test samples is calculated by dividing the fold change of the target copy number in the test sample by that of the calibrator sample and then multiplying by the target copy number of the calibrator sample. This calculation is used in the analysis of the currently and commercially available TaqMan® assay systems and similar systems. The test and calibrator assays are, at least in part, directed to the same target loci, but the target loci can also be different. In some embodiments, the methods can include amplifying a target locus from outside (i.e., not within) a CNVR from a test biological sample (such as a gDNA sample in which the number of copies of a particular chromosome is not known), amplifying the same target loci from a calibrator biological sample, and calculating the copy number of the target loci in the test sample relative to the control sample. Variations of such embodiments, including those that do not use a reference assay or calibrator sample, are also contemplated as would be understood by one of skill in the art. As discussed above, many embodiments of the methods described herein are contemplated as would be understood by one of skill in the art. Exemplary assay formats using reference or calibrator samples are illustrated in Table 1 and described below. TABLE 1Exemplary Karyotyping Assay Design Formats when an UnknownSample is Tested Relative to a Calibrator SampleReaction #1Reaction #2No.DetectableDetectableNo. CNReactionsPlexyDetectableLabelDetectableLabelFormatNo. CNReference(perPerLabel (CN(CN Ref.Label (CN(CN Ref.No.AssaysAssayssample)ReactionAssay)Assay)Assay)Assay)11112Dye #1*Dye #221121Dye #1Dye #131121Dye #1Dye #241121DNADNABindingBindingDye**Dye5≧21≧31Dye #1Dye #16≧21≧31Dye #1Dye #27≧21≧31DNADNABindingBindingDyeDye81≧2≧31Dye #1Dye #191≧2≧31Dye #1Dye #2101≧2≧31DNADNABindingBindingDyeDye11≧2≧2≧41Dye #1Dye #112≧2≧2≧41Dye #1Dye #213≧2≧2≧41DNADNABindingBindingDyeDye14≧20≧21Dye #1Dye #115≧20≧21Dye #1Dye #216≧20≧21DNADNABindingBindingDyeDye*Dyes are typically conjugated to primers or probes.**DNA binding dyes are typically not conjugated to primers or probes. Notes The number of reactions is per replicate per sample. Dye #1 and Dye #2 represent different fluorophores conjugated to probes or primers of the Copy Number Assay and Copy Number Reference Assay and provide differential fluorescence as the reaction generates amplification products.DNA Binding Dye represents a fluorophore that binds to amplification products and provides fluorescence as the reaction generates amplification products.Format 1 is one 2-plex reaction (i.e. a multiplex reaction).Formats 2, 3, and 4 are variations of two 1-plex reactions (i.e., a single-plex reaction).Formats 5, 6, and 7 are variations of 1-plex reactions that combine (via average, median, etc.) C T values from multiple Copy Number Assays.Formats 8, 9, and 10 are variations of 1-plex reactions that combine (via average, median, etc.) C T values from multiple Copy Number Reference Assays.Formats 11, 12, and 13 are variations of 1-plex reactions that combine (via average, median, etc.) C T values from multiple Copy Number Assays and combine (via average, median, etc.) C T values from multiple Copy Number Reference Assays.Formats 14, 15, and 16 are variations of 1-plex reactions that provide multiple analyses via each Copy Number Assay, in turn, being compared to one or more of the remaining virtual Copy Number Reference Assays.Copy Number Assays of format 5, 6, or 7 target the same chromosome.Copy Number Reference Assays of format 8, 9, or 10 target the same chromosome.Copy Number Assays of format 11, 12, or 13 target the same chromosome.Copy Number Reference Assays of format 11, 12, or 13 target the same chromosome.Copy Number Assays of format 14, 15, or 16 target different chromosomes.Formats 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 may also permute and combine (via average, median, etc.) ΔC T values.Formats 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 may also be multiplexed (even though the multiplexed assays may not provide ΔC T value).(Modified) permutations of different formats are also possible (e.g. format 14 with multiple Copy Number Assays per chromosome via incorporating aspects of format 5).Detectable entities other than fluorophores may also be employed. In certain formats outlined in Table 1, the detectable label can be the same (e.g., formats 2, 4, 5, 7, 8, 10, 11, 13, 14, and 16). In other formats, the detectable labels can be different (e.g., Dye #1, Dye #2, and DNA binding dye as in formats 1, 3, 6, 9, 12, or 15) and are conjugated to probes or primers to provide a differential value as the reaction generates amplification products. One or more DNA binding dyes can be used to detect amplification products generated during a reaction (such as real-time PCR) in a multiplex reaction or in separate 1-plex reactions. Typically, the DNA binding dyes are not conjugated to a probe or primer. The skilled artisan will also note the following from Table 1: 1) format 1 is a 2-plex reaction (i.e., multiplex reaction) and uses different detectable labels for each reaction;2) formats 2, 3, and 4 are variations of two 1-plex reactions (i.e., single-plex reaction) and use the same or different detectable labels in each reaction;3) formats 5, 6, and 7 are variations of 1-plex reactions that combine C T values from multiple copy number assays (via average, median, etc.), typically target the same chromosome, and can use the same or different detectable labels in each reaction;4) formats 8, 9, and 10 are variations of 1-plex reactions that combine C T values from multiple copy number reference assays (via average, median, etc.), target the same chromosome, and use the same or different detectable labels in each reaction;5) formats 11, 12, and 13 are variations of 1-plex reactions that combine C T values from multiple copy number assays (via average, median, etc.) and combine C T values from multiple copy number reference assays (via average, median, etc.), target the same chromosome, and use the same or different detectable labels in each reaction;6) formats 14, 15, and 16 are variations of 1-plex reactions that provide multiple analyses in which each copy number assay is compared to one or more of the remaining virtual copy number reference assays, target different chromosomes, and use the same or different detectable labels in each reaction. Formats 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 can also permute and combine (e.g., via average, median, etc.) ΔC T values. The ΔC T value is defined herein as the C T of the test copy number assay minus the C T of the copy number reference assay. The ΔΔC T value is defined herein as: [the C T of the test assay minus the C T of the reference assay of each test sample] minus [the C T of the test assay minus the C T of the reference assay of the calibrator sample]. In some embodiments, the ΔΔC T values can also be permuted and combined. However, because the ΔC T of the calibrator sample is subtracted from each ΔC T of the test sample, the values being permuted and combined now (ΔΔC T vs. ΔC T ) are of a different scale, and track in a “parallel” manner (e.g., ΔC T s of 2, 4, 5 vs. ΔΔC T s of 1, 3, 4 where a value of 1 is subtracted from each). Formats 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, and 16 can also be multiplexed even though the multiplexed assays may not provide a ΔC T value. Modified permutations of different formats are also possible (for example, formats 5 and 14 can be combined for analysis of multiple copy number assays per chromosome). In one embodiment, karyotyping assay format 1 of Table 1 uses a 2-plex real-time PCR reaction comprised of a copy number assay (or test assay) and a copy number reference assay wherein target loci outside of CNVRs are interrogated. Generally, the detectable labels used by each component of this karyotyping assay are different because the amplified products are contained within the same reaction. Subsequent copy number analysis by the 2 −ΔΔCT method is the same as that used in the TaqMan® Copy Number Assay. In this calculation, ΔΔC T determined for each test copy number assay serves as the negative exponent of 2 in order to calculate the fold change for each test copy number assay relative to its corresponding copy number reference assay. This assay format provides for multiplexing of the copy number assay and the copy number reference assay, which minimizes the error of the ΔC T calculation and minimizes the use of reagents and consumables. This karyotyping assay format can be used to interrogate a single chromosome or multiple chromosomes. In certain embodiments, the test copy number assay provides the copy number of the target locus of the test sample, as well as the copy number of the chromosome containing the target locus. Different samples having a particular target locus known to be outside of a CNVR can be used for the reference assay. To properly normalize for sample input variation, the target locus or chromosomal copy number for the reference assay should be the same for all samples. In such embodiments, the copy number assay and copy number reference assay can target different chromosomes. Alternatively, or in addition, each chromosome can be interrogated with both a copy number assay and a copy number reference assay. Typically, but not necessarily, each chromosome is assayed separately from one another. Karyotyping assay formats 2, 3, and 4 of Table 1 each use two single-plex real-time PCR reactions and the same, two or three different, detectable label(s). One real-time PCR reaction is the copy number assay and the other real-time PCR reaction is the copy number reference assay. The detectable label used in each assay can be the same or different. Subsequent copy number analysis by the 2 −ΔΔCT method is performed as previously described hereinabove, with the exception that the replicate C T values of the copy number assay and copy number reference assay are typically, but not necessarily, averaged separately prior to calculating the average ΔC T value. These karyotyping assay designs provide the following advantages: 1) the use of copy number assay and copy number reference assay utilizing the same detectable label conjugated to the probe or primer; 2) the use of previously incompatible assays that cannot be multiplexed due to assay interaction issues or PCR bias of one assay over another; and 3) the use of a DNA binding dye in order to minimize reagent costs. It is possible to use this assay format, or modified versions thereof, to interrogate a single chromosome or multiple chromosomes. Each chromosome is interrogated with both a copy number assay and a copy number reference assay and typically, but not necessarily, each chromosome is assayed separately from one another. In some embodiments, the karyotyping assay uses one or more copy number assays specific for the chromosome of interest, and one or more copy number reference assays. In some embodiments, the average or median C T values can be used. An average average (or “double average”) C T value is calculated by averaging the multiple average C T values derived from the replicates of each copy number assay when more than one copy number assay is used. One or more copy number assays against a chromosome or chromosomes different from the test sample can be used as controls. These control copy number assays fill the role served by copy number reference assay in karyotyping assay formats 1-4 described above. A “double” average C T value is calculated by averaging the multiple average C T values derived from the replicates of each copy number assay. The “double” average ΔC T value can then be calculated from the two “double” average C T values. Subsequent copy number analysis by the 2 −ΔΔCT method is carried out as previously described herein. Karyotyping assay formats 5, 6, 7, 8, 9, 10, 11, 12, and 13 provide the following advantages: 1) allow one to use previously incompatible assays that cannot be multiplexed due to assay interaction issues or PCR bias of one assay over another; 2) allow one to use a DNA binding dye (e.g., SYBR Green I) in order to minimize reagent costs; 3) allow one to eliminate the use of a defined copy number reference assay; and 4) allow one to minimize aberrant copy number observed from a minority of copy number assays by diluting the aberrant average C T values in a “double” average C T value. Karyotyping assay formats 5, 6, 7, 8, 9, 10, 11, 12, or 13, or modified versions thereof, can be used to interrogate a single chromosome or multiple chromosomes. In other embodiments, the copy number assays can serve as a copy number reference assay herein denoted as a “virtual copy number reference assay”. In these embodiments, a multiplicity of copy number assays are performed and each individual copy number assay is compared to one or more of the remaining copy number assays, which then serve as the copy number reference assays. For example, if ten copy number assays are performed, copy number assay no. 1 is compared to each of copy number assays nos. 2-9, copy number assay no. 2 is compared to each of copy number assays nos. 1 and 3-10, and so forth, for a possible total number of 90 different copy number calculations. For each copy number determination, any two or more of the other nine virtual copy number reference assays can be combined (e.g., via average, median, etc.) toward a total number of ten different analyses. This combining takes place at the virtual copy number reference assay C T level or ΔC T level with one copy number assay and up to nine virtual copy number reference assays. These karyotyping assay formats provide the following advantages: 1) the use of incompatible assays that cannot be multiplexed due to assay interaction issues or PCR bias of one assay over another; 2) the use of a DNA binding dye in order to minimize reagent costs; 3) elimination of a properly defined copy number reference assay; 4) confirmation of copy number using each copy number assay as a virtual copy number reference assay; and 5) for troubleshooting of a copy number assay by the use of each copy number assay as a virtual copy number reference assay. It is also possible to further modify these karyotyping assay formats. For example, in some embodiments, at least ten different copy number analyses can be used in karyotyping assay formats 14, 15, or 16, and the ten different average ΔC T values derived from the ten different copy number analyses are then averaged toward a “double” average ΔC T value. Subsequent copy number analysis by the 2 −ΔΔCT method is performed as previously described herein. This copy number analysis mirrors that of the other assays with the exception that average ΔC T values, not average C T values, are being averaged. In other embodiments, assay formats 14, 15 or 16 can be combined with assay formats 5, 6, 7, 11, 12 or 13 by averaging the average C T values from multiple copy number assays prior to calculating ΔC T values. For example, a karyotyping assay with 10 copy number assays in which five target chromosome 1 and five target chromosome 2, the replicate C T values are averaged prior to averaging the five assays targeting each chromosome. Accordingly, only two “double” average C T values exist, one for each chromosome. A variety of subsequent calculations of ΔC T are possible. These karyotyping assay formats with modified copy number analyses provide the following advantages: 1) the use of previously incompatible assays that can not be multiplexed due to assay interaction issues or PCR bias of one assay over another; 2) the use of a DNA binding dye in order to minimize reagent costs; 3) do not rely on the use of a properly defined copy number reference assay; and 4) minimize aberrant copy number results observed in some copy number assays by diluting the aberrant average ΔC T values in a “double” average ΔC T value. Such assay formats can be used to interrogate a single chromosome or multiple chromosomes. It should also be noted that the real-time PCR reactions can utilize increased multiplexing. Karyotyping methods that use a virtual copy number reference assay (i.e., those that do not utilize either a reference assay or calibrator sample) are also provided. Situations in which a reference assay is not used include the lack of a suitable reference genomic sequence, non-identification of a control assay locus from a reference genomic sequence, assay unavailability, cost reduction, or to facilitate ease of use. Situations in which a calibrator sample is not used include unavailability of such a sample or a reference sequence, to reduce costs, or facilitate ease of use. Such assays are described below. In the following two embodiments, the copy number assay C T values and copy number reference assay C T values for the virtual calibrator sample are calculated. The copy number assay C T values can be calculated by averaging the replicate C T for each copy number assay and then averaging these values across the multiple test samples. Alternatively, the copy number assay C T values can be calculated by averaging replicate C T values of each copy number assay, averaging these values across multiple copy number assays (those targeting the same chromosome), and averaging these values across the multiple test samples. These methods can also be applied to the copy number reference assay C T values. Depending upon the number of copy number assays and copy number reference assays used, up to four formats can be used to perform this calculation. Furthermore, the copy number assays and the copy number reference assays for the test samples can be treated separately or in combination as outlined in Table 1. In the first of these embodiments, a “virtual calibrator sample” can be used in lieu of an actual calibrator sample (i.e., virtual calibrator assay no. 1). Typically, in these karyotyping assays, one or more copy number assays targeting one or more test chromosomes, one or more copy number reference assays targeting one or more reference chromosomes, and two or more test samples (e.g., gDNA) are utilized. In these assays, the copy number of the reference chromosome may or may not be previously known. An average C T value is calculated from the replicate C T values of copy number assay. If more than one copy number assay is used, the average C T values of each copy number assay are averaged. This calculation is performed for each of the two or more test samples, and for the one or more reference assay(s). The average C T values or “double” average C T values can then be further averaged across the two or more test samples. This “double” or “triple” average C T value is representative of a “virtual” calibrator sample. If appropriate, other calculations, such as the median, can be used in lieu of the average. The calculated C T values from the copy number assay(s) and copy number reference assay(s) can then be used to calculate the ΔC T value for each of the test samples. Subsequent copy number analysis by the 2 −ΔΔCT method (see below) is similar to that as previously described herein. More accurate results will typically result when the test samples are normalized to the same concentration prior to chromosomal copy number analysis and when additional reference assays are utilized. Even in the presence of equal numbers of target loci, different reference assays may provide different C T values due to differences in assay performance. Therefore, the use of additional reference assays can provide a more accurate C T representation of each test gDNA sample. Likewise, the use of additional test samples can provide a more accurate C T representation of the “virtual” calibrator sample. In another of these embodiments, a modified “virtual calibrator sample” (i.e., virtual calibrator assay no. 2) can be used in lieu of an actual calibrator sample as described in the immediately preceding paragraph. However, after averaging replicate C T values, the average C T values from one copy number reference assay can be averaged across the multiple test samples. This “double” average C T value represents the C T value from the virtual calibrator sample. If multiple copy number reference assays are used, average C T values from replicates can be averaged across multiple copy number reference assays and then averaged across multiple test samples toward a “triple” average C T value representing the virtual calibrator sample. Multiple copy number assays can be treated separately or combined. In yet other embodiments, multiple copy number assays with virtual calibrator assays are used, for example, multiple copy number assays targeting one or more test loci on a chromosome (virtual calibrator assay no. 1 targeting the test sample); multiple copy number assays targeting one or more test locus on a reference chromosome (virtual calibrator assay no. 2 targeting the virtual calibrator sample); multiple copy number reference assays targeting a reference chromosome (virtual calibrator assay no. 3, copy number reference assay targeting the test sample and the virtual calibrator sample). In these embodiments, the copy number of the reference chromosome may or may not be previously known. The copy number of the targeted chromosome(s) in virtual calibrator assays no. 2 and no. 3 need not be the same. In these embodiments, a calibrator sample is not required. “Double” average C T values are calculated from each of the three assay groups. The “double” average C T values from virtual calibrator assays no. 1 and no. 3 are then used to calculate the ΔC T value for the test sample. If appropriate, other calculations, such as the median, can be used in lieu of the average. The “double” average C T values from virtual calibrator assays no. 2 and no. 3 are used to calculate the ΔC T value for the “virtual” calibrator sample. Subsequent copy number analysis by the 2 −ΔΔCT method is similar to that previously described herein. It is noted that the use of additional test and reference assays can provide a more accurate C T representation of the test gDNA sample and “virtual” calibrator gDNA sample. Yet another embodiment is similar to that described in the immediately preceding paragraph except that virtual calibrator assay #3 is omitted. Because the test sample and “virtual” calibrator sample are derived from the same biological sample, there is no need to normalize for input variation by using one or more reference assays. Therefore, the reference assays can be removed from the workflow. Upon calculating the “double” average C T values from virtual calibrator assays no. 1 and no. 2, the “double” average C T value from virtual calibrator assay no. 2, representing the “virtual” calibrator sample, is subtracted from the “double” average C T value from assay group no. 1, representing the test sample, to calculate a ΔC T value. If appropriate, other calculations, such as the median, can be used in lieu of the average. Because the reference assays are not used, calculation of relative quantity via the equation of 2 −ΔΔCT is replaced with calculation of relative quantity via the equation of the 2 −ΔCT . Subsequent copy number analysis is similar to that previously described herein. As described above, data generated using the karyotyping methods described herein (with or without reference or calibrator samples) can be analyzed using any of several well-known methods or algorithms. As an example, relative copy number can be calculated using assay format 1 (of Table 1) as shown in Table 2: TABLE 2Karyotyping Assay Format 1 Performed Without ReplicatesTest orCali-UnknownbratorStepDescriptionSampleSample1Determine copy number of calibrator sampleTBD22Collect C T value from copy number assay23203Collect C T value from copy number reference2321assay4Calculate ΔC T value0−1(C T from CN Assay − C T from CN Ref Assay)5Calculate ΔΔC T value10(ΔC T from each sample − ΔC T from calibratorsample)6Calculate relative quantity (RQ = 2 −ΔΔCT )0.517Calculate copy number12(CN = RQ × CN of calibrator sample) As understood by those of skill in the art, a one cycle difference is theoretically a two-fold difference in quantity of the target sample. The skilled artisan can derive from step 2 that the Test or Unknown Sample (C T value=23) can have eight-fold fewer copies than the Calibrator Sample (C T value=20). However, because the copy number reference assay targets the same number of copies in all samples, the test sample (C T value=23) actually contains four-fold less sample input the calibrator sample (C T value=21). Because of the normalization of sample input variation via the copy number reference assay, it can be determined that the test sample has two-fold fewer copies than the calibrator sample (i.e., 4-fold variation is accounted for as sample input variation from the initial 8-fold variation) indicating that the actual copy number variation between the test and calibrator samples is two-fold. The data generated using the methods described herein can also be analyzed using CopyCaller™ software available from Applied Biosystems. CopyCaller™ software is based on the 2 −ΔΔCT method described by Livak, et al. (supra). In one method, the user is required to select one sample as the calibrator sample and to identify the copy number thereof. For example, if the target loci in the test sample (such as gDNA) is detected using VIC™ dye and the target loci in the calibrator sample is detected using FAM™ dye, the ΔC T value is calculated for each reaction well by subtracting the VIC™ C T value from the FAM™ C T value. The calculation of the ΔC T value normalizes for sample input variation between wells. Because multiple replicates are typically assayed, the ΔC T values from each replicate for each sample are averaged toward an average ΔC T value for each sample. The ΔΔC T value is calculated for each sample by subtracting the average ΔC T value of the calibrator sample from the average ΔC T value of each test sample. The calculation of the ΔΔC T value provides for determining the copy number of a test sample relative to the calibrator sample of known copy number. The ΔΔC T values are converted to a relative quantity (RQ) by the equation of RQ=2 −ΔΔCT . The RQ value of each sample is then multiplied by the copy number of the calibrator sample to obtain the copy number determination of each sample. Another method of copy number analysis by CopyCaller™ utilizes proprietary algorithms for determining copy number without selection of a calibrator sample. The user is only required to identify the most common copy number to be provided by the samples. Both methods of copy number analysis by CopyCaller™ employ outlier removal strategies for all C T and ΔC T values. CopyCaller™ can also provide confidence and absolute Z-score values for the predicted copy number values. It is also noted that copy number analysis methods other than the 2 −ΔΔCT method can be utilized (e.g., Cikos, et al. Anal Biochem. 384:1-10 (2009)). Other methods of analysis can also be used, as would be understood by one of skill in the art. While many of the embodiments described herein relate to PCR, other amplification or product detection methods or reagents can also be utilized. For example, such methods or reagents may include any of several methods that can be used to amplify the target nucleic acid from the sample. The term “amplifying” which typically refers to an “exponential” increase in target nucleic acid is used herein to describe both linear and exponential increases in the numbers of a select target sequence of nucleic acid. The term “amplification reaction mixture” refers to an aqueous solution comprising the various reagents used to amplify a target nucleic acid. These include enzymes, including, but not limited to, polymerases (such as DNA polymerase, RNA polymerase and reverse transcriptase), aqueous buffers, salts, amplification primers, target nucleic acid, and nucleoside triphosphates. Depending upon the context, the mixture can be either a complete or incomplete amplification reaction mixture. The method used to amplify the target nucleic acid can be any method available to one of skill in the art. Any in vitro means for multiplying or amplifying the copies of a target sequence of nucleic acid can be utilized. These include linear, logarithmic, or any other amplification method. Exemplary methods include polymerase chain reaction (PCR; see, e.g., U.S. Pat. Nos. 4,683,202; 4,683,195; 4,965,188; and 5,035,996), isothermal procedures (using one or more RNA polymerases (see, e.g., WO 2006/081222), strand displacement (see, e.g., U.S. Pat. No. RE39,007), partial destruction of primer molecules (see, e.g., WO 2006/087574), ligase chain reaction (LCR) (see, e.g., Wu, et al. Genomics 4:560-569 (1989) and Barany, Proc. Natl. Acad. Sci. USA 88:189-193 (1991)), Qβ RNA replicase systems, RNA transcription-based systems (e.g., TAS, 3SR), rolling circle amplification (RCA) (see, e.g., U.S. Pat. No. 5,854,033; U.S. Pub. No. 2004/0265897; Lizardi, et al. Nat. Genet. 19: 225-232 (1998); and Barter, et al. Nucleic Acid Res. 26:5073-5078 (1998)), and strand displacement amplification (SDA) (Little, et al. Clin. Chem. 45:777-784 (1999)), among others. Many systems are suitable for use in amplifying target nucleic acids and are contemplated herein as would be understood by one of skill in the art. Any of several methods can be used to detect amplified target nucleic acids using primers or probes. Many different reagents, systems, or detectable labels can be used in the methods described herein. These include, for example, TaqMan® systems, detectable nucleic acid intercalating agents, such as ethidium bromide and SYBR dyes, detectable label-quencher systems (e.g., FRET, salicylate/DTPA ligand systems (see, e.g., Oser et al. Angew. Chem. Int. Ed. Engl. 29:1167-1169 (1990)), displacement hybridization, homologous probes, assays described in EP 070685), molecular beacons (e.g., NASBA), Scorpion, locked nucleic acid (LNA) bases (Singh, et al. Chem. Commun. 4:455-456 (1998)), peptide nucleic acid (PNA) probes (Pellestor, et al. Eur. J. Hum. Gen. 12:694-700 (2004)), Eclipse probes (Afonina, et al. Biotechniques 32:940-949 (2002)), light-up probes (Svanvik, et al. Anal. Biochem. 281:26-35 (2000)), molecular beacons (Tyagi, et al. Nat. Biotechnol. 14:303-308 (1996)), tripartite molecular beacons (Nutiu, Nucleic Acids Res. 30:E94 (2002)), QuantiProbes (www.qiagen.com), HyBeacons (French, et al. Mol. Cell. Probes 15:363-374 (2001)), displacement probes (Li, et al. Nucleic Acids Res. 30:E5 (2002)), HybProbes (Cardullo, et al. Proc. Natl. Acad. Sci. USA 85:8790-8794 (1988)), MGB Alert® probes (www.nanogen.com), Q-PNA (Fiandaca, et al. Genome Res. 11:609-613 (2001)), Plexor (www.Promega.com), LUX primers (Nazarenko, et al. Nucleic Acids Res. 30:E37 (2002)), Scorpion primers (Whitcombe, et al. Nat. Biotechnol. 17:804-807 (1999)), AmpliFluor® (Sunrise) primers (Nazarenko, et al. Nucleic Acids Res. 25:2516-2521 (1997)), DzyNA primers (Todd, et al. Clin. Chem. 46:625-630 (2000)), and the like. In each of these assays, the generation of amplification products can be monitored while the reaction is in progress. An apparatus for detecting the signal generated by the detectable label can be used to detect, measure, and quantify the signal before, during, or after amplification. The particular type of signal may dictate the choice of detection method. For example, in some embodiments, fluorescent dyes are used to label probes or amplified products. The probes bind to single-stranded or double-stranded amplified products, or the dyes intercalate into the double-stranded amplified products, and consequently, the resulting fluorescence increases as the amount of amplified product increases. In some embodiments, the T m is ascertained by observing a fluorescence decrease as the double-stranded amplified product dissociates and the intercalating dye is released therefrom. The amount of fluorescence can be quantitated using standard equipment such as a spectra-fluorometer, for example. The use of other methods or reagents is also contemplated herein as would be understood by one of skill in the art. One exemplary method for amplifying and detecting target nucleic acids is the TaqMan® system described above (see, e.g., U.S. Pat. Nos. 4,889,818; 5,079,352; 5,210,015; 5,436,134; 5,487,972; 5,658,751; 5,538,848; 5,618,711; 5,677,152; 5,723,591; 5,773,258; 5,789,224; 5,801,155; 5,804,375; 5,876,930; 5,994,056; 6,030,787; 6,084,102; 6,127,155; 6,171,785; 6,214,979; 6,258,569; 6,814,934; 6,821,727; 7,141,377; and 7,445,900). As described herein and elsewhere, TaqMan® assays are typically carried out by performing nucleic acid amplification on a target polynucleotide using a nucleic acid polymerase having 5′-to-3′ nuclease activity, a primer capable of hybridizing to said target polynucleotide, and an oligonucleotide probe capable of hybridizing to said target polynucleotide 3′ relative to said primer. The oligonucleotide probe typically includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of said reporter molecule. The oligonucleotide probe typically exists in at least one single-stranded conformation when unhybridized where said quencher molecule quenches the fluorescence of said reporter molecule. When hybridized to a target nucleic acid, the probe exhibits at least one other conformation in which the fluorescence of the reporter molecule is unquenched. Typically, the detectable label and quencher molecule are part of a single probe. As amplification proceeds, the polymerase digests the probe to separate the detectable label from the quencher molecule. The detectable label (e.g., fluorescence) is monitored during the reaction, where detection of the label corresponds to the occurrence of nucleic acid amplification (e.g., the higher the signal the greater the amount of amplification). Variations of TaqMan® assays (e.g., LNA™ spiked TaqMan® assay) are known in the art and would be suitable for use in the methods described herein. Another exemplary system utilizes double-stranded probes in displacement hybridization methods (see, e.g., Morrison, et al. Anal. Biochem. 183:231-244 (1989); and Li, et al., (supra)). In such methods, the probe typically includes two complementary oligonucleotides of different lengths where one includes a detectable label and the other includes a quencher molecule. When not bound to a target nucleic acid, the quencher suppresses the signal from the detectable label. The probe becomes detectable upon displacement hybridization with a target nucleic acid. Multiple probes can be used, each containing different detectable labels, such that multiple target nucleic acids may be queried in a single reaction. Additional exemplary methods for amplifying and detecting target nucleic acids involve “molecular beacons”, which are single-stranded hairpin shaped oligonucleotide probes. In the presence of the target sequence, the probe unfolds, binds and emits a signal (e.g., fluoresces). A molecular beacon typically includes at least four components: 1) the “loop”, an 18-30 nucleotide region which is complementary to the target sequence; 2) two 5-7 nucleotide “stems” found on either end of the loop and being complementary to one another; 3) at the 5′ end, a detectable label; and 4) at the 3′ end, a quencher dye that prevents the detectable label from emitting a signal when the probe is in the closed loop shape (i.e., not bound to a target nucleic acid). Thus, in the presence of a complementary target, the “stem” portion of the beacon separates out resulting in the probe hybridizing to the target. Other types of molecular beacons are also known and may be suitable for use in the methods described herein. Molecular beacons can be used in a variety of assay systems. One such system is nucleic acid sequence-based amplification (NASBA®), a single step isothermal process for amplifying RNA to double stranded DNA without temperature cycling. A NASBA® reaction typically requires avian myeloblastosis virus (AMV), reverse transcriptase (RT), T7 RNA polymerase, RNase H, and two oligonucleotide primers. After amplification, the amplified target nucleic acid can be detected using a molecular beacon. Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein. The Scorpion system is another exemplary assay format that can be used in the methods described herein. Scorpion primers are bi-functional molecules in which a primer is covalently linked to the probe, along with a detectable label (e.g., a fluorophore) and a quencher. In the presence of a target nucleic acid, the detectable label and the quencher separate which leads to an increase in signal emitted from the detectable label. Typically, a primer used in the amplification reaction includes a probe element at the 5′ end along with a “PCR blocker” element (e.g., HEG monomer) at the start of the hairpin loop. The probe typically includes a self-complementary stem sequence with a detectable label at one end and a quencher at the other. In the initial amplification cycles (e.g., PCR), the primer hybridizes to the target and extension occurs due to the action of the polymerase. The Scorpion system can be used to examine and identify point mutations using multiple probes that have different tags to distinguish between the probes. Using PCR as an example, after one extension cycle is complete, the newly synthesized target region will be attached to the same strand as the probe. Following the second cycle of denaturation and annealing, the probe and the target hybridize. The hairpin sequence then hybridizes to a part of the newly produced PCR product. This results in the separation of the detectable label from the quencher and causes emission of the signal. Other uses for molecular beacons are known in the art and would be suitable for use in the methods described herein. One or more detectable labels or quenching agents are typically attached to a primer or probe. The detectable label can emit a signal when free or when bound to the target nucleic acid. The detectable label can also emit a signal when in proximity to another detectable label. Detectable labels can also be used with quencher molecules such that the signal is only detectable when not in sufficiently close proximity to the quencher molecule. For instance, in some embodiments, the assay system can cause the detectable label to be liberated from the quenching molecule. Any of several detectable labels can be used to label the primers and probes used in the methods described herein. As mentioned above, in some embodiments the detectable label can be attached to a probe, which can be incorporated into a primer, or may otherwise bind to amplified target nucleic acid (e.g., a detectable nucleic acid binding agent such as an intercalating or non-intercalating dye). When using more than one detectable label, each should differ in their spectral properties such that the labels can be distinguished from each other, or such that together the detectable labels emit a signal that is not emitted by either detectable label alone. Exemplary detectable labels include, for instance, a fluorescent dye or fluorphore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), “acceptor dyes” capable of quenching a fluorescent signal from a fluorescent donor dye, and the like. Suitable detectable labels may include, for example, fluorosceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-HAT (Hydroxy Tryptamine); 6-HAT; 6-JOE; 6-carboxyfluorescein (6-FAM); FITC); Alexa fluors (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492/515, 493/503, 500/510, 505/515, 530/550, 542/563, 558/568, 564/570, 576/589, 581/591, 630/650-X, 650/665-X, 665/676, FL, FL ATP, FI-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), coumarins (e.g., 7-amino-4-methylcoumarin, AMC, AMCA, AMCA-S, AMCA-X, ABQ, CPM methylcoumarin, coumarin phalloidin, hydroxycoumarin, CMFDA, methoxycoumarin), calcein, calcein AM, calcein blue, calcium dyes (e.g., calcium crimson, calcium green, calcium orange, calcofluor white), Cascade Blue, Cascade Yellow; Cy™ dyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP Fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent protein (e.g., GFP. EGFP), blue fluorescent protein (e.g., BFP, EBFP, EBFP2, Azurite, mKalama1), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet), yellow fluorescent protein (e.g., YFP, Citrine, Venus, YPet), FRET donor/acceptor pairs (e.g., fluorescein/tetramethylrhodamine, IAEDANS/fluorescein, EDANS/dabcyl, fluorescein/fluorescein, BODIPY FL/BODIPY FL, Fluorescein/QSY7 and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND-22, LysoTracker Blue-White DPX, LysoTracker Yellow HCK-123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND-167, LysoSensor Green DND-189, LysoSensor Green DND-153, LysoSensor Yellow/Blue DND-160, LysoSensor Yellow/Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); rhodamines (e.g., 110, 123, B, B 200, BB, BG, B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, Red, Rhod-2,5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, Tetramethylrhodamine (TRITC), WT), Texas Red, Texas Red-X, VIC and other labels described in, e.g., US Pub. No. 2009/0197254), among others as would be known to those of skill in the art. The amplified target nucleic acid can also be detected using a detectable nucleic acid binding agent (see, e.g., Table 1) which can be, for example, an intercalating agent or a non-intercalating agent. As used herein, an intercalating agent is an agent or moiety capable of non-covalent insertion between stacked base pairs of a double-stranded nucleic acid molecule. A non-intercalating agent is one that does not insert into the double-stranded nucleic acid molecule. The nucleic acid binding agent can produce a detectable signal directly or indirectly. The signal can be detectable directly using, for example, fluorescence or absorbance, or indirectly using, for example, any moiety or ligand that is detectably affected by its proximity to double-stranded nucleic acid is suitable, for example a substituted label moiety or binding ligand attached to the nucleic acid binding agent. It is typically necessary for the nucleic acid binding agent to produce a detectable signal when bound to a double-stranded nucleic acid that is distinguishable from the signal produced when that same agent is in solution or bound to a single-stranded nucleic acid. For example, intercalating agents, such as ethidium bromide and SYBR dyes, fluoresce more intensely when intercalated into double-stranded DNA than when bound to single-stranded DNA, RNA, or in solution (see, e.g., U.S. Pat. Nos. 5,994,056; 6,171,785; and 6,814,934). Similarly, actinomycin D fluoresces red when bound to single-stranded nucleic acids, and green when bound to double-stranded nucleic acids. And in another example, the photoreactive psoralen 4-aminomethyle-4-5′,8-trimethylpsoralen (AMT) has been reported to exhibit decreased absorption at long wavelengths and fluorescence upon intercalation into double-stranded DNA (Johnston et al. Photochem. Photobiol. 33:785-791 (1981). For example, U.S. Pat. No. 4,257,774 describes the direct binding of fluorescent intercalators to DNA (e.g., ethidium salts, daunomycin, mepacrine and acridine orange, 4′,6-diamidino-α-phenylindole). Non-intercalating agents (e.g., minor groove binders such as Hoechst 33258, distamycin, netropsin) may also be suitable for use. For example, Hoechst 33258 (Searle, et al. Nucleic Acids Res. 18:3753-3762 (1990)) exhibits altered fluorescence with an increasing amount of target. Exemplary detectable DNA binding agents may include, for example, acridine derivatives (e.g., acridine homodimer, acridine orange, acridine yellow, 9-amino-6-chloro-2-methoxyacridine (ACMA), proflavin), actinomycins (e.g., actinomycin D (Jain, et al. J. Mol. Biol. 68:1-10 (1972), 7-amino-actinomycin D (7-AAD)), anthramycin, auramine, azure B, BOBO™-1, BOBO™-3, BO-PRO™-1, BO-PRO™-3, chromomycin (e.g., A3), crystal violet, cyanine dyes, DAPI (Kapuściński, et al. Nucleic Acids Res. 6:3519-3534 (1979)), 4′,6-diamidino-2-phenylindole (DAPI), daunomycin, distamycin (e.g., distamycin D), dyes described in U.S. Pat. No. 7,387,887, ellipticine, ethidium salts (e.g., ethidium bromide, ethidium homdimer-1, ethidium homdimer-2, dihydroethidium (also known as hydroethidine), ethidium monoazide), fluorcoumanin, fluorescent intercalators as described in U.S. Pat. No. 4,257,774, GelStar®(Cambrex Bio Science Rockland Inc., Rockland, Me.), hexidium iodide, Hoechst 33258 (Searle, et al., (supra)), Hoechst 33342, Hoechst 34580, homidium, hydroxystilbamidine, JO-JO-1, JO-PRO™-1, LDS 751, LOLO-1, LO-PRO™-1, malachite green, mepacrine (e.g., orange), mithramycin, netropsin, the Nissl substance, 4′,6-diamidino-α-phenylindole, proflavine, POPO™-1, POPO™-3, PO-PRO™-1, propidium iodide, ruthenium polypyridyls, Sevron dyes (e.g., Brilliant Red 2B, Brilliant Red 4G, Brilliant Red B, Orange, Yellow L), SYBR 101, SYBR 102, SYBER 103, SYBR® Gold, SYBR® Green I (U.S. Pat. Nos. 5,436,134 and 5,658,751), SYBR® Green II, SYTOX® Blue, SYTOX® Green, SYTOX® Orange, SYTO® 1, SYTO® 11, SYTO® 13, SYTO® 14, SYTO® 15, SYTO® 16, SYTO® 17, SYTO® 18, SYTO® 20, SYTO® 21, SYTO® 22, SYTO® 23, SYTO® 24, SYTO® 25, SYTO® 40, SYTO® 43, SYTO® 44, SYTO® 45, SYTO® 59, SYTO® 60, SYTO® 61, SYTO® 62, SYTO® 63, SYTO® 64, SYTO® 80, SYTO® 81, SYTO® 82, SYTO® 83, SYTO® 84, SYTO® 85, thiazole orange (Aldrich Chemical Co., Milwaukee, Wis.), TO-PRO-1, TO-PRO-3, TO-PRO-5, TOTO-1, TOTO-2, TOTO™-3, YO-PRO®-1, YO-PRO®-3, YOYO-1, and YOYO®-3 (Molecular Probes, Inc., Eugene, Oreg.), among others. SYBR® Green I (see, e.g., U.S. Pat. Nos. 5,436,134; 5,658,751; and/or 6,569,927), for example, has been used to monitor a PCR reaction by amplifying the target sequence in the presence of the dye, exciting the biological sample with light at a wavelength absorbed by the dye and detecting the emission therefrom; and, determining a melting profile of the amplified target sequence. The presence of amplified products and, therefore, the target sequence in the sample, can thereafter be determined by, for example, performing a melting curve analysis (i.e., non-linear least squares regression of the sum of multiple gaussians). It is to be understood that the use of the SYBR® Green dye is presented as an example and that many such dyes may be used in the methods described herein. Other nucleic acid binding agents can also be suitable as would be understood by one of skill in the art. The nature of the test and control amplified products can vary depending on the type of assay system that is utilized. For example, the product of PCR amplification of DNA is typically referred to as an “amplicon”. In contrast, the Ligation Chain Reaction product is instead referred to as “LCR product” or “ligation product”. In PCR, primers are utilized but in other methods, such as LCR ligation probes, can be utilized. It is known that both PCR and LCR functions through exponential amplification or linear amplification. It is important to note, however, that regardless of the kind of method used to perform amplification or detection of target loci, any target loci should exhibit similar “amplification efficiency” to one another (e.g., within about 10 percent). This means that within a particular reaction, the target loci being compared should amplify to approximately the same extent (e.g., within about 10 percent) under similar reaction conditions. It is understood in the art that amplification efficiency may be affected by, for example, sample quality (e.g., purity, presence of reaction inhibitors, and the like) or sequence (e.g., G/C content, mismatches, and the like). As used herein, amplification efficiency refers to any product that may be quantified to determine copy number (e.g., a PCR amplicon, an LCR ligation product, or similar product). Variations in amplification due to factors other than copy number may thereby be limited. For example, when using PCR, it may be optimal to amplify amplicons of a similar size (e.g., within about ten percent of the length of any other amplicon) and amplify with similar amplification efficiency (e.g., within about ten percent of one another). PCR-related amplification efficiencies can be tested as described by Livak, et al. (supra), or as is otherwise known in the art. Briefly, Livak, et al. teach that, as the ΔC T varies with template dilution, amplifications can be performed over a particular range (e.g., a 100-fold range) and the ΔC T calculated at each point. A log of dilution versus ΔC T is made and if the absolute value of the slope is close to zero, the efficiencies are similar. For PCR-based assays, the resultant amplicons are typically about 70 to 125 nucleotides in length, and can be less than or equal to about 110 nucleotides in length. The amplification efficiency is typically controlled by amplifying amplicons of similar G/C content, length, or melting temperature. The primers used in the test and control assays are also typically of similar character (e.g., G/C content, length, melting temperature). Variations of these parameters can also be used, as would be understood by the skilled artisan. The methods described herein typically require a target locus to be present on the one or more chromosomes being studied (exceptions include, for example, the absence of a target locus such as when the Y chromosome is assayed in a normal (i.e., XX) female sample). Pre-existing bioinformatics algorithms can be used to generate “qualified” pre-characterized genome targets and to design assays against those targets. Qualified genome targets may include, for example, genes, exons, introns, intergenic regions, junctions thereof, evolutionarily conserved regions (“cold” spots not prone to change), or other regions within the genome. In certain embodiments, multiple target loci can be interrogated on a chromosome. This can be used to control for unanticipated abnormalities in regions containing target loci. It is possible that such regions can include a duplication, deletion, or other abnormality that may result in an inaccurate karyotype determination. By targeting multiple target loci of a chromosome, the user can control for such unanticipated abnormalities. Thus, in certain embodiments, one, more than one, at least two, or two or more loci are targeted from at least one chromosome or arm thereof, but optionally include more than one arm, to be interrogated. In certain embodiments, three, four, five, six, seven, eight, nine, 10 or more loci may be interrogated. In one embodiment, four loci are interrogated on each chromosome. In some embodiments, it may also be important to separate the target loci by a particular approximate number of nucleotides which can, in some embodiments, be calculated as is known in the art to further insure against interrogating a CNVR. It may also be beneficial to separate each target loci from any other target loci by approximately the same number of nucleotides (e.g., along the arm of a chromosome). Many suitable targets exist on each chromosome. Exemplary targets (which can serve as qualified targets) and their corresponding PCR primers that can be used to interrogate human chromosomes are shown in Table 3. The probes that can be used in combination with particular primers or primer pairs, and the sequences amplified using particular primer pairs are shown in Table 4. One or more of such target loci can be amplified from a biological sample (e.g., gDNA). It should be understood that non-CNVR targets and corresponding probes or primers other than those listed in Tables 3 and 4 can be used in the methods disclosed herein. It is noted that chromosomes of other organisms may be similarly interrogated but that different target loci are used. TABLE 3Exemplary Targets and PCR PrimersSEQSEQChromosomeGeneIDIDlocationCytobandSymbolForward PrimerNOReverse PrimerNO1: 36669968-1p34.3C1orf102CCAGGGCTGCCTAT1GCTGATCCGGCAGAC236670038TGACTTACT1: 19882469-1p36.13TMCO4CCCACGGCCTTCAG3GGGCTCTGCACACCC419882569GATA1: 176197341-1q25.2SEC16BAACCCACCAGCCTG5TGAGCTCAGTCAGTA6176197427AACTGCATCAGAGAT1: 203386468-1q32.1DSTYKCACAATGCTGCCTG7TGCTTTGTTGGCAGC8203386559ACATCATTGGATA2: 51062327-2p16.3NRXN1TGACAGCTTTTGGC9CCTGTCACTGGGAGG1051062418TCAGAAATTAGAAAATCCATA2: 27426789-2p23.3GTF3C2CACGATGAGGGTTG11GATTCTTGAGCCAGC1227426880AGGGAAAAAGCTGTA2: 141646278-2q22.1LRP1BGCCAGGATGCTCCA13AAGGATTATTCTGAC14141646366TGTAGTAGGTTCATGTTGT2: 166773406-2q24.3SCN9AAGGTGAAAAAAGTA15TTGATCAAAGCTTAT16166773515CTTATGAGGATGATGGCTCTATCAACTGAAT3: 71541265-3p14.1FOXP1AAACAGGAGAATGA17CCATAGACAGATTAG1871541358ATGAATGAATATGCCCTGCTTCTTT3: 51489723-3p21.2VPRBPGCCATCCTCCTTTT19TGGGTTTGGTGCCTC2051489813TCTCATCCTACA3: 98908486-3q11.2EPHA6TGGCATGTGAGATG21AAAGGGTACCACTAG2298908579TGTTCAAGAAAAGAGGCA3: 142551967-3q23ZBTB38TCCCTCAAGTTTAT23AGAGCAAGACGTCCA24142552067TCAGTCTCCTTATGAATTGAAGTAT4: 46733909-4p12GABRB1CATTTCCAAGTACA25CCTCAGTGGTGCAAA2646734018GTAACTCCACAGTAAACAGTT4: 6931464-4p16.1KIAA0232CCCAAGCACCTGTA27CCTCAAACATCTGCC286931545GCATCATCTTCATGTGT4: 100651173-4q23C4orf17GGAATGTTACCACG29CAGCTGTCTTCATCC30100651274TTGCTAAGCAGTTTCTCA4: 146906234-4q31.22ZNF827TTTCTGGGAGCCAT31CAGCGAATCAAATAG32146906321CTGAATCATCCCCCTCTT5: 26772993-5p14.1LOC100131678GGTATGACCTGGAC33AGGAGGGAGATAAAA3426773084ACATTAAGCAATAATGAGAAATGTAAGC5: 13791807-5p15.2DNAH5GCAAGCCACAGGAA35TGTACAATTTGACTT3613791884GAGGAAGGTGCCAGAA5: 108773400-5q21.3PJA2GCGGAACAAGCCAG37GAGGTTCGAGCGCTG38108773485ACTGAATTCT5: 122258322-5q23.2SNX24GTTTTAGAAGGAAG39AGAATGTGCAGTCAA40122258422AGGGCTAGGAACACTCAGAA6: 12970453-6p24.1PHACTR1GTATAGGCAGCGAC41AGATCTCCACAGGAC4212970529AGCACTTTCACCAA6: 3672898-6p25.2C6orf145GAAAACCAAAGCAA43GGGAGATGGGAGTAA443672977CAAGGTGAGTGTTCCAAAC6: 74590195-6q13CD109GGGTTGCAGGGATG45TGCATTCATTCTGAT4674590286GTGTACTTCCACACA6: 112680120-6q21LAMA4GGGATCTGTAACTT47GCAGCACAGCAAAGT48112680214GACCAAGGTGTTTCAG7: 47936016-7p12.3PKD1L1GATGGTATCTCCCA49CAATTTGCAGCACAA5047936124CAAGTCACTACGGAGCTA7: 40801751-7p14.1C7orf10CTGTCTGATTGTTA51GTCACAACTTGTTCT5240801837AGAGGGCTTGTTGGGAGTTTG7: 99515052-7q22.1ZNF3GATAGATGGCCTGG53GCCTTCTAGGGACTG5499515140CAGTAAGAACACTTCAA7: 134591172-7q33STRA8TGAACCTTTGACAC55TGACAGCAAATATTA56134591254CTTCCCAAACCGAAGGTGAT8: 12902405-8p22C8orf79GATCTCCTCTTCTG57TGTGATGACAAAAAC5812902494TGCCTACATCATAAATGAGACTGAGT8: 10106677-8p23.1MSRAGTTCTCTCTGGCCG59CACTTCTGCAGAGGC6010106775TCAATATCTTTGGAA8: 61648551-8q12.1RAB2AGGGACCTGGGTTTC61ACCCAGAGTCGAGTG6261648656CTGATACTGACAAT8: 75439579-8q21.11GDAP1TGGAGAGAACCCCA63CTAAAGCAATGTGTG6475439660GGCTTTATTGATTCATAAGCA9: 26949592-9p21.2IFT74AGATGGGATCAAGG65GGGCACATAAACTTC6626949694GTAAATCAGAGTTCTACATCCA9: 408149-9p24.3DOCK8TGGCCATAGCAGGG67ACCAGACACATGTGC68408232AATAATTTCAACCAA9: 78498063-9q21.13PRUNE2GGATGGGCAATTTT69ATCTCTTAAGCACCT7078498161AGGTAATCTCCAAACCCTGGT9: 100023301-9q22.33TBC1D2CCAGTGCCTTGTGC71CCTCCCTGAGCTCAC72100023371AGGATAAGATT10: 17011452-10p13CUBNAAATAGAATATGAG73TCAAGTTGTAGTCAG7417011533ACATGAGTAAATATTGCCACAAAGCCCTTTT10: 5401127-10p15.1UCN3CAAAAGCTACAAGC75ACACATATGTACAGA765401221CAGAGATACGAGAGACCAGGAA10: 63195641-10q21.2C10orf107AAGACAATGTGCAG77GGCCTCTTCCTGTAT7863195741CAAAAGATAGCTTGCAGTTT10: 121323685-10826.11LOC100133264CAAATTTTACCCAC79GCTTAAGTTGTATGT80121323788TIAL1ACAGCCTGAAAGTGCAGAGTT11: 46730822-11p11.2CKAP5AAAACAAGTAGGGC81TGCCCTTTCAACTGC8246730911ACTGGAAGAATGATTCTAAT11: 6200897-11p15.4FAM160A2CATTGCAGAACTCC83CTGTCTGCGACGGGA846200970AGGGAACTAGA11: 62241048-11q12.3HNRNPUL2CCCCGGCTTCGGTT85AGTACAAGGAGGAGG8662241147CTCAAGGAA11: 130999952-11q25NTMGGAATCCAGGAGGT87CAGCCAACTAAACTG88131000023GGTGATGTATGCTCTGT12: 27346341-12p11.23STK38LAAGAAATTAGAAGT89GGGTGCTTTTGTACA9027346426GGCCATGGAAGAGTAATTATAGGT12: 16036914-12p12.3DERACAGGTCAATCTACT91CCGCTACTGAAAGAT9216037009GCTAAGGGATTAAAGCCACTT12: 42605583-12q12TMEM117AGGCTGGTGGAGGC93GAAACCCTGGGAAAC9442605676TAGTCATACCAT12: 92044805-12q22LOC643339CTTGGGATGTTTTA95GGGAAGGGACCTGAG9692044882TAAGTGTCTGTCTGGATAGGT13: 19660225-13q12.11GJB2TTGACATGAGGCCA97GCACCTAACAACATT9819660311TTTGCTATCAGTAGCCTCAA13: 38442357-13q13.3STOML3AGATCTGGGACAAG99GCTAATGTCAACGAT10038442447GTCTGTGTGTCCATCAAG13: 95040142-13q32.1DZIP1ACTTCTCCAGTTGA101GGTAATGGAGACTCA10295040222AAGGGTATCCATGAATGACACT13: 114069879-13q34UPF3AGCCTAGAATATCCT103TGCTTCCAGTCTTGG104114069968GCAGTGGTAGACATCTTTT14: 24173173-14q12GZMBGGAGGAAGGCCAGC105ACAACAGCAGCTCCA10624173244AGAAGACCA14: 34648789-14q13.2PPP2R3CCAGCCTTTTCACCA107ACCAGACACCACCTA10834648863ACCTTCAAATGATTGGA14: 72506044-14q24.2ZFYVE1GATAGGCGCACCAG109CAGTGGCCAAACACG11072506141GAATGAAATTAAAGT14: 104621601-14q32.33CATCCACTCACCAC111GGCATGAGGCTTGGA112104621710TGTATCCAAGCA15: 33605950-15q14ATPBD4GAGCACCCACTGTG113ACACCAGCAGAATTA11433606033TACGATGCCATACTT15: 43667323-15q21.1PLDNGGGATGGATTTACC115AGCTGACCAAGCATT11643667413AGAAAGATGATCAGTCATGAGT15: 77533137-15q25.1KIAA1024ACTCAGGCTTACCA117TGCATGGCAAAGGAA11877533242TATTTGTTTGTACTATCCCAT15: 86971227-15q26.1AENAGGTGATAAATAGC119CCATACCTGAACGTG12086971330TTACATTTTAGAGTATGCCATTGCT16: 31240261-16p11.2ITGAMTGATGGTTTTCTGG121CCACTTCCCTGGGAT12231240341TGTCCCTTTAGTGAACT16: 4814659-16p13.3N-PACGCCCAAGAGCCTGA123CCGGGCCATCGATGA1244814737GTTCTAGAG16: 56871110-16q21CCDC113CCATCGTAAGGCTT125GGCTACTTCCCAGCA12656871184GGAATCGAAAGGTAAT16: 85328817-16q24.1LOC729979GGTCCAGCCCTTCT127ACCAGCACTCACCGC12885328925CAACACTAAA17: 8680592-17p13.1PIK3R6TCCTGGTAGGGATA129GTCTGGTTTGCAGGG1308680671CAGCTCATTACACT17: 854262-17p13.3ABRGGCAGCCGATGGTC131GGCCTTGGGCAGAAC132854342AGTAAGTAAATA17: 45884445-17q21.33ACSF2CCCTCTGCTGGCAC133GCCCAGGTGGGACTG13445884521CTTTAAGAGA17: 77723894-17q25.3CCDC57GCTTAGAGCCTCCA135AGACTTTCCATCCAG13677723990TTTCTTTCCTTGAGATCCA18: 13731517-18p11.21RNMTGATTGACAAATTTC137TCAGCCTGCTCATAA13813731609GTGACCCACAAGACTCAAATG18: 201348-18p11.32USP14TCCAGAGCTTTAGA139GTGGTCTGCTTCTGT140201426GGAAGACACATCCTCTTTT18: 57674840-18q21.33RNF152TGCTGTCCTTACTC141GCCTAAGTTTGCAGA14257674938ATTCCACATCCCCTCAA18: 74964920-18q23ATP9BGTGGTCCATATGGT143AAAGGGACTCTTCCG14474964997CCCTTCTTAAAGTTCTTG19: 17313717-19p13.11GTPBP3CCGTTCGACCCTTG145ACTACGAAACAAATA14617313790ATGCTTACTGAGATCCTCCT19: 14507730-19p13.12GPSN2GGTGACTCACTGGG147GAGTGCCTACAGCAA14814507818CAGATTCAGAAATGG19: 47551898-19q13.2MEGF8GCTCTGCCGATGTC149CAGTGTGGGCATTGC15047551977CTCAAGTTC19: 62959915-19q13.43ZNF776CAGTACTGGTGAGG151TCCAGGCTTATAACG15262960014GAAATCTGTTTAGGACACTA20: 13418983-20p12.1TASP1CCACTTCCCTCAAT153GGGTTTTGCCAACTT15413419079CATGTGACATTTCTGGATT20: 2311101-20p13TGM6GTGCGAAGGTTAGT155GAGAGGAACCCAGCA1562311185TTCTGAGGAAAGTTAGTT20: 34441093-20q11.23DLGAP4CCCATGGGAGATGC157GGTCTCCTGGTTCCA15834441175TCTTGATCTCTTC20: 42805126-20q13.12LOC100128040GCCCTGTCCCTGCT159AGGTGCCCCTTAGCC16042805219TCTGAGTA21: 27228739-21q21.3ADAMTS5CAGGCAGCTTCTTG161GTGTCCCGGCATGGA16227228824GTCAGATGT21: 32606313-21q22.11MRAPAGCATCCTATGCCT163CAGTAAGCAAGCAGG16432606415TTGACAAAGACTAGGT21: 32989371-21q22.11SYNJ1GTTCTGATTTCTAC165GGAATCAGTCTTTGC16632989464TCCTCCACACAATTTGCATCT21: 38009196-21q22.13KCNJ6CTGATGTGTCTTGG167CCATGGATCAGGACG16838009283CAGGTCATTCGAAAG22: 15964337-22q11.1IL17RACCTTACCCATCCCA169GTAGAGTGAGTGTGA17015964432ACTAGCCTTACGTTGGAT22: 29154514-22q12.2MTP18CCTCCTGATCATAC171CACATTCCCTGGCAG17229154594TCTGGTACCTGAGTAG22: 34452693-22q12.3APOL5CACATGAGGCTTTC173CCTTGATGCCCTGGA17434452785GGAGGAATAATAGCTTTTAC22: 48978363-22q13.33TRABDCCATCCCTCTCCAC175GTCTGGGAACTCGCC17648978457AGCAAAATCATX: 50512491-Xp11.22SHROOM4GGAAATTGTCAGGT177CCCATTTCATGTCCT17850512567CAGCTCAGTCTCAGAAGAAX: 24141606-Xp22.11ZFXTGCTTTAGGCAGGT179GGGCCAAGAAGGTAC18024141705GTGAACTAGGAATTTX: 109581619-Xq22.3RGAG1CCCCATGGTCAACA181CATCACCCCAGAGGC182109581695CAAAATGTAGTGTTX: 123351536-Xq25ODZ1GGTCAGAAAGTTAC183CCAGTGTCTGCAGTG184123351615CAGGACTTGTGACAAAAY: 7271634-Yp11.2PRKYGTGATCTGAATGAT185ACACGGATAGCCAGA1867271743GTTGAACAAGCACAATGAAATACY: 5423177-Yp11.2PCDH11YTCCTGCAAAATGAC187ACATGTCAGGCCTTT1885423278TTGAGTTGGTATTATTTTGTAGCY: 20211350-Yq11.222CYorf15ACTTCCAGGGAAATT189GTTTCCCTGTTGAGA19020211455CACCTCTTCTATGTTTCCATY: 21330672-Yq11.223RPS4Y2GAAAGGGAAGAGCA191GGCCTCAAAGTCCCA19221330747CACAGTCTCACAA TABLE 4Exemplary Amplified SequencesPrimerPairProbeAmplifiedAmpliconChromosomeGeneSEQ IDProbeSEQ IDSequenceSEQ IDlocationCytobandSymbolNO)SequenceNO(amplicon)NO1: 36669968-1p34.3C1orf1021/2TCTTCCAA193CCAGGGCTG28936670038GACCTGCACCTATTGACCATCCGTTACTCGGATGTGCAGGTCTTGGAAGAAGATGAGGAGTGTCTGCCGGATCAGC1: 19882469-1p36.13TMCO43/4CAGGAGAC194CCCACGGCC29019882569AGTGAGTGTTCAGGATGAGCACCGCATCCATCTGCTTGGCATAGTCCAGGTGGCCGCTGACCTGCAGGAGACAGTGAGTGAGCACCACCGTGGGTGTGCAGAGCCC1: 176197341-1q25.2SEC16B5/6CCCCAGCT195AACCCACCA291176197427TCAGCAGCGCCTGAACTTTGGGACTCCAAGCTGCTGAAGCTGGGGGATCATCCCGCTCCGGGGCATCTCTGATGTACTGACTGAGCTCA1: 203386468-1q32.1DSTYK7/8CCGTGCCA196CACAATGCT292203386559AGATCACTGCCTGACATGACTTACATGGCCTCTGGCTTGCAGAATCCTAAGTCAGTGATCTTGGCACGGTTCTGCTTATCCAGCTGCCAACAAAGCA2: 51062327-2p16.3NRXN19/10AACCACCA197TGACAGCTT29351062418ACAAAGGGTTGGCTCAGATTCTAAATTAGAAAATGAAATGATAACCACCAACAAAGGGATTCTGCAGCTGAGTATGGATTTCCTCCCAGTGACAGG2: 27426789-2p23.3GTF3C211/12ACCTTCCC198CACGATGAG29427426880AGTTTGATGGTTGAGGGAAGCACAAAAACAGTTGGTAGGAACAAGTGCTTATCAAACTGGGAAGGTGCTCTTATTTACAGCTGCTGGCTCAAGAATC2: 141646278-2q22.1LRP1B13/14CTGGCCTG199GCCAGGATG295141646366TGTGTACTCTCCATGTATCTGTATTGCATTATAACATGGTCTCAGCTGGCCTGTGTGTACTTCTACAACATGAACCGTCAGAATAATCCTT2: 166773406-2q24.3SCN9A15/16ACCCATGC200AGGTGAAAA296166773515CTCTTTCTAAGTACTTAAATAACTGAGGATGATGAATAGTTGGAAAAACTAGTAAAATAGGGTTGGTTATTAGAAAGAGGCATGGGTAGTTGATAGAGCCATAAGCTTTGATCAA3: 71541265-3p14.1FOXP117/18CCTGCCTA201AAACAGGAG29771541358CCAAAGAGAATGAATGAGATACAATGAATATGCTAATACAACCACCTCTGTATCCTCTTTGGTAGGCAGGAGGCAAGAAGCAGGCTAATCTGTCTATGG3: 51489723-3p21.2VPRBP19/20TCCCAGCC202GCCATCCTC29851489813CACTGTAACTTTTTCTCATGATCCTGTGGGGCTACTTATGATGTGATGCCATTTACAGTGGGCTGGGATTACAGGTGTGAGGCACCAAACCCA3: 98908486-3q11.2EPHA621/22AATGCCAC203TGGCATGTG29998908579CAGTGACCAGATGTGTTTTCAGCAAGAAACTCAAGACTAAGGGAATGAATGAATGAATGCCACCAGTGACCTTCAGTGCCTCTCTAGTGGTACCCTTT3: 142551967-3q23ZBTB3823/24TCTTCTTT204TCCCTCAAG300142552067GCTCCTGATTTATTCAGGACCTCTCTCCTTATGTAATCAGTAATTCTATCAAATCCTCTTCTTTGCTCCTGAGACCTCACCTACTTCAATTTGGACGTCTTGCTCT4: 46733909-4p12GABRB125/26ATAGGTGT205CATTTCCAA30146734018CACTGTAAGTACAGTAAAGCAACCTCCACAGTACTATCCTGTTGCTTTACAGGGACACCTATGCCTTTTTTATTCAGAATAAAGAACATTGCAAACTGTTTTTGCACCACTGAGG4: 6931464-4p16.1KIAA023227/28TCCTGCTG206CCCAAGCAC3026931545CCCACTGACTGTAGCATCCTGCATCGTCCACGTCCTGCTGCCCACTGACCTGTCCGGCTCCACACATGAAGGCAGATGTTTGAGG4: 100651173-4q23C4orf1729/30CCACACAG207GGAATGTTA303100651274GCTCCTTGCCACGTTGCGAGTAATAAGCTATGTAACATATCTTAACAACCAGGGAGCCACACAGGCTCCTTGGAGTAAGAGTGTGAGAAACTGGATGAAGACAGCTG4: 146906234-4q31.22ZNF82731/32TTGCTGTT208TTTCTGGGA304146906321GGCTGAATGCCATCTGACACTATCATCTTTGCTGTTGGCTGAATCACTCAGAGCTGAGAGGGAGGATGAAGAGGGGCTATTTGATTCGCTG5: 26772993-5p14.1LOC10013167833/34AATGGAGA209GGTATGACC30526773084AGGGAAAATGGACACATTTACTAAGCATTCGTAATTTTCCCTTCTCCATTACTAGATACAGTGCTTACATTTCTCATTATTTTTATCTCCCTCCT5: 13791807-5p15.2DNAH535/36CAGGGAGA210GCAAGCCAC30613791884CAAAACAGAGGAAGAGGAAATATAAGCCCAAAGGCAGGGAGACAAAACAGAAATATGCTTCTGGCACCAAGTCAAATTGTACA5: 108773400-5q21.3PJA237/38CCGGAGCC211GCGGAACAA307108773485GCTGCACAGCCAGACTGTAAAAAAAAAAAAAAAAACCCTCACCGAAATGTGCAGCGGCTCCGGAGCGAGAACAGCGCTCGAACCTC5: 122258322-5q23.2SNX2439/40CTAGGTAC212GTTTTAGAA308122258422TGCGCCACGGAAGAGGGTTTTCTAGGAAGAAAAGTGGCGCAGTACCTAGTAGGTAAGTATAATCTGGATGCTCCCAGTAATTCTGAGTGTTGACTGCACATTCT6: 12970453-6p24.1PHACTR141/42ATGCAACT213GTATAGGCA30912970529CATGCTGAGCGACAGCAATTTACTTGTAAATTCAGCATGAGTTGCATGGTTGGCCAATGTTGGTGAGTCCTGTGGAGATCT6: 3672898-6p25.2C6orf14543/44CCTCAAGC214GAAAACCAA3103672977TCCGACCCAGCAACAAGCTCCTGTGAGTCCTCAGGAGGGGTCGGAGCTTGAGGTTTTGGAGTTTGGAACTTACTCCCATCTCCC6: 74590195-6q13CD10945/46CATGTATA215GGGTTGCAG31174590286GCTGCATAGGATGGTGTGATTTCACAACAGGTCCTAGCATGTATAGCTGCATAGATTTCTTCACCTGATCTTTGTGTGGAAGATCAGAATGAATGCA6: 112680120-6q21LAMA447/48CAGTCTGA216GGGATCTGT312112680214TGGTCCCAAACTTGACCAGTTGAAAGGTCAAAGAGCTTGAAATTTCAACTTGGGACCATCAGACTGAAAACCTGCAATCTGAAACACTTTGCTGTGCTGC7: 47936016-7p12.3PKD1L149/50CCACCCTT217GATGGTATC31347936124TCTACATTTCCCACAAGTCTCCTCACTACTTCCTGTGTTTTTGCGAAAAGCTCCCCGTGAGGGTGGGTGCCACCCTTTCTACATTTCTCCCTAGCTCCTTGTGCTGCAAATTG7: 40801751-7p14.1C7orf1051/52TCCTTGCC218CTGTCTGAT31440801837AACTAGAATGTTAAGAGACTATGGGCTTGTATTCTCTTGAAAATCATAGTTTCTAGTTGGCAAGGAGCAAACTCCCAAGAACAAGTTGTGAC7: 99515052-7q22.1ZNF353/54AAAGAATC219GATAGATGG31599515140AGGCAGGTCCTGGCAGTAAAGCTAAGAACAAGACACGGAAAGCTTTACCTGCCTGATTCTTTCCTTCCTTCTTTGAAGTCAGTCCCTAGAAGGC7: 134591172-7q33STRA855/56ACGCTGGG220TGAACCTTT316134591254CTATTTCAGACACCTTCTCATCTCCAAAACGCTGGGCTATTTCATCATCTTCTACAGTCTTCATCACCTTCGGTAATATTTGCTGTCA8: 12902405-8p22C8orf7957/58CTTCCCCC221GATCTCCTC31712902494AGCAAAGTTTCTGTGCCTAGTTGTACATCAACTTCCCCCAGCAAAGTTAGTTGTATCTTTGTCTACTCAGTCTCATTTATGTTTTTGTCATCACA8: 10106677-8p23.1MSRA59/60CCACGGTC222GTTCTCTCT31810106775CACTCTGTGGCCGTCAACCACGTTATCTTAATGAAAGTGACATTCCGTTGGCCACGGTCCACTCTGTCCACGTGGAGGGCCGGGTTCCAGCCTCTGCAGAAGTG8: 61648551-8q12.1RAB2A61/62ACAAGGCA223GGGACCTGG31961648656AGACAGAGGTTTCCTGAATGTACTACTTCCTATGTGTCACAGTTTTCCCTTAAATGATAACCGTACATCTCTGTCTTGCCTTGTCCTTGAATTGTCCACTCGACTCTGGGT8: 75439579-8q21.11GDAP163/64CTTTGACC224TGGAGAGAA32075439660TCAGTGTTCCCCAGGCTAATTTTTTATATGTATACTTTGACCTCAGTGTTAATTTTAAATGCTTATGAATCACACACATTGCTTTAG9: 26949592-9p21.2IFT7465/66CTCCAGTC225AGATGGGAT32126949694TCAACAGCCAAGGGTAACATTCCATCAGAGTAAGATTGATCTTGAATGAGAGAAGGAATGGCTGTTGAGACTGGAGGGCAGGATGGATGTAGAGAAGTTTATGTGCCC9: 408149-9p24.3DOCK867/68CCAAGGAA226TGGCCATAG322408232GACAGCACCAGGGAATATATTCATTTCAATTTGAAAACAAGTGGAATAGTGCTGTCTTCCTTGGTNTGTTGGTGCACATGTGTCTGGT9: 78498063-9q21.13PRUNE269/70CTGCTGAG227GGATGGGCA32378498161TAATTCACATTTTAGGTTTTCCCAATCTCCAATTGACCTAACTCTAATGGAATGGGAAAGTGAATTACTCAGCAGATGACCACCAGGGTAGGTGCTTAAGAGAT9: 100023301-9q22.33TBC1D271/72CCTGCCCA228CCAGTGCCT324100023371GGAGCTAGTGTGCAGGATGTCTTCACTAGCTCCTGGGCAGGGAGAGGGAAGAATCTTGTGAGCTCAGGGAGG10: 17011452-10p13CUBN73/74ACAACCAG229AAATAGAAT32517011533CCACATGGATGAGACATATTCGAGTAAATATGCCCTTTTATACAACCAGCCACATGGATTCTTTGTGGCACTGACTACAACTTGA10: 5401127-10p15.1UCN375/76CTGAGCAA230CAAAAGCTA3265401221GCATTTGACAAGCCAGATCCTGCGATACGATACAACAAGGACATTGCTCTGCAGGATCAAATGCTTGCTCAGATTTCCTGGTCTCTCTGTACATATGTGT10: 63195641-10q21.2C10orf10777/78CTTCACAG231AAGACAATG32763195741ACCGAGATTGCAGCAAAAAACGAGATAGCTCCATCATAACCACGTTTTTTATGATTGTCTTCACAGACCGAGATAAACGAAAAACTGCAAATACAGGAAGAGGCC10: 121323685-10q26.11LOC10013326479/80TCGGTCTT232CAAATTTTA328121323788TIAL1CTGCATCTCCCACACAGTCCCCTGAAAAATACCTTGAAAGCAAACCTCGGTCTTCTGCATCTTCCAATTGATTCCTTTACAAACTCTGCACACATACAACTTAAGC11: 46730822-11p11.2CKAP581/82ACCCAACA233AAAACAAGT32946730911CAACAGCAAGGGCACTGTTAAGTGAAGAAAAACCCAACACAACAGCATTAAGTTTCAAACCTGCATTCCAATTAGAATCAGCAGTTGAAAGGGCA11: 6200897-11p15.4FAM160A283/84CAAGGGCT234CATTGCAGA3306200970GGCACTCCACTCCAGGGCAAACTCATGAAGAGTGCAAGGGCTGGCACTCCCAGCCAGTCTTCCCGTCGCAGACAG11: 62241048-11q12.3HNRNPUL285/86TTTCGGTT235CCCCGGCTT33162241147GTTTCGGCCGGTTCTGCGATTTGCGGTTACGCTTGTTTCGGTTGTTTCGGCGATTTGTCCGCTTCTCGGAGGGGGGCAGAAGCTTCCTTGCCTCCTCCTTGTACT11: 130999952-11q25NTM87/88ATCAGGCA236GGAATCCAG332131000023GCCAGGATGAGGTGGTGTTATGATCAGGCAGCCAGGATTTCTGTCTCCACAGAGCATACAGTTTAGTTGGCTG12: 27346341-12p11.23STK38L89/90ACCTCTTC237AAGAAATTA33327346426ATCTGCTAGAAGTGGCCATCCTTCATGGAAGAAGAAGGATTAGCAGATGAAGAGGTAATGTAATTACCTATAATTACTGTACAAAAGCACCC12: 16036914-12p12.3DERA91/92CAGCCCAG238CAGGTCAAT33416037009CAAATGCACTACTGCTACACATAGGGATTTCAGCCCAGCAAATGCACACATTAAGAATAATGCCAGAATGTAGAAAAGTGGCTTTATCTTTCAGTAGCGG12: 42605583-12q12TMEM11793/94CTGCGGGC239AGGCTGGTG33542605676TTTAGGACGAGGCTAGTTCCAGCTCCGCCACAGCTGCGGGCTTTAGGACTCCACCTCGTCAGTCATCCATGCCAATGGTATGGTTTCCCAGGGTTTC12: 92044805-12q22LOC64333995/96ACTTCCTA240CTTGGGATG33692044882TGACAGCCTTTTATAAGAATCACTGTCTGTCTGTACTTCCTATGACAGCCAATCACATCCAACCTATCCTCAGGTCCCTTCCC13: 19660225-13q12.11GJB297/98AAGCCATC241TTGACATGA33719660311ACTAGGAAGGCCATTTGCTTCTCTATCATAAGCCATCACTAGGAACTTCTAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGC13: 38442357-13q13.3STOML399/100TTGAGCCA242AGATCTGGG33838442447GCAGAAATACAAGGTCTGTTGTGTCCCTAAGACATTTCTCAGAGTGGTTTGAGCCAGCAGAAATGTTGCTTGATGGACATCGTTGACATTAGC13: 95040142-13q32.1DZIP1101/102CAGATCAG243ACTTCTCCA33995040222TGCAGTGTGTTGAAAGGTTCTCAGTATCCATTTGAGAAACACTGCACTGATCTGGAATATAGTGTCATTCATGAGTCTCCATTACC13: 114069879-13q34UPF3A103/104TTGCTCCA244GCCTAGAAT340114069968TTCCAGAAATCCTGCAGGATAGCTGGTAGAGTTTGCTCCATTCCAGAAGATAGCCAAAAAGAAGCTGAGAAAAAAAGATGCCAAGACTGGAAGCA14: 24173173-14q12GZMB105/106CTGAGAAG245GGAGGAAGG34124173244ATGCAACCCCAGCAGAAAATCCTGCAGGATTGGTTGCATCTTCTCAGGAAGGCTGCCCTGGTTGGAGCTGCTGTTGT14: 34648789-14q13.2PPP2R3C107/108AAGCGATG246CAGCCTTTT34234648863ATCAATTACACCAACCTCGAAAACTTCAAAAAGTTTTCGTAATTGATCATCGCTTCCTCTCCAATCATAGGTGGTGTCTGGT14: 72506044-14q24.2ZFYVE1109/110CCGCCATA247GATAGGCGC34372506141TACTTCCCACCAGGAATTAAAGCTGACCGCCATATACTTCCCTAAAGCTCAACCCACCCACCAGTTCAGTTAAGAATTATACTTTAATTCGTGTTTGGCCACTG14: 104621601-14q32.33111/112TCTCCTCC248CATCCACTC344104621710CTTTGTTTACCACTGTATCCCTCCATCCACCTCTCCTCCCTTTGTTTTCCCTACAAGCCCCACGTCCTGGGGGGCTGACTCCAACTGGGGGTGCTGCTTCCAAGCCTCATGCC15: 33605950-15q14ATPBD4113/114ACGTGGCT249GAGCACCCA34533606033CAGCACTGCTGTGTACGTATACAGTACACAAAGTGACCACGTGGCTCAGCACTGTATACAAATAAGTATGGCATAATTCTGCTGGTGT15: 43667323-15q21.1PLDN115/116ACGTCACC250GGGATGGAT34643667413TCTCTGAATTACCAGAATTATAGATGATCAGCTTATAATTCAGAGAGGTGACGTATCCTATAATATTGACCACTCATGAAATGCTTGGTCAGCT15: 77533137-15q25.1KIAA1024117/118CTGGGCCT251ACTCAGGCT34777533242TGGTTTTCTACCATATTCATGTTTGTACTTCTTTTATTCACTTCAGGAGACACTGGGCCTTGGTTTTCCAAATAGGGTTTTTGACCTGGGATTTCCTTTGCCATGCA15: 86971227-15q26.1AEN119/120CTGTGGGC252AGGTGATAA34886971330TTTACAAAATAGCTTACTTTTAATTTTAGAGTTTGCTTTCTGTTATAAAAGTTGTACGCATTGATATAAAATTTGTAAAGCCCACAGTGGCATCACGTTCAGGTATGG16: 31240261-16p11.2ITGAM121/122ACTGAGAG253TGATGGTTT34931240341TCAAGGCATCTGGTGTCATCATCCTTTAGGTCCCAGCCAGTACTGAGAGTCAAGGCAATCATGGAGTTCAATCCCAGGGAAGTGG16: 4814659-16p13.3N-PAC123/124ACCATGTC254GCCCAAGAG3504814737CTCCTGTGCCTGAGTTCTCCGTCTCCTGAGACGGACACAGGAGGACATGGTGAGATGAGAAGCTCCTCTTCATCGATGGCCCGG16: 56871110-16q21CCDC113125/126CAACTGCT255CCATCGTAA35156871184CATTGGTTGGCTTGGAAATTTTCTCGAATGAAAATAACCAATGAGCAGTTGCAGGCAGATTACCTTGCTGGGAAGTAGCC16: 85328817-16q24.1LOC729979127/128AAGCCCTT256GGTCCAGCC35285328925GAGCCATCCTTCTCAACTTTACNGGAAAGCCCTTGAGCCATCTTTGATTTGTGTGTTTTGATCTAATTGCACTACTGCTTGCAATGCTTGTTTTTAGCGGTGAGTGCTGGT17: 8680592-17p13.1PIK3R6129/130TTCGGCAA257TCCTGGTAG3538680671TGACCATCGGATACAGCCTTTGTCATTCGTCAAGTTCTGTTCGGCAATGACCATCCTTTGGTACAGTGTCCCTGCAAACCAGAC17: 854262-17p13.3ABR131/132CCTCTTGG258GGCAGCCGA354854342GCATGTCTTGGTCAGTATTCCTCTTCCTTCCTCTTGGGCATGTCTTTCCTCCGTGCACAGAGTATTTACTGTTCTGCCCAAGGCC17: 45884445-17q21.33ACSF2133/134CAGATAGG259CCCTCTGCT35545884521AGCCTTGAGGCACCTTTAGAAACAAAGGTGGGGCTGTGCTTTGTTTCTTCAAGGCTCCTATCTGGTCTCAGTCCCACCTGGGC17: 77723894-17q25.3CCDC57135/136TTGCGAAA260GCTTAGAGC35677723990CGCGATTGCTCCATTTCCCCATTTCCTCATCTGGGCAATCGCGTTTCGCAAGCTCGTGTTCTGCTCTCGGAGCCGCTGGATCTCACTGGATGGAAAGTCT18: 13731517-18p11.21RNMT137/138ATGACAGA261GATTGACAA35713731609CAAACTGAATTTCGTGACAACTGCCCCACAAATGTGTTTTGACATCTGCAGTTGTCAGTTTGTCTGTCATTACTCATTTGAGTCTTATGAGCAGGCTGA18: 201348-18p11.32USP14139/140CAAATGAG262TCCAGAGCT358201426GTGAAACATTAGAGGAATAAACCCGACACATAGGTGGGTTTATGTTTCACCTCATTTGGAACAAAAGAGGACAGAAGCAGACCAC18: 57674840-18q21.33RNF152141/142AAGATTGC263TGCTGTCCT35957674938TCGACCACTACTCATTCCCCTCCCACATCCTTACTAGAGGTGAGGGGTTGGGGGAGGGGTGGTCGAGCAATCTTTTGTACTTTTGAGGGTCTGCAAACTTAGGC18: 74964920-18q23ATP9B143/144TAGTGGTG264GTGGTCCAT36074964997AGAACACCATGGTCCCTCATCTTCTCTTAAAGAAGATGGGTGTTCTCACCACTATTTACAGCCAAGAACCGGAAGAGTCCCTTT19: 17313717-19p13.11GTPBP3145/146CCAACCCG265CCGTTCGAC36117313790GATGCCCCCCTTGATGCTGGGGCATCCGGGTTGGGATGGAGATAGGAGGATCTCAGTATATTTGTTTCGTAGT19: 14507730-19p13.12GPSN2147/148CAGGACAG266GGTGACTCA36214507818AAGGGACTCTGGGCAGACCACCTTCTCCTGGTGGAGTCCCTTCTGTCCTGGCTGTAGCTTTGTACTTAGGCCATTTCTTTGCTGTAGGCACTC19: 47551898-19q13.2MEGF8149/150CACTGCCG267GCTCTGCCG36347551977CATGGCTCATGTCCTCATGGGCTGGGCTGGCCCACACTGCCGCATGGCTCTGTGTCCTGAGAACTGCAATGCCCACACTG19: 62959915-19q13.43ZNF776151/152CAAGTCCT268CAGTACTGG36462960014ACAGTGCATGAGGGAAATTCATGTCTGTTCTCAAGTCCTACAGTGCATTCATGTGTCCTGAAGTCCAGAATTCTGTAGGATAGTGTCCTACGTTATAAGCCTGGA20: 13418983-20p12.1TASP1153/154CAGTGAAG269CCACTTCCC36513419079CCACCTTTTCAATCATGAAATCATGACACCACTTCAGTGAAGCCACCTTTAAATCATCTGTTTTTGAATTTGTCTGGAATCCAGAAAAAGTTGGCAAAACCC20: 2311101-20p13TGM6155/156AATGGGCA270GTGCGAAGG3662311185TCATCATCTTAGTTTCTAACTTTGAGGAAGGAAAAAAGTTGATGATGATGCCCATTGTCAGGTCTGTAACTAACTTGCTGGGTTCCTCTC20: 34441093-20q11.23DLGAP4157/158CCCACCAC271CCCATGGGA36734441175CAGAATAGGATGCTCTTTCTTTGAGAAAGACTATTCTGGTGGTGGGTGCGGGATCCTGTCAGGGGGAAGAGATGGAACCAGGAGACC20: 42805126-20q13.12LOC100128040159/160CTGTGTGC272GCCCTGTCC36842805219AGATGTCGCTGCTTCTGAAAATGAAAAAGAATTTTCGACATCTGCACACAGACAGTTGTGAAAAAGGAGGAGAAGCAGCTACTGGCTAAGGGGCACCT21: 27228739-21q21.3ADAMTS5161/162CATCTGGC273CAGGCAGCT36927228824CCTGGCGTTCTTGGTCAACCAGACAGACCATCTGGCCCTGGCGTACCACAGCACACCACAGGCGAGCACAGACATCCATGCCGGGACAC21: 32606313-21q22.11MRAP163/164CCAGGTGT274AGCATCCTA37032606415TGCTGAGTTGCCTTTGATTATCAAAGATTGCAGTGGCCCCTCGAGTGCAGAGGTCATCCCAGGTGTTGCTGAGTTTATTGAGCACACCTAGCCTGCTTGCTTACTG21: 32989371-21q22.11SYNJ1165/166CACTATGG275GTTCTGATT37132989464CGTGAATTTCTACTCCTGTGCCACACATAAGACGTAATAACCAGTCATCACAATTCACGCCATAGTGTTTGAGATGCAAATGCAAAGACTGATTCC21: 38009196-21q22.13KCNJ6167/168CCATTCAC276CTGATGTGT37238009283CAGCCAAACTTGGCAGGGTTTCATCCCTGGCCTGCTTAGGCAACTTTGGCTGGTGAATGGCCACTGGGCTTTCGACGTCCTGATCCATGG22: 15964337-22q11.1IL17RA169/170CCCAGACC277CCTTACCCA37315964432AGAAGAGTTCACACTCATCCACGCCTTACCCATCCTCGCCTCTCTCCTCAGCCCAGACCAGAAGAGTTCCACCAGCGATCCAACGTCACACTCACTCTAC22: 29154514-22q12.2MTP18171/172CTGTGCAT278CCTCCTGAT37429154594CGGCCTCCCATACTCTGTGCGTACCTGGCCTGTGCATCGGCCTCCTGCTTCATGTCAACCTCCTACTCCTGCCAGGGAATGTG22: 34452693-22q12.3APOL5173/174CCAGCAGC279CACATGAGG37534452785CTCGATTTCTTTCGGAGCAGACGAATAAATTGGTCTGAAATCGAGGCTGCTGGCTTTTGTGTTAATAANTGTGTAAAAGCTATCCAGGGCATCAAGG22: 48978363-22q13.33TRABD175/176CTGCTTGC280CCATCCCTC37648978457AGCGTTCCTCCACAGCAACGTCAGGATGACGTGGAACGCTGCAAGCAGAAGGACCTACTGGAGCAGATGATGGCCGAGATGATTGGCGAGTTCCCAGACX: 50512491-Xp11.22SHROOM4177/178ACAGGCCC281GGAAATTGT37750512567CATTAATTCAGGTCAGCTATGTCAGTGCCTACAGGCCCCATTAATTTATGTCTCCTTCTTCTGAGAGGACATGAAATGGGX: 24141606-Xp22.11ZFX179/180CCAAATGC282TGCTTTAGG37824141705CAGTCAAACAGGTGTGAGTCAACTCCAGCCCAAATGCCAGTCAAAGTCAAGGCATGGGTTTTCCTAGCCTATCTTANAGGAAATTCCTGTACCTTCTTGGCCCX: 109581619-Xq22.3RGAG1181/182CACTGGCG283CCCCATGGT379109581695GATTAGACCAACACAAAATCATTATGTAGACTCTGAAATGATGTCTAATCCGCCAGTGAGAGCAACAGCCTCTGGGGTGATGX: 123351536-Xq25ODZ1183/184ACCTTCCT284GGTCAGAAA380123351615CACCCAGAGTTACCAGGATAAACTTGTCTTGATACCTTATTCTGGGTGAGGAAGGTCTTATTTTTGTCCACTGCAGACACTGGY: 7271634-Yp11.2PRKY185/186ACTCTCCT285GTGATCTGA3817271743CCCTTTGCATGATGTTGTTCTCAACAAGCATTATCAAAGAATTCCACGATGAGAAGCAAAGGGAGGAGAGTGGAACTTTTGAAAACCTGTATTTCATTGTCTGGCTATCCGTGTY: 5423177-Yp11.2PCDH11Y187/188CAGGGCCA286TCCTGCAAA3825423278AGTAGTAAATGACTTGAAGACCTGTTGGTAAAGTAGAAAGTTTTATGACTACAAATTTCAGGGCCAAGTAGTAAAGACCTGCTACAAAATAAAAAGGCCTGACATGTY: 20211350-Yq11.222CYorf15A189/190AACTATAC287CTTCCAGGG38320211455GATTTGAAAAATTCACCACAAAATTTCTTCTATACGAAGAGTTTGTTTTGAACTATACGATTTGAAACAAAATTCTTTTTTTGGAGACTATGGAAACATTCTCAACAGGGAAACY: 21330672-Yq11.223RPS4Y2191/192CCGATATT288GAAAGGGAA38421330747GCTGGACCGAGCACACAACCTCTGTCTGTGTTAAGAGGTGGTCCAGCAATATCGGCAGGGCTTGTGTGGGACTTTGAGGCC Any of the exemplary loci shown in Table 3, or any other suitable target loci that are outside of a CNVR, can be used in the karyotyping methods described herein. Such target loci can also be combined with target loci that fall within a CNVR, if desired. Particular loci can be targeted on each chromosome and any such target loci can be combined with any other target loci to form a subset, or screening panel. For instance, any of SEQ ID NOS. 1-192 can be used to interrogate chromosomes 1-22, X or Y as shown below: SEQ ID NOS. 1, 2, 3, 4, 5, 6, 7, 8 (chromosome 1); SEQ ID NOS. 9, 10, 11, 12, 13, 14, 15, 16 (chromosome 2); SEQ ID NOS.: 17, 18, 19, 20, 21, 22, 23, 24 (chromosome 3); SEQ ID NOS. 25, 26, 27, 28, 29, 30, 31, 32 (chromosome 4), 33, 34, 35, 36, 37, 38, 39, 40 (chromosome 5); SEQ ID NOS. 41, 42, 43, 44, 45, 46, 47, 48 (chromosome 6); SEQ ID NOS. 49, 50, 51, 52, 53, 54, 55, 56 (chromosome 7); SEQ ID NOS. 57, 58, 59, 60, 61, 62, 63, 64 (chromosome 8); SEQ ID NOS. 65, 66, 67, 68, 69, 70, 71, 72 (chromosome 9); SEQ ID NOS. 73, 74, 75, 76, 77, 78, 79, 80 (chromosome 10); SEQ ID NOS. 81, 82, 83, 84, 85, 86, 87, 88 (chromosome 11); SEQ ID NOS. 89, 90, 91, 92, 93, 94, 95, 96 (chromosome 12); SEQ ID NOS. 97, 98, 99, 100, 101, 102, 103, 104 (chromosome 13); SEQ ID NOS. 105, 106, 107, 108, 109, 110, 111, 112 (chromosome 14); SEQ ID NOS. 113, 114, 115, 116, 117, 118, 119, 120 (chromosome 15); SEQ ID NOS. 121, 122, 123, 124, 125, 126, 127, 128 (chromosome 16); SEQ ID NOS. 129, 130, 131, 132, 133, 134, 135, 136 (chromosome 17); SEQ ID NOS. 137, 138, 139, 140, 141, 142, 143, 144 (chromosome 18); SEQ ID NOS. 145, 146, 147, 148, 149, 150, 151, 152 (chromosome 19); SEQ ID NOS. 153, 154, 155, 156, 157, 158, 159, 160 (chromosome 20); SEQ ID NOS. 161, 162, 163, 164, 165, 166, 167, 168 (chromosome 21); SEQ ID NOS. 169, 170, 171, 172, 173, 174, 175, 176 (chromosome 22); SEQ ID NOS. 177, 178, 179, 180, 181, 182, 183, 184 (X chromosome); or SEQ ID NOS. 185, 186, 187, 188, 189, 190, 191, 192 (Y chromosome). Typically, the primers are used in pairs as set forth in Tables 3 and 4. It is understood that other primers and primer pairs not listed in Tables 3 and 4 can be used to interrogate chromosomes or parts of chromosomes 1-22, X and Y. The probes (e.g., SEQ ID NOS. 193-288) are typically used to detect their corresponding amplified sequence (e.g., SEQ ID NOS. 289-384) (Table 4). When multiple chromosomes are interrogated, any of SEQ ID NOS. 1-192 can be used to interrogate their respective chromosomes. Any one or more of SEQ ID NOS. 1-192 can be used with any other one or more of SEQ ID NOS. 1-192 to perform such assays. For instance, any one or more of SEQ ID NOS. 1-8 can be used with any one or more of SEQ ID NOS. 9-16 to interrogate chromosomes 1 and 2, respectively. Other similar subsets of SEQ ID NOS. 1-192 can also be suitable for use, as would be contemplated by one of skill in the art. At least one additional locus can also be interrogated as a control (e.g., “control gene”). Such additional loci can be, for example, the aforementioned RNase P (chromosome 14, cytoband 14q11.2) or TERT (chromosome 5, cytoband 5p15.33). In certain embodiments, the karyotyping methods described herein are used to simultaneously interrogate multiple chromosomes. For example, using a human gDNA sample, more than one chromosome (i.e., chromosomes 1-22, X and Y) can be simultaneously interrogated in the same or separate assays. Furthermore, a subset of the total complement of chromosomes can be interrogated in the same or separate assays. Individual chromosomes can be targeted by amplifying loci specific to such chromosomes that are outside of CNVRs. For example, chromosome 1 can be interrogated along with any one or more of chromosomes 2-22, X or Y; chromosome 2 can be interrogated along with any one or more of chromosomes 1 and 3-22, X or Y; chromosome 3 can be interrogated along with any one or more of chromosomes 1-2, 3-22, X or Y; chromosome 4 can be interrogated along with any one or more of chromosomes 1-3, 5-22, X or Y; chromosome 5 can be interrogated along with any one or more of chromosomes 1-4, 6-22, X or Y; chromosome 6 can be interrogated along with any one or more of chromosomes 1-5, 7-22, X or Y; chromosome 7 can be interrogated along with any one or more of chromosomes 1-6, 8-22, X or Y; chromosome 8 can be interrogated along with any one or more of chromosomes 1-7, 9-22, X or Y; chromosome 9 can be interrogated along with any one or more of chromosomes 1-8, 10-22, X or Y; chromosome 10 can be interrogated along with any one or more of chromosomes 1-9, 11-22, X or Y; chromosome 11 can be interrogated along with any one or more of chromosomes 1-10, 12-22, X or Y; chromosome 12 can be interrogated along with any one or more of chromosomes 1-11, 13-22, X or Y; chromosome 13 can be interrogated along with any one or more of chromosomes 1-12, 14-22, X or Y; chromosome 14 can be interrogated along with any one or more of chromosomes 1-13, 15-22, X or Y; chromosome 15 can be interrogated along with any one or more of chromosomes 1-14, 16-22, X or Y; chromosome 16 can be interrogated along with any one or more of chromosomes 1-15, 17-22, X or Y; chromosome 17 can be interrogated along with any one or more of chromosomes 1-16, 18-22, X or Y; chromosome 18 can be interrogated along with any one or more of chromosomes 1-17, 19-22, X or Y; chromosome 19 can be interrogated along with any one or more of chromosomes 1-18, 20-22, X or Y; chromosome 20 can be interrogated along with any one or more of chromosomes 1-19, 21, 22, X or Y; chromosome 21 can be interrogated along with any one or more of chromosomes 1-20, 22, X or Y; chromosome 22 can be interrogated along with any one or more of chromosomes 1-21, X or Y; X chromosome can be interrogated along with any one or more of chromosomes 1-22 or Y; Y chromosome can be interrogated along with any one or more of chromosomes 1-22 or X. Other subsets of chromosomes can also be interrogated as would be understood by one of skill in the art. For PCR-based assays, any of the primer sets shown in Tables 3 or 4 can be used as may any other suitable primer set. Described herein are karyotyping methods for determining the copy number of one or more chromosomes in a test biological sample (such as a test gDNA). In certain embodiments, the methods can be used to determine the karyotype of a test genome. The karyotype information typically relates to one or more chromosomes of a genome. Such methods described herein can be used in prenatal diagnostic assays to screen for and detect chromosomal abnormalities in a fetus or embryo, such as Down's Syndrome (Trisomy 21), Edward's Syndrome (Trisomy 18) and Patau Syndrome (Trisomy 13). These assays can be performed on biological samples such as fetal cells or cell-free fetal DNA in maternal blood, amniotic fluid, trophoblast cells, chorionic villus samples and percutaneous umbilical cord blood. Furthermore, the methods disclosed herein can also be performed on embryos used in in vitro fertilization (IVF) wherein blastocyst cells or cells biopsied from the trophectoderm are analyzed from embryos that are 3 to 6 days post-fertilization, in order to determine if they should be implanted in utero. The methods described herein can be useful in, for example, stem cell analysis, quality control assays of cell cultures, analysis of samples of limited quantity (e.g. single cell, formalin-fixed paraffin-embedded (FFPE)), comparisons between cell or tissue types, comparisons between diseased or non-diseased tissues, detection of chromosomal polymorphisms, and the like. The methods disclosed herein can be used to compare chromosome copy number between, for example, cell types (e.g., lymphocyte, epithelial cell), tissue types (e.g., neural tissue, skeletal muscle tissue), disease states (e.g., cancerous, non-cancerous), or types of organisms (e.g. human, mouse, plant, fruit fly). Other uses for the methods described herein will be apparent to one of skill in the art. The methods described herein can be used to detect chromosomal abnormalities. Exemplary abnormalities include, but are not limited to, deletion, duplication, translocation, mosaicism, aneuploidy (e.g., nullisomy, disomy, trisomy and tetrasomy), inversion, ring formation, isochromosome formation, or chromosomal instability syndromes. Pathologies have been associated with abnormalities in particular human chromosomes including, for example, chromosome 1 (e.g., acute lymphoblastic leukemia, acute megakaryoblastic leukemia, alveolar rhabdomyosarcoma), chromosome 2 (e.g., anaplastic large cell lymphoma, alveolar rhabdomyosarcoma), chromosome 3, chromosome 4 (e.g., Wolf-Hirschhorn syndrome, acute lymphoblastic leukemia), chromosome 5 (e.g., Cri du chat, also known as Chromosome 5q deletion syndrome, anaplastic large cell lymphoma), chromosome 6, chromosome 7 (e.g., Williams syndrome), chromosome 8 (e.g., Burkitt's lymphoma, acute lymphoblastic leukemia, acute myeloblastic leukemia with maturation), chromosome 9 (e.g., Trisomy 9, Warkany syndrome 2, acute lymphoblastic leukemia, Philadelphia chromosome), chromosome 10, chromosome 11 (e.g., Jacobsen syndrome, mantle cell lymphoma, multiple myeloma, acute lymphoblastic leukemia, Ewing's sarcoma, desmoplastic small round cell tumor), chromosome 12 (e.g., acute lymphoblastic leukemia, myxoid liposarcoma), chromosome 13 (e.g., Patau syndrome, alveolar rhabdomyosarcoma, breast and ovarian cancers, deafness, Wilson's disease), chromosome 14 (e.g., Burkitt's lymphoma, follicular lymphoma, acute lymphoblastic leukemia), chromosome 15 (e.g., Angelman syndrome, Prader-Willi syndrome, acute promyelocytic leukemia, Marfan syndrome, Tay-Sach's disease), chromosome 16 (e.g., Trisomy 16, myxoid liposarcoma, polycystic kidney disease, α-thalassemia), chromosome 17 (e.g., Miller-Dieker syndrome, Smith-Magenis syndrome, acute promyelocytic leukemia, dermatofibrosarcoma protuberans, Charcot-Marie-Tooth disease), chromosome 18 (e.g., Edwards syndrome, Burkitt's lymphoma, follicular lymphoma, mantle cell lymphoma, multiple myeloma, synovial sarcoma, Nieman-Pick disease, pancreatic cancer), chromosome 19 (e.g., acute lymphoblastic leukemia), chromosome 20, chromosome 21 (e.g., Down syndrome, acute lymphoblastic leukemia, acute myeloblastic leukemia with maturation), chromosome 22 (e.g., Di George's syndrome, Trisomy 22, acute lymphoblastic leukemia, Philadelphia chromosome, acute megakaryoblastic leukemia, Ewing's sarcoma, dermatofibrosarcoma protuberans, desmoplastic small round cell tumor), X chromosome (e.g., Fragile X syndrome, Turner syndrome, Triple X syndrome, Klinefelter's syndrome, synovial sarcoma, mixed gonadal dysgenesis, XX gonadal dysgenesis, uniparental disomy, Duchenne muscular dystrophy, X-linked diseases, hemophilia, adrenoleukodystrophy, Hunter's disease), or Y chromosome (e.g., Klinefelter's syndrome, uniparental disomy, acute myeloid leukemia). Any of these disorders, or any other disorders that may be detected by karyotyping as would be known by the skilled artisan, can be studied using the methods described herein. Kits for determining the copy number of multiple chromosomes are also provided. For use with a PCR-based assay, the kit can include at least a set of primers for amplifying at least one test locus on a chromosome (e.g., any one or more of SEQ ID NOS. 1-192) or corresponding probes (e.g., any one or more of SEQ ID NOS. 193-288). The kit can also include samples of pre-determined amplified sequences such as those listed in Table 4 (e.g., any one or more of SEQ ID NOS. 289-384), which can optionally be affixed to a solid support (e.g. a membrane, glass slide, multi-well plate) for use as a control reaction. The kit can also optionally include stock solutions, buffers, enzymes, detectable labels or reagents required for detection, tubes, membranes, and the like that can be used to complete the amplification reaction. In some embodiments, multiple primer sets are included. The kits can also comprise the reagents required to use a reference (e.g., primers and probes for amplifying or detecting a reference sequence such as RNase P or TERT) or calibrator sample (i.e., a control genome of known karyotype, a chromosome sample, or the like). In some embodiments, the kits can contain multiple sets of primers for amplifying multiple target loci on a single chromosome or among two or more chromosomes (e.g., any combination of primers sets and probes shown in Tables 3 and 4, or any primer/probe sets that target loci outside of CNVRs). In one embodiment, a multi-well plate contains within its wells an array of replicate wells for use in carrying out assays. For example, a 384-well array containing four replicate wells for each of chromosomes 1-22, X and Y comprising primer/probe sets targeting loci outside of CNVRs for each of the chromosomes, is provided, optionally including reagents such as stock solutions, buffers, enzymes such as polymerases, and detectable labels. Other embodiments of particular systems and kits are also contemplated which would be understood by one of skill in the art. In addition, the arrays can be customized depending on the target samples being analyzed, for example, arrays comprising one, two, three or more chromosomes comprising one, two, or more than two loci to be analyzed per chromosome. Furthermore, the number of replicate wells or samples per chromosome per array can vary (e.g., one, two, three, four, or more than four). All references cited within this disclosure are hereby incorporated by reference in their entirety. Certain embodiments are further described in the following examples. These embodiments are provided as examples only and are not intended to limit the scope of the claims in any way. EXAMPLES A. Karyotyping of Chromosomes 2, 3, 4, 5, 6, 20 and 22 The primers and probes used to interrogate the targets of interest described below were designed using masked genomic DNA sequences (the human genome assembly B36) by an Applied Biosytems proprietary TaqMan® Copy Number Assay Design Pipeline. The existing pre-designed TaqMan® copy number assay protocols were utilized. TaqMan® copy number assays targeting chromosomal regions located outside of copy number variable regions (CNVR) on each of the 24 chromosomes were designed (the data shown below, however, relates only to chromosomes 2, 3, 4, 5, 6, 20 and 22.) As described above, to cover all 24 chromosomes on a 384 well plate or TaqMan® array card (TLDA), four assays can be selected for each chromosome, using two assays on each arm of each chromosome whenever possible. The assays were run as duplex TaqMan® real-time PCR reactions. A FAM™ dye-based assay was used to detect test target loci and the VIC® dye-based assay was used for the reference locus RNase P (PN 4316844 from Applied Biosystems). Each assay utilized 10 ng gDNA, 1×TaqMan® probe/primer mix (900 nM of each primer, 250 nM of each probe) in 1×TaqMan® Genotyping Master Mix in a 10 μl reaction (run in quadruplicate). PCR reactions were incubated in an Applied Biosystems 7900HT SDS instrument for 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and 60 seconds at 60° C. Real-time data was collected by the SDS 2.3 software. The relative quantification analysis was performed to calculate estimated copy number of each sample for the gene of interest by CopyCaller™ software. These methods were used to interrogate loci on chromosomes 2, 3, 4, 5, 6, 20 and 22 of human gDNA samples (a set of 92 African American and Caucasian gDNA samples from Coriell Institute) using the following primer sets and probes: TABLE 5SEQ IDNO.SEQ ID(primerNO.Amplified sequenceSEQ ID NO.Chromosomepairs)Probe(probe)(amplicon)(amplicon)29/10AACCACCA197TGACAGCTTTTGGCTCAGAAAT293ACAAAGGGTAGAAAATGAAATGATAACCACATTCTCAACAAAGGGATTCTGCAGCTGAGTATGGATTTCCTCCCAGTGACAGG11/12ACCTTCCC198CACGATGAGGGTTGAGGGAAAA294AGTTTGATACAGTTGGTAGGAACAAGTGCTAAGCACTATCAAACTGGGAAGGTGCTCTTATTTACAGCTGCTGGCTCAAGAATC13/14CTGGCCTG199GCCAGGATGCTCCATGTAGTAT295TGTGTACTTGCATTATAACATGGTCTCAGCTCTTGGCCTGTGTGTACTTCTACAACATGAACCGTCAGAATAATCCTT15/16ACCCATGC200AGGTGAAAAAAGTACTTATGAG296CTCTTTCTGATGATGAATAGTTGGAAAAACAATAACTAGTAAAATAGGGTTGGTTATTAGAAAGAGGCATGGGTAGTTGATAGAGCCATAAGCTTTGATCAA317/18CCTGCCTA201AAACAGGAGAATGAATGAATGA297CCAAAGAGATATGCTAATACAACCACCTCTGATACAGTATCCTCTTTGGTAGGCAGGAGGCAAGAAGCAGGCTAATCTGTCTATGG19/20TCCCAGCC202GCCATCCTCCTTTTTCTCATCC298CACTGTAATGTGGGGCTACTTATGATGTGAATGTGCCATTTACAGTGGGCTGGGATTACAGGTGTGAGGCACCAAACCCA21/22AATGCCAC203TGGCATGTGAGATGTGTTCAAG299CAGTGACCAAACTCAAGACTAAGGGAATGATTCAGATGAATGAATGCCACCAGTGACCTTCAGTGCCTCTCTAGTGGTACCCTTT23/24TCTTCTTT204TCCCTCAAGTTTATTCAGTCTC300GCTCCTGACTTATGTAATCAGTAATTCTATGACCTCCAAATCCTCTTCTTTGCTCCTGAGACCTCACCTACTTCAATTTGGACGTCTTGCTCT425/26ATAGGTGT205CATTTCCAAGTACAGTAACTCC301CCCTGTAAACAGTACTATCCTGTTGCTTTAAGCAACCAGGGACACCTATGCCTTTTTTCTTCAGAATAAAGAACATTGCAAACTGTTTTTGCACCACTGAGG27/28TCCTGCTG206CCCAAGCACCTGTAGCATCATC302CCCACTGAGTCCACGTCCTGCTGCCCACTGCCTGACCTGTCCGGCTCCACACATGAAGGCAGATGTTTGAGG29/30CCACACAG207GGAATGTTACCACGTTGCTAAG303GCTCCTTGCTATGTAACATATCTTAACAACGAGTAACAGGGAGCCACACAGGCTCCTTGGAGTAAGAGTGTGAGAAACTGGATGAAGACAGCTG31/32TTGCTGTT208TTTCTGGGAGCCATCTGAATCA304GGCTGAATTCTTTGCTGTTGGCTGAATCACCACTTCAGAGCTGAGAGGGAGGATGAAGAGGGGCTATTTGATTCGCTG533/34AATGGAGA209GGTATGACCTGGACACATTAAG305AGGGAAAACATTCGTAATTTTCCCTTCTCCTTACATTACTAGATACAGTGCTTACATTTCTCATTATTTTTATCTCCCTCCT35/36CAGGGAGA210GCAAGCCACAGGAAGAGGAAGC306CAAAACAGCCAAAGGCAGGGAGACAAAACAAAATATGAAATATGCTTCTGGCACCAAGTCAAATTGTACA37/38CCGGAGCC211GCGGAACAAGCCAGACTGAAAA307GCTGCACAAAAAAAAAAAAAACCCTCACCGTAAATGTGCAGCGGCTCCGGAGCGAGAACAGCGCTCGAACCTC39/40CTAGGTAC212GTTTTAGAAGGAAGAGGGCTAG308TGCGCCACGAAGAAAAGTGGCGCAGTACCTTTTTAGTAGGTAAGTATAATCTGGATGCTCCCAGTAATTCTGAGTGTTGACTGCACATTCT641/42ATGCAACT213GTATAGGCAGCGACAGCACTTG309CATGCTGATAAATTCAGCATGAGTTGCATGATTTAGTTGGCCAATGTTGGTGAGTCCTGTGGAGATCT43/44CCTCAAGC214GAAAACCAAAGCAACAAGGTGA310TCCGACCCGTCCTCAGGAGGGGTCGGAGCTCTCCTTGAGGTTTTGGAGTTTGGAACTTACTCCCATCTCCC45/46CATGTATA215GGGTTGCAGGGATGGTGTACAA311GCTGCATACAGGTCCTAGCATGTATAGCTGGATTTCCATAGATTTCTTCACCTGATCTTTGTGTGGAAGATCAGAATGAATGCA47/48CAGTCTGA216GGGATCTGTAACTTGACCAAGG312TGGTCCCATCAAAGAGCTTGAAATTTCAACAGTTGATTGGGACCATCAGACTGAAAACCTGCAATCTGAAACACTTTGCTGTGCTGC20153/154CAGTGAAG269CCACTTCCCTCAATCATGTGAC365CCACCTTTACCACTTCAGTGAAGCCACCTTAAATCATAAATCATCTGTTTTTGAATTTGTCTGGAATCCAGAAAAAGTTGGCAAAACCC155/156AATGGGCA270GTGCGAAGGTTAGTTTCTGAGG366TCATCATCAAGGAAAAAAGTTGATGATGATAACTTTGCCCATTGTCAGGTCTGTAACTAACTTGCTGGGTTCCTCTC157/158CCCACCAC271CCCATGGGAGATGCTCTTGAGA367CAGAATAGAAGACTATTCTGGTGGTGGGTGTCTTTCGGGATCCTGTCAGGGGGAAGAGATGGAACCAGGAGACC159/160CTGTGTGC272GCCCTGTCCCTGCTTCTGGAAA368AGATGTCGAAGAATTTTCGACATCTGCACAAAAATCAGACAGTTGTGAAAAAGGAGGAGAAGCAGCTACTGGCTAAGGGGCACCT22169/170CCCAGACC277CCTTACCCATCCCAACTAGCCT373AGAAGAGTTACCCATCCTCGCCTCTCTCCTTCCACCAGCCCAGACCAGAAGAGTTCCACCAGCGATCCAACGTCACACTCACTCTAC171/172CTGTGCAT278CCTCCTGATCATACTCTGGTAC374CGGCCTCCCTGGCCTGTGCATCGGCCTCCTTGCGCTTCATGTCAACCTCCTACTCCTGCCAGGGAATGTG173/174CCAGCAGC279CACATGAGGCTTTCGGAGGAAT375CTCGATTTAAATTGGTCTGAAATCGAGGCTCAGACGCTGGCTTTTGTGTTAATAANTGTGTAAAAGCTATCCAGGGCATCAAGG175/176CTGCTTGC280CCATCCCTCTCCACAGCAAGGA376AGCGTTCCTGACGTGGAACGCTGCAAGCAGACGTCAAGGACCTACTGGAGCAGATGATGGCCGAGATGATTGGCGAGTTCCCAGAC The resultant data is shown in FIG. 1 (chromosome 2), FIG. 2 (chromosome 3), FIG. 3 (chromosome 4), FIG. 4 (chromosome 5), FIG. 5 (chromosome 6), FIG. 6 (chromosome 20), FIG. 7 (chromosome 20), and FIG. 8 (chromosome 22). As shown therein, the methods described herein (e.g., interrogating target loci located outside CNVRs) has been used to accurately karyotype various chromosomes found within the human genome. B. Detection of Disease Pathology by Karyotype Analysis Many forms of cancer have been associated with various chromosomal abnormalities (see discussion hereinabove). Detection of diseases or susceptibility to diseases is critical for proper diagnosis or treatment. For example, certain breast and ovarian cancers are associated with abnormalities in chromosome 13. Primers and probes useful for interrogation of non-CNVR loci of chromosome 13 can be used to determine whether a patient has or is susceptible to having a breast or ovarian cancer. The primers and probes used to interrogate the chromosome 13 target loci are designed using masked genomic DNA sequences (the human genome assembly B36) by an Applied Biosystems proprietary TaqMan® Copy Number Assay Design Pipeline and interrogated using copy number assays of format 1 and using virtual calibrator assay no. 1. Test samples are obtained from normal and tumor cell and tissue. As described above, four assays are selected for chromosome 13, using two assays on each arm of the chromosome. The assays are run as duplex TaqMan® real-time PCR reactions. A FAM™ dye-based assay is used to detect test target loci and the VIC® dye-based assay is used for the reference locus RNase P (PN 4316844 from Applied Biosystems) in assay format 1. Each assay uses 10 ng gDNA, 1×TaqMan® probe/primer mix (900 nM of each primer, 250 nM of each probe) in 1×TaqMan® Genotyping Master Mix in a 10 μl reaction (run in quadruplicate). PCR reactions are incubated in an Applied Biosystems 7900HT SDS instrument for 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and 60 seconds at 60° C. Real-time data is collected by the SDS 2.3 software. The relative quantification analysis is performed as described herein above to calculate estimated copy number of each sample for the gene of interest by CopyCaller™ software. Identification of abnormal chromosomal copy number and karyotype of chromosome 13 indicates the presence or susceptibility to the breast or ovarian cancer associated with chromosome 13. While certain embodiments have been described in terms of the preferred embodiments, it is understood that variations and modifications will occur to those skilled in the art. Therefore, it is intended that the appended claims cover all such equivalent variations that come within the scope of the following claims.","lang":"en","source":"USPTO_FULLTEXT","data_format":"ORIGINAL"}},"description_lang":["en"],"has_description":true,"has_docdb":true,"has_inpadoc":true,"has_full_text":true,"biblio_lang":"en"},"jurisdiction":"US","collections":[],"usersTags":[],"lensId":"013-469-144-908-836","publicationKey":"US_2011_0281755_A1","displayKey":"US 2011/0281755 A1","docAssets":{"lensId":"013-469-144-908-836","pdfUrl":"https://www.lens.org/images/patent/US/20110281755/A1/US_2011_0281755_A1.pdf","images":[{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000001.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000001.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000002.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000002.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000003.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000003.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000004.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000004.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000005.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000005.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000006.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000006.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000007.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000007.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000008.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000008.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000009.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000009.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000010.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000010.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000011.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000011.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000012.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000012.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000013.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000013.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000014.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000014.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000015.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000015.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000016.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000016.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000017.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000017.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000018.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000018.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000019.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000019.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000020.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000020.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000021.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000021.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000022.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000022.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000023.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000023.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000024.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000024.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000025.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000025.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000026.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000026.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000027.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000027.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000028.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000028.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000029.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000029.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000030.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000030.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000031.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000031.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000032.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000032.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000033.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000033.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000034.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000034.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000035.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000035.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000036.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000036.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000037.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000037.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000038.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000038.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000039.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000039.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000040.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000040.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000041.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000041.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000042.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000042.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000043.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000043.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000044.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000044.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000045.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000045.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000046.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000046.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000047.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000047.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000048.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000048.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000049.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000049.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000050.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000050.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000051.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000051.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000052.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000052.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000053.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000053.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000054.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000054.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000055.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000055.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000056.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000056.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000057.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000057.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000058.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000058.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000059.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000059.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000060.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000060.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000061.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000061.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000062.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000062.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000063.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000063.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000064.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000064.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000065.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000065.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000066.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000066.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000067.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000067.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000068.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000068.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000069.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000069.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000070.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000070.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000071.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000071.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000072.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000072.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000073.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000073.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000074.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000074.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000075.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000075.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000076.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000076.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000077.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000077.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000078.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000078.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000079.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000079.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000080.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000080.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000081.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000081.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000082.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000082.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000083.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000083.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000084.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000084.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000085.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000085.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000086.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000086.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000087.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000087.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000088.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000088.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000089.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000089.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000090.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000090.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000091.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000091.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000092.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000092.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000093.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000093.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000094.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000094.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000095.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000095.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000096.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000096.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000097.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000097.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000098.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000098.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000099.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000099.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000100.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000100.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000101.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000101.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000102.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000102.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000103.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000103.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000104.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000104.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000105.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000105.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000106.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000106.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000107.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000107.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000108.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000108.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000109.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000109.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000110.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000110.png"},{"thumb":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/10pc/00000111.png","full":"https://s3-us-west-2.amazonaws.com/lens-resource/patent/US/A1/20110281/20110281755/image/page/full/00000111.png"}],"fallover":false},"countryName":"USA","inventorModel":{"inventors":[{"name":{"value":"BROOMER ADAM","valueNormalised":"Broomer Adam"},"inventorship":null},{"name":{"value":"LI KELLY","valueNormalised":"Li Kelly"},"inventorship":null},{"name":{"value":"TOBLER ANDREAS R","valueNormalised":"Tobler Andreas R"},"inventorship":null},{"name":{"value":"CHEN CAIFU","valueNormalised":"Chen Caifu"},"inventorship":null},{"name":{"value":"KEYS JR DAVID N","valueNormalised":"Keys Jr David N"},"inventorship":null}],"inventorships":[],"unmatchedInventorships":[],"activeUserHasInventorship":false},"simpleFamilyId":215475348,"citesPatentCount":3,"countrySpec":{"countryName":"USA","description":"FIRST PUBLISHED PATENT APPLICATION [FROM 2001 ONWARDS]","rule":"pubdate:AFTER:15-03-2001","docType":"PATENT_APPLICATION"},"pageTitle":"US 2011/0281755 A1 - Karyotyping Assay","documentTitle":"Karyotyping Assay"},"claims":{"source":"xml_claims","claims":[{"lines":["A method for determining the copy number of at least one test locus on at least one chromosome in a test sample, the method comprising:\n
(a) interrogating at least one test locus on at least one chromosome in the test sample; and\n
(b) quantifying the copy number of at least one of the interrogated test loci,\n
wherein the at least one test locus is located on a region of the chromosome that is not within a copy number variable region (CNVR) on the chromosome."],"number":1,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, further comprising,\n
interrogating at least one reference locus of at least one chromosome in a calibrator sample; and\n
quantifying the copy number of at least one of the interrogated reference loci,\n
wherein the quantifying of the copy number of the interrogated test locus comprises quantifying the copy number of the test locus relative to the copy number of at least one of the reference loci of the calibrator sample."],"number":2,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, further comprising,\n
determining the copy number of at least one chromosome in the test sample on which at least one of the interrogated test loci is located,\n
wherein determining the copy number of the chromosome is based on the copy number of the interrogated test locus."],"number":3,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 3, wherein the determining of the copy number of at least one chromosome in the test sample comprises determining the copy number of more than one chromosome in the test sample."],"number":4,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, wherein the copy number of more than one test loci in the test sample is interrogated and quantified."],"number":5,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 2, wherein the calibrator sample is a virtual calibrator sample derived by assaying at least two or more test samples by a method comprising the steps of:\n
(a) interrogating one or more test loci in each test sample using one or more copy number assays and calculating an average CT for each of said copy number assays;\n
(b) interrogating one or more reference loci in each test sample using one or more copy number reference assays and calculating an average CT from each of said copy number reference assays;\n
(c) averaging the copy number assay average CT values of (a);\n
(d) averaging the copy number reference assay average CT values of (b);\n
(e) calculating the relative quantity using values of (c) and (d); and\n
(f) determining the copy number for each test locus by multiplying the relative quantity by the copy number of the calibrator sample."],"number":6,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1 wherein the test sample comprises genomic DNA."],"number":7,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1 wherein at least one of the interrogated test loci and at least one of the reference loci correspond to the same location on a chromosome."],"number":8,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1 wherein at least one of the interrogated test loci and at least one of the reference loci correspond to different locations on the chromosome."],"number":9,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, further comprising the steps of:\n
(a) amplifying from a first genomic DNA sample at least one or more test loci from at least one chromosome and at least one or more reference loci from at least one chromosome;\n
(b) amplifying from a second test genomic DNA sample at least one or more target loci from at least one chromosome and at least one or more reference loci from at least one chromosome;\n
(c) calculating the average CT values for each of amplifications (a) and (b);\n
(d) calculating the average of the average CT values for each of amplifications (a) and (b); and\n
(e) calculating the relative copy number in the genomic DNA sample,\n
wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome."],"number":10,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, further comprising the steps of:\n
(a) amplifying from a genomic DNA sample one or more target loci on a chromosome;\n
(b) amplifying from the genomic DNA sample one or more target loci on a chromosome;\n
(c) amplifying from the genomic DNA sample one or more reference loci on a chromosome;\n
(d) calculating the average CT values for each of amplifications (a), (b), and (c);\n
(e) calculating the average of the average CT values for each of amplifications (a), (b), and\n
(c);\n
(f) calculating the ΔCT value from the average calculated in (e) for amplifications (a) and (c);\n
(g) calculating the relative copy number in the genomic DNA sample,\n
wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome."],"number":11,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, further comprising the steps of:\n
(a) amplifying from a genomic DNA sample one or more test loci on a chromosome;\n
(b) amplifying from the genomic DNA sample one or more test loci on a chromosome;\n
(c) calculating the average CT values for each of amplifications (a) and (b);\n
(d) calculating the average of the average CT values for each of amplifications (a) and (b);\n
(e) calculating the ΔCT value by subtracting the average calculated in (d) for amplification\n
(b) from the average calculated in (d) for amplification (a); and\n
(f) calculating the relative copy number in the genomic DNA sample,\n
wherein the target loci are located on a region of the chromosome that is not within a copy number variable region on the chromosome."],"number":12,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 1, wherein the at least one test locus is amplified using the polymerase chain reaction to produce amplicons."],"number":13,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 13, wherein the amplification efficiency of each amplicon amplified from the test genome is within about ten percent of any other amplicon."],"number":14,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 14, wherein at least two target loci are amplified from each arm of each chromosome being interrogated."],"number":15,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 15, wherein at least four target loci are amplified from each chromosome being assayed."],"number":16,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 13, wherein multiple target loci are amplified and each is from any other target loci on the arm by approximately the same number of nucleotides."],"number":17,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 13, wherein the amplicons are less than or equal to about 110 nucleotides in length."],"number":18,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 19, wherein the amplicons are about 70 to 110 nucleotides in length."],"number":19,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 13, wherein primers utilized in the polymerase chain reaction are specific for regions outside of a copy number variable region."],"number":20,"annotation":false,"claim":true,"title":false},{"lines":["The method of claim 20, wherein the primers are selected from the group consisting of SEQ ID NOS. 1-192."],"number":21,"annotation":false,"claim":true,"title":false},{"lines":["An array comprising a plurality of oligonucleotide probe sets, wherein each probe has a portion that is specific for at least one target locus in at least one chromosome, wherein the target locus is located on a region of the chromosome that is not within a copy number variable region on the chromosome."],"number":22,"annotation":false,"claim":true,"title":false},{"lines":["The array of claim 22, wherein the plurality of oligonucleotide probe sets are immobilized on a solid support."],"number":23,"annotation":false,"claim":true,"title":false},{"lines":["The array of claim 22, wherein the plurality of oligonucleotide probe sets comprise subsets of probes that are specific for at least two target loci outside of a CNVR from at least one chromosome."],"number":24,"annotation":false,"claim":true,"title":false},{"lines":["The array of claim 22, wherein the at least one chromosome is selected from human chromosomes 1-22, X and Y."],"number":25,"annotation":false,"claim":true,"title":false},{"lines":["The array of claim 22, wherein the nucleic acid probes are selected from the group consisting of SEQ ID NO: 193-288."],"number":26,"annotation":false,"claim":true,"title":false},{"lines":["The array of claim 22, wherein the nucleic acid primers are selected from the group consisting of SEQ ID NO: 1-192."],"number":27,"annotation":false,"claim":true,"title":false},{"lines":["A kit for determining the copy number of at least one chromosome of a test genomic DNA sample of an unknown karyotype, the kit comprising, at least two oligonucleotide primers and at least one nucleic acid probe corresponding to a test locus located on a region of the chromosome that is not within a copy number variable region on the at least one chromosome and instructions for use."],"number":28,"annotation":false,"claim":true,"title":false},{"lines":["The kit of claim 28, further comprising at least one additional set of oligonucleotide primers corresponding to a reference test locus."],"number":29,"annotation":false,"claim":true,"title":false},{"lines":["The kit of claim 28, further comprising a control genomic DNA sample of known karyotype optionally affixed to a solid support."],"number":30,"annotation":false,"claim":true,"title":false},{"lines":["The kit of claim 28, further comprising a plurality of oligonucleotide primers and a plurality of oligonucleotide probes corresponding to a plurality of test loci located on a region of the chromosome that is not within a copy number variable region on one or more chromosome."],"number":31,"annotation":false,"claim":true,"title":false},{"lines":["A method for diagnosing a disease resulting from a chromosomal abnormality, the method comprising:\n
(a) providing a test sample comprising at least one test locus on at least one chromosome;\n
(b) interrogating the at least one test locus on at least one chromosome in the test sample; and\n
(c) quantifying the copy number of at least one of the interrogated test loci, thereby diagnosing a disease resulting from the chromosomal abnormality,\n
wherein the at least one test locus is located on a region of the chromosome that is not within a copy number variable region on the chromosome."],"number":32,"annotation":false,"claim":true,"title":false},{"lines":["Use of the method of claim 1 for diagnosing a disease resulting from a chromosomal abnormality."],"number":33,"annotation":false,"claim":true,"title":false},{"lines":["Use of the array of claim 22 for diagnosing a disease resulting from a chromosomal abnormality."],"number":34,"annotation":false,"claim":true,"title":false},{"lines":["Use of the kit of claim 28 for diagnosing a disease resulting from a chromosomal abnormality."],"number":35,"annotation":false,"claim":true,"title":false}]}},"filters":{"npl":[],"notNpl":[],"applicant":[],"notApplicant":[],"inventor":[],"notInventor":[],"owner":[],"notOwner":[],"tags":[],"dates":[],"types":[],"notTypes":[],"j":[],"notJ":[],"fj":[],"notFj":[],"classIpcr":[],"notClassIpcr":[],"classNat":[],"notClassNat":[],"classCpc":[],"notClassCpc":[],"so":[],"notSo":[],"sat":[]},"sequenceFilters":{"s":"SEQIDNO","d":"ASCENDING","p":0,"n":10,"sp":[],"si":[],"len":[],"t":[],"loc":[]}}